Stem Cells http://www.epitomics.com
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sogo, S.
Right arrow Articles by Ikehara, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sogo, S.
Right arrow Articles by Ikehara, S.
Stem Cells, Vol. 15, No. 6, 420-429, November 1997
© 1997 AlphaMed Press

Induction of c-kit Molecules on Human CD34+/c-kit<low Cells: Evidence for CD34+/c-kit<low Cells as Primitive Hematopoietic Stem Cells

Shinji Sogoa,b, Muneo Inabab, Hajime Ogatac, Hiroko Hishab, Yasushi Adachib, Shin-ichiro Morib, Junko Tokib, Kazuya Yamanishia, Hideharu Kanzakid, Masakazu Adachia, Susumu Ikeharab

a Cellular Technology Institute, Otsuka Pharmaceutical Co., Ltd., Tokushima, Japan;
b First Department of Pathology,
c Department of Pediatrics,
d Department of Obstetrics and Gynecology, Kansai Medical University, Moriguchi City, Osaka, Japan

Key Words. c-kit • CD34 • Human cord blood • Hematopoietic stem cells

Dr. Susumu Ikehara, First Department of Pathology, Kansai Medical University, 10-15 Fumizono-cho, Moriguchi City, Osaka 570, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
c-kit, a receptor for stem cell factor, has been widely accepted as a distinctive marker for hematopoietic stem cells. However, the level of c-kit expression on pluripotent hematopoietic stem cells is still controversial in mice and humans. We purified CD34+/c-kit<low cells (phenotypically c-kit-negative but only detectable at the message level) from human cord blood and examined their maturational steps in relation to the expression of c-kit molecules. When the CD34+/c-kit<low cells were cultured with cytokines (flt 3 ligand, interleukin 6 and interleukin 7) plus immobilized anti-CD34 monoclonal antibody (to crosslink CD34 molecules), c-kit molecules were clearly induced within 24 h. The c-kit expression gradually increased until day 8. When CD34+/c-kitlow or CD34+/c-kit+ cells that had been induced from CD34+/c-kit<low cells were resorted and recultured using a methylcellulose culture system, they showed the same colony-forming ability as the freshly isolated CD34+/c-kitlow or CD34+/c-kit+ cells, respectively. Furthermore, CD34+/c-kit<low cells have a similar hematopoietic potential to CD34+/c-kitlow cells in assays for long-term culture initiating cell and colony-forming unit culture generated from long-term cultures. These findings suggest that CD34+/c-kit<low cells mature into CD34+/c-kitlow and CD34+/c-kit+ cells, and acquire the reactivity to various humoral hematopoietic stimuli. Moreover, CD34+/c-kit<low cells showed a low level of rhodamine 123 retention, suggesting that CD34+/c-kit<low cells have multidrug resistance. Therefore, the CD34+/c-kit<low cells without colony-forming unit-granulocyte-erythroid-macrophage-megakaryocyte activity are also a pluripotent hematopoietic stem cell population, and the expression of c-kit on c-kit<low cells is the first maturational step of hematopoiesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pluripotent hematopoietic stem cells (P-HSCs) are defined as cells with the capacity to eternally self-renew and to differentiate into all hematopoietic lineage cells. In humans, HSCs have been characterized as CD34+ cells; they possess colony-forming activity when bone marrow (BM), cord blood (CB), and mobilized peripheral blood are cultured [1-4]. Other immunophenotypes defining primitive HSCs have been reported to be CD34+/CD38, CD34+/Thy-1+, CD34+/Lineage(Lin)/CD41a, CD34+/HLA-DR or CD34+/HLA-DR+/Rhodamine 123 (Rh123)dull, based on the assays for high proliferative potential colony-forming cells (HPP-CFC) or long-term culture-initiating cells (LTC-IC). CD34+/CD38 cells can generate colony-forming unit-culture (CFU-C) in LTC-IC assay [5]. Most LTC-IC, cobblestone area-forming cells, and cells reconstituting the thymus implant in severe combined immunodeficiency human mice are contained in the CD34+/Thy-1low population [6-8]. The CD34+/Lin/CD41a population in the fetal BM contains a significantly high frequency of cobblestone area-forming cells [9]. The cells possessing the capacity for self-renewal and commitment to multipotential hematopoietic differentiation were found in the CD34+/HLA-DR population [10], though there has been a report that LTC-IC are present in the CD34+/HLA-DR+ population, and that HPP-CFC are in the CD34+/HLA-DR+/Rh123dull population [11].

Another functionally and phenotypically important molecule is c-kit. c-kit is known as a receptor for stem cell factor (SCF) which plays an important role in the early stage of hematopoiesis [12-15]. In previous studies, it was found that the CD34+/c-kitlow population contained the majority of cycle-dormant progenitors, multilineage colony-forming cells (colony-forming unit granulocyte-erythroid-macrophage-megakaryocyte [CFU-GEMM]) and LTC-IC [16-18]. In addition, long-term reconstituting activity (LTRA) was found to be enriched in the CD34+/c-kitlow population using an in utero transplantation system [19]. In contrast, CD34+/c-kit cells were rejected as P-HSCs because of their low proliferative responses or the absence of such responses to several stimuli [14, 16-20], in spite of the existence of these cells in the human BM and CB. However, it has also been shown that the expression of c-kit molecules on HSCs is dependent on the differentiation steps [14, 20, 21]. Therefore, there is a possibility that the induction of c-kit molecules is a first step in the differentiation of P-HSCs, being accompanied by the acquirement of reactivity to SCF. Furthermore, taking the dormancy of HSCs into consideration, it would be logical for HSCs not to express c-kit on their surface and so protect them from stimuli that would induce them to enter the cell cycle. In this sense, CD34+/c-kit<low cells could be more primitive HSCs. Actually, in mice, we have very recently found that Lin/CD71/MHC class Ihigh/c-kit<low cells (phenotypically negative, but c-kit mRNA was detected by reverse transcriptase polymerase chain reaction [RT-PCR] assay) have LTRA in comparison with Lin/CD71/MHC class Ihigh/c-kitlow cells [22]. This finding prompted us to examine whether human P-HSCs are c-kit<low, c-kitlow, or c-kit+. In this report, we show that c-kit molecules can be induced on the purified CD34+/c-kit<low cells as a first maturational step of hematopoiesis, and we also compare the colony-forming activity of CD34+/c-kit<low cells with that of induced and freshly isolated CD34+/c-kitlow or c-kit+ cells. In addition, we show that CD34+/c-kit<low cells have a potential as P-HSCs in the long-term culture with the BM stromal cell line, MS-5.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Preparation and Purification of CD34+/c-kit (CD34+/c-kit<low) Cells
The CB cells were collected in acid-citrate-dextrose according to the guidelines of the Cord Blood Bank, Kansai Medical University (Osaka, Japan; fully informed consent was obtained from the mothers). BM cells were obtained from normal healthy volunteers. RBCs were sedimented out by the addition of a half volume of 2% Dextran, and mononuclear cells were isolated by using LymphoprepTM (Nycomed; Oslo, Norway) density gradient centrifugation. CD34-bearing cells were positively isolated using anti-CD34 class II monoclonal antibodies (mAb) (QBend-10) and CD34 multisort kit (Miltenyi Biotec; Bergisch Gladbach, Germany) followed by the Mini MACS system (Miltenyi Biotec). The purified CD34+ cells were then stained with fluorescein isothiocyanate (FITC)-conjugated mAb against CD34 class III (HPCA2; Becton Dickinson Immunocytometry Systems; San Jose, CA), which did not share the epitope recognized by anti-CD34 class II specific mAb (QBend-10) [23], and phycoerythrin (PE)-conjugated anti-c-kit (anti-CD117) mAb (Immunotech; Marseille, France). The cells with phenotype of CD34+/c-kit+, CD34+/c-kitlow, and CD34+/c-kit were isolated using a FACStarTM (Becton Dickinson Immunocytometry Systems), as shown in Figure 1.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Preparation of c-kit, c-kitlow, and c-kit+ populations from CD34+ cells. CD34+ cells isolated from the CB were stained with FITC-conjugated anti-CD34 mAb and PE-conjugated anti-c-kit mAb. A) Forward scatter versus side scatter pattern of CD34+ cells: Live CD34+ cells were gated as shown in R1. B) CD34 versus c-kit pattern of the cells: R2, R3 and R4 are the gates for sorting CD34+/c-kit, CD34+/c-kitlow and CD34+/c-kit+ populations, respectively. C) FACS profile of the cells stained with isotype-matched control mAbs.

 
Cell Cultures
Sorted cells were seeded in 24-well culture plates (Flow Laboratories, Inc.; McLean, VA) precoated with anti-CD34 mAb (HPCA2; 10 µg/ml, to crosslink CD34 molecules), and were cultured in {alpha}-modified Eagle's medium (GIBCO; Grand Island, NY) supplemented with 10% heat-inactivated fetal bovine serum ([FBS]; Stem Cell Technologies, Inc.; Vancouver, BC, Canada), 10% heat-inactivated horse serum ([HS]; Stem Cell Technologies, Inc.), 100 ng/ml of recombinant human (rHu) flt 3 ligand (FL) (Genzyme; Cambridge, MA), 10 ng/ml of rHu interleukin 6 (IL-6) (Boehringer Mannheim Biomedica; Indianapolis, IN), and 10 ng/ml of rHuIL-7 (Genzyme) for various culture periods in a humidified atmosphere at 37°C in 5% CO2.

Flow Cytometric Analyses and Colony-Forming Assays
Cells were harvested and double-stained with FITC-conjugated anti-CD34 (HPCA2) and PE-conjugated anti-c-kit mAbs. Expression of cell-surface antigens was evaluated using a FACScanTM (Becton Dickinson Immunocytometry Systems). Sorted cells, or cells harvested from the liquid culture of CD34+/c-kit cells, were assayed for their ability to produce burst forming unit-erythroid (BFU-E), colony-forming unit-granulocyte-macrophage (CFU-GM), colony-forming unit-macrophage (CFU-M) and CFU-GEMM in a methylcellulose assay system. Briefly, cells (50 cells/well) were added to 0.8 ml of culture mixture (Methocult GF H4434; Stem Cell Technologies, Inc.) consisting of 0.9% methylcellulose, 30% FBS, 1% bovine serum albumin, 10–4M 2-mercaptoethanol, 2 mM L-glutamate, rHu erythropoietin (EPO), rHuSCF, rHuGM-CSF, rHuG-CSF and rHuIL-3 (concentrations of CSFs were optimally conditioned to form BFU-E, CFU-GM, CFU-M and CFU-GEMM) in 12-well culture plates (Flow Laboratories, Inc.) The plates were incubated for 14 days, and the numbers of colonies were counted under an inverted microscope. The average number of colonies and standard errors were calculated from quadruplicated wells.

LTC-IC Assay
The assay for LTC-IC was carried out according to the modified method described by Young et al. [24]. Briefly, sorted CD34+/c-kit<low cells or CD34+/c-kitlow cells (103 cells/flask) were plated on murine BM stromal cell line (MS-5) in the presence of rHuIL-3 (1 ng/ml), rHuIL-6 (1 ng/ml), rHuG-CSF (1 ng/ml), rHuSCF (1 ng/ml), rHu leukemia inhibitory factor (1 ng/ml), and rHu FL (20 ng/ml) in Iscove's modified Dulbecco's medium with 10% FBS. At weekly intervals, the supernatant was removed and replaced by fresh medium containing cytokines. The nonadherent cells in the supernatant were counted. Nonadherent cells harvested from LTC-IC were further cultured for the colony-forming assay (CFU-C) under the same conditions described above.

Detection of c-kit Transcript by RT-PCR
The sorted CD34+/c-kit and CD34+/c-kitlow cells (3.6 x 103 cells, each) were lyzed with RNA STAT-60 (TEL-TEST"B"; Friendswood, TX) in the presence of 2 mg of yeast ribosomal RNA (TOYOBO; Tokyo, Japan) as a carrier, and total RNA was extracted according to the manufacturer's protocol. The RT-PCR was performed using oligo-dT primers for RT; human c-kit 5' sense (ATGGCACGGTTGAATGTAAGGC) and 3' antisense (TCTCCTCAACAACCTTCCACTG) were used as primers for PCR.

Rh123 Staining and Efflux
The staining and efflux procedure for Rh123 was described previously [25] and was modified as follows. Briefly, CD34+ cells were incubated with 100 ng/ml of Rh123 (Molecular Probes; Eugene, OR) for 20 min at 37°C. The cells were washed and incubated at 4°C or 37°C for 40 min to determine Rh123 dye efflux. The cells were then washed and stained with PE-conjugated anti-c-kit mAb and PE-Cyanin 5-conjugated anti-CD34 mAb. The fluorescence intensity of Rh123 was detected in FL1 (535 nm) using a FACScanTM (Becton Dickinson Immunocytometry Systems).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Purification of CD34+/c-kit Cells
Positively isolated CD34+ cells from the CB cells were stained with FITC-conjugated anti-CD34 class III and PE-conjugated anti-c-kit mAbs. The forward scatter versus side scatter pattern and the expression of CD34/c-kit are represented in Figure 1A and 1B, respectively. The regions (R) in Figure 1B show the sorting gates for purifying CD34+/c-kit cells (R2), CD34+/c-kitlow (R3), and CD34+/c-kit+ (R4). Figure 1C represents a FACS profile stained with FITC- or PE-conjugated isotype-matched control mAbs to determine the sorting regions for each cell population. The populations (R2-R4) sorted using a FACStarTM were reanalyzed using a FACScanTM to confirm the intensity of c-kit expression. Peak intensities of c-kit expression in the sorted populations corresponded to the sorting gates (R2-R4). In particular, the intensity of c-kit<low cells was lower than that of the negative controls stained by isotype-matched control mAb (mouse IgG1) or unstained.

c-kit mRNA in CD34+/c-kit Cells
The c-kit transcripts in CD34+/c-kitlow cells and CD34+/c-kit cells were next compared by RT-PCR analyses. Substantial expression of c-kit mRNA was detected even in the c-kit cells (data not shown). Based on this finding, we defined the cells as "c-kit<low" instead of "c-kit", although the cells appeared to be "c-kit" in FACS analyses, as shown in Figure 1B.

Colony-Forming Ability of CD34+/c-kit<low Cells
The colony-forming ability of the sorted CD34+/c-kit<low, CD34+/c-kitlow, and CD34+/c-kit+ cells was next determined using a methylcellulose culture system containing SCF, EPO, GM-CSF, G-CSF and IL-3. The ability of CD34+/c-kit<low cells to form BFU-E, CFU-GM, CFU-M or CFU-GEMM was less than that of the other two populations ( Table 1). It should be noted that no CFU-GEMM colony was detected in the culture of CD34+/c-kit<low cells. Thus, CD34+/c-kit<low cells have less reactivity to these stimuli.


View this table:
[in this window]
[in a new window]
 
Table 1. Colony-forming ability of sorted cells
 
Induction of c-kit Molecules by In Vitro Culture and Kinetics of c-kit Expression
The induction of c-kit molecules on the purified CD34+/c-kit<low cells was next examined using a combination of hematopoietic stimuli: FL, IL-6, IL-7 and immobilized anti-CD34 mAb (we did not use SCF as a stimulus for the induction of c-kit<low cells because c-kit<low cells are actually c-kit in the FACS level). Three populations of CD34+ cells were sorted on the basis of c-kit expression, cultured for 24 to 72 h, then stained with FITC-conjugated anti-CD34 and PE-conjugated anti-c-kit mAbs. As shown in Figure 2A (center panel), c-kit molecules were clearly induced on CD34+/c-kit<low cells after 24-h culture with FL, IL-6, IL-7 and immobilized anti-CD34 mAb. After a three-day culture, the intensity of the c-kit molecules increased to the higher level, and a new population with a phenotype of CD34low/c-kitlow appeared, as shown in Figure 2A (right panel). This population, however, seemed to be well-differentiated and myeloid-committed, since it expressed CD33 and CD11b (data not shown) instead of decreased expression of CD34 and c-kit. Moreover, after culture of the other two populations (CD34+/c-kit+ [R4 in Fig. 1B] and CD34+/c-kitlow cells [R3 in Fig. 1B]), the expression of c-kit on these populations also increased under the same culture conditions. The kinetics of c-kit molecule induction were next monitored from day 0 to day 12 in the presence of these stimuli. Figure 2B plots the mean channels of fluorescence intensity at each time point of the CD34+ cells. The c-kit molecules were induced by 24 h, and the expression intensity increased to the maximum level on day 8.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. CD34+/c-kit<low cells stimulated with FL, IL-6, IL-7 and immobilized anti-CD34 mAb. A) Expression patterns of c-kit molecules in precultured (day 0), one-day cultured and three-day cultured cells. B) Kinetics of c-kit expression in cultured CD34+/c-kit<low cells in vitro.

 
Essential Stimuli for Induction of c-kit Molecules
CD34+/c-kitlow cells were induced from CD34+/c-kit<low cells after short-term culture with FL, IL-6, IL-7 and immobilized anti-CD34 mAb. We next withdrew these stimuli one by one to determine which stimuli were necessary for the induction of c-kit molecules. c-kit molecules were induced on CD34+/c-kit<low cells by any stimulus or any combination after a 24-h culture, although FL is necessary for their further development into CD34+/c-kithigh cells) ( Fig. 3). It should be noted that the induction of c-kit molecules is observed without any exogenous hematopoietic stimulus (as shown in Fig. 3G). The recovery of the cultured cells decreased when the stimuli were withdrawn (the numbers of cultured cells with or without stimuli are shown in the legend for Fig. 3). These findings indicate that stimulation by FL, IL-6, IL-7 or anti-CD34 mAb was not essential for the induction of c-kit molecules, but for the maintenance of the induced CD34+/c-kitlow or + cells. Furthermore, as shown in Figure 4B, the induction of c-kit molecules was observed even in the absence of FBS and HS, which might contain some hematopoietic stimuli. This indicates that the transition from c-kit<low cells to c-kitlow cells occurs without exogenous cytokines. However, it should be noted that c-kitlow or c-kit+ cells do not develop when c-kit<low cells are cultured in polypropylene tubes ( Fig. 4C), where cell adhesion may be blocked. It therefore seems that adhesive signals are essential to the induction of c-kit molecules on CD34+/c-kit<low cells.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Induction of c-kit molecules on CD34+/c-kit<low cells cultured with various stimuli. Sorted CD34+/c-kit<low cells (7,000 cells) were cultured with: A) FL + IL-6 + IL-7 + immobilized anti-CD34 mAb; B) FL + IL-6 + IL-7; C) FL + IL-6; D) immobilized anti-CD34 mAb; E) IL-6; F) FL, and G) medium alone for three days. Each cell was harvested, counted and assessed for its expression of c-kit molecules. Recovered cell counts were 5,500 (A), 6,000 (B), 3,000 (C), 1,500 (D), 2,500 (E), 3,000 (F) and 500 (G), respectively.

 


View larger version (10K):
[in this window]
[in a new window]
 
Figure 4. Essential stimuli in induction of c-kit molecules. CD34+/c-kit<low cells were suspended with Iscove's modified Dulbecco's medium containing 10% FBS (A, C) or serum-free medium based on Iscove's modified Dulbecco's medium (B). Cells were cultured in culture-coated plates for cell adhesion (A, B) or in polypropylene tubes (C) for 24 h. The cells were harvested, stained with FITC-anti-CD34 class III mAb plus PE-anti-c-kit mAb, and analyzed using a FACScanTM.

 
Colony-Forming Ability of c-kitlow or c-kit+ Cells Induced from CD34+/c-kit<low Cells
The colony-forming ability of CD34+/c-kitlow or CD34+/c-kit+ cells that had been induced from CD34+/c-kit<low cells was next determined. Purified CD34+/c-kit<low cells were cultured with FL, IL-6, IL-7 and immobilized anti-CD34 mAb for two days, and CD34+/c-kitlow or CD34+/c-kit+ cells were resorted and recultured in a methylcellulose culture system containing SCF, GM-CSF, G-CSF, IL-3 and EPO for 14 days. As shown in Table 2, the induced CD34+/c-kitlow or CD34+/c-kit+ cells showed the same colony-forming ability as the freshly isolated CD34+/c-kitlow or CD34+/c-kit+ cells, respectively. Furthermore, we detected CFU-GEMM when the freshly isolated or resorted CD34+/c-kitlow or CD34+/c-kit+ cells (but not CD34+/c-kit<low cells) were cultured. Thus, CD34+/c-kit<low cells can functionally mature into CD34+/ c-kitlow and CD34+/c-kit+ cells in vitro. In this sense, the CD34+/c-kit<low cells are the earlier stage of cells, and the changes in their immunophenotype (from c-kit to c-kitlow) is the first maturational step of P-HSCs.


View this table:
[in this window]
[in a new window]
 
Table 2. Colony-forming ability of resorted c-kit+ cells
 
Induction of c-kit Molecules on CD34+/c-kit<low Cells in BM
CD34+/c-kit<low cells were sorted from adult human BM cells, and were stimulated with FL, IL-6, IL-7 and immobilized anti-CD34 mAb. CD34+/c-kitlow or CD34+/c-kit+ cells developed from CD34+/c-kit<low cells within 24 h, although a significant population of CD34+/c-kit<low cells remained.

Capacity of the Sorted CD34+/c-kit<low Cells to Maintain and Produce CFU-C in LTC
The LTC is considered to be the most informative in vitro assay for stem cell activity. As shown in Figure 5A, the numbers of nonadherent cells generating from CD34+/c-kit<low cells were comparable to those in the culture of CD34+/ c-kitlow cells over the culture period (until 90 days). The ability to form CFU-C in nonadherent cells from the LTC was further investigated. Cells harvested from the LTC of CD34+/c-kit<low cells have a similar CFU-C activity to that of CD34+/c-kitlow cells ( Fig. 5B). These findings clearly indicate that CD34+/c-kit<low cells have the potential of P-HSCs.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. LTC-IC assay. A) Sorted CD34+/c-kit<low cells (closed circle) or CD34+/c-kitlow cells (open circle) (103 cells/flask) were plated on murine stromal cell line (MS-5) in the presence of hematopoietic cytokines. At weekly intervals, the number of nonadherent cells was counted. B) Nonadherent cells harvested from the LTC were further cultured (300 cells/well) for colony-forming assay under the same conditions described in Table 1. Values in A and B represent mean of four cultures.

 
Efflux of Rh123 from CD34+/c-kit<low Cells
CD34+ cells were stained with Rh123 and then washed and incubated at 4°C or 37°C for 40 min to determine the dye efflux. Rh123 was retained in the CD34+ cell at 4°C while accelerated dye efflux was observed when incubated at 37°C ( Fig. 6A). To evaluate the activity of dye efflux in CD34+/ c-kit<low cells after staining with Rh123, the CD34+ cells were further stained with anti-CD34 and anti-c-kit mAbs. The retention of Rh123 in CD34+/c-kit<low, CD34+/c-kitlow or CD34+/c-kit+ cells is shown in Figure 6B. The CD34+/c-kit<low population had a higher capacity to exclude Rh123 dye than the other two populations. CD34+/c-kit<low cells are therefore Rh123low. This Rh123 efflux from CD34+ cells, which is due to an efflux pump (i.e., P-glycoprotein) [25], suggests that CD34+/c-kit<low cells are resistant to various cytotoxic substances.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. Rh123 efflux from CD34+/c-kit<low cells. CD34+ cells from the CB were stained with Rh123, washed, and incubated for 40 min at 4°C or 37°C (A). Rh123 retention was evaluated using CD34+/c-kit<low cells, CD34+/c-kitlow cells or CD34+/c-kit+ cells (B).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we have shown that CD34+/c-kit<low cells (phenotypically c-kit but only detectable at the message level) have the capacity to differentiate into CD34+/c-kitlow or CD34+/c-kit+ cells. Although a CD34+ population which does not express c-kit molecules exists in the human CB and BM, nobody has paid attention to CD34+/c-kit cells because of their low proliferative activity, or the absence of such activity, against various hematopoietic stimuli [14, 16-20]. In contrast, it has been shown that CD34+/c-kitlow cells have some of the characteristics of P-HSCs, including multilineage colony-forming abilities [16] and an LTRA in the in utero transplantation system [19]. Since the most primitive P-HSCs are thought to be dormant, it is conceivable that they are unresponsive to usual hematopoietic cytokines such as EPO, SCF, GM-CSF and IL-3. It has been reported that CD34+/c-kithigh cells develop from CD34+/c-kitlow cells during coculture with allogenic stromal cells or from liquid culture in the presence of SCF, IL-6 and EPO [18]. This indicates that the expression of c-kit is dependent on the maturational step in early hematopoiesis. Even in the murine system there are substantial data suggesting that c-kit+ cells are P-HSCs; c-kit+ cells have the activity of spleen colony formation, long-term multilineage reconstitution and in vitro proliferation in the presence of hematopoietic cytokines [26-30]. However, we have recently demonstrated that cells with LTRA are only enriched in the MHC class Ihigh/c-kit<low population (they express an extremely low level of c-kit molecules, but are only detected by RT-PCR) [22]. Therefore, it can be hypothesized that CD34+/c-kitlow or CD34+/c-kit+ cells with reactivity to hematopoietic cytokines are induced from dormant P-HSCs, CD34+/c-kit<low cells. The fact that isolated human CD34+ cells enter the cell cycle in the presence of SCF without any other growth factors [15] also supports our assumption that the expression of c-kit on CD34+/c-kit<low cells is the first maturational step of P-HSCs.

To prove this hypothesis, highly purified CD34+/c-kit<low cells were cultured with various stimuli that regulate hematopoiesis: FL [31], IL-6 [32-34], IL-7 [35] and immobilized anti-CD34 mAb to crosslink CD34 molecules [36, 37]. In this report, we have shown that the colony-forming ability of sorted CD34+/c-kit<low cells is less than that of the other two populations (CD34+/c-kit+, CD34+/c-kitlow), and that the stimulation with FL, IL-6, IL-7 and CD34 crosslinking induces the expression of c-kit molecules on CD34+/c-kit<low cells within 24 h of in vitro culture, then increases and reaches a plateau on day 8 of culture. It should be noted that the CD34+/c-kit+ and CD34+/c-kitlow cells generated from CD34+/c-kit<low cells acquired the ability to form multilineage colonies, as did the freshly isolated CD34+/c-kit+ or CD34+/c-kitlow populations, respectively. These data indicate that the changes in the expression of c-kit molecules reflect the changes not only in their immunophenotype but also in functional maturation of CD34+/c-kit<low cells. This is in accordance with the report by Gunji et al. [18] where: A) CD34+/c-kithigh cells are induced from CD34+/c-kitlow cells after four-week culture with stromal cells and B) LTC-ICs are enriched in the CD34+/c-kitlow population, but not in differentiated CD34+/c-kithigh cells with the ability to form CFU-GM. However, they only reported the induction of differentiation from c-kitlow to c-kithigh. Our purified CD34+/c-kit<low or low and CD34+/c-kit+ cells may correspond to CD34+/c-kit and CD34+/c-kitlow cells, respectively, in the previous reports, based on FCM pattern and colony-forming ability [16, 19]. Therefore, our results clearly show that the changes in the intensity of c-kit molecules are closely related to the earliest maturational phase of hematopoiesis. In our murine system, the substantial expression of c-kit mRNA was also detected using RT-PCR analyses even in the c-kit cells [22]. To explain this discrepancy, there are two possibilities below: A) this CD34+/c-kit cell expresses a very low level of c-kit molecules in spite of the "c-kit" immunophenotype in FACS analyses or B) c-kit protein synthesis from c-kit transcript is blocked by some system. Taking these findings into consideration, both in humans and mice, CD34+/c-kit<low cells appear to be an earlier population than CD34+/c-kitlow cells, and the changes in the immunophenotype (c-kit to c-kitlow) are the first maturational step of P-HSCs. Furthermore, both the CD34+/c-kit<low and CD34+/c-kitlow populations had a repopulating activity not only in long-term (>90 days) culture in the presence of hematopoietic cytokines but also in CFU-C assays from LTC. This may be due to the transition of CD34+/c-kitlow cells from the initial CD34+/c-kit<low cells during the culture period, since the induction of CD34+/c-kitlow cells from CD34+/c-kit<low cells occurs within three days ( Fig. 2).

As shown in Figure 2, the expression of c-kit molecules was immediately inducible in CD34+/c-kit<low cells, and this transition was unidirectional and irreversible in our in vitro culture system. However, only a small but steady number of CD34+/c-kit<low cells were detected in the CB, suggesting that a niche constructed by stromal cells or some cytokine(s) negatively regulate the induction of c-kit molecules and the reactivity to SCF to maintain dormant P-HSCs. The report that TNF-{alpha} and TGF-ß downregulate not only the c-kit m-RNA but also c-kit protein in CD34+/c-kithigh cells and CD34+ leukemia cells might support this possibility [38-40].

In our system, the transition of c-kit<low to c-kitlow occurred even in the absence of exogenous stimuli (hematopoietic cytokines, FBS and HS) ( Figs. 3 and 4). The addition of TGF-ß, macrophage inflammatory protein-1{alpha} and TNF-{alpha} inhibits the transition from c-kit+ cells to c-kithigh cells in our system. However, these cytokines did not affect the transition from c-kit<low cells to c-kit+ cells (data not shown). Though factor(s) regulating the c-kit induction in the CD34+/c-kit<low population were still unclear, the induction of c-kit molecules was completely inhibited when the cells were cultured in polypropylene tubes ( Fig. 4C). It is well known that cell adhesion is weaker in polypropylene tubes than in usual culture plates (polystyrene). Therefore, it is feasible that some adhesive signal(s) essentially regulates the induction of c-kit molecules on CD34+/c-kit<low cells, and the exogenous cytokines used in our system may support the survival of the cells and act synergistically with the adhesive signals. If this is the case, our findings may explain why the CD34+/c-kit<low population showed no colony formation in the methylcellulose culture system or in utero transplantation assay, where it is possible that no essential adhesion occurs [18, 19].

In the BM microenvironment, stromal cells appear to support quiescent P-HSCs and induce them to proliferate by the production of various soluble factors and cell-to-cell adhesion [41-46]. Primitive hematopoiesis could therefore be regulated by these mechanisms [47]. When CD34+/c-kit<low cells isolated from the BM were cultured, CD34+/c-kitlow or CD34+/c-kit+ cells developed from the CD34+/c-kit<low cells within 24 h, although a significant population of CD34+/c-kit<low cells still remained (data not shown), while only a minute population was present in the CB. This may indicate that the CD34+/ c-kit<low cells in the CB are more mature and, therefore, more sensitive to hematopoietic stimuli than those in the BM. These findings raise the possibility that real pluripotent HSCs are indeed c-kit cells that do not express even c-kit mRNA, and can develop into c-kit<low, c-kitlow and c-kit+ cells after the cognate interaction with some regulatory cells (i.e., stromal cells).

Rh123 is another useful reagent for defining the subset of P-HSCs [25], and the efflux of Rh123 is dependent on an efflux pump such as P-glycoprotein (the product of multidrug resistance gene) on hematopoietic cells [48]. In our experiment, there was less retention of Rh123 by the CD34+/c-kit<low cells than the CD34+/c-kitlow or CD34+/c-kit+ cells, indicating that the cells with a high level of Rh123 efflux are enriched in the CD34+/c-kit<low cells ( Fig. 6). Therefore, the CD34+/c-kit<low cells have multidrug resistance and can be protected from various cytotoxic substances. This is in accordance with the recent reports that P-HSCs in the BM are highly enriched in the CD34+/Thy-1+/Rh123low cells in humans [25] and that c-kit<low or c-kit cells remained after the injection of 5-fluorouracil in mice [22, 49, 50].

In conclusion, our findings clearly indicate that the immunophenotypical change from CD34+/c-kit<low to CD34+/c-kitlow or + is the first step in functional maturation in hematopoiesis. Even though the CD34+/c-kit<low cells have no ability to form CFU-GEMM, unlike CD34+/c-kitlow cells, both populations have similar repopulating activity in long-term culture, suggesting that CD34+/c-kit<low cells without CFU-GEMM activity are another P-HSC population and the functional maturation of the cells occurs immediately in this condition in association with immunophenotypical changes. Therefore, the presence of a CD34+/c-kit<low population in situ is physiologically important as a reservoir of dormant P-HSCs with multidrug resistance. Studies to clarify the mechanism(s) behind the regulation of the transition from c-kit<low to c-kitlow are now under way.


    Acknowledgments
 
We thank Mr. F. Ishida (Research Center of Kansai Medical University; Osaka, Japan) for flow cytometry studies, and Ms. K. Ando for preparing the manuscript.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bernstein ID, Andrews RG, Zsebo KM. Recombinant human stem cell factor enhances the formation of colonies by CD34+ and CD34+lin cells, and the generation of colony-forming cell progeny from CD34+lin- cells cultured with interleukin-3, granulocyte colony-stimulating factor, or granulocyte-macrophage colony-stimulating factor. Blood 1991;77:2316-2321.[Abstract/Free Full Text]

  2. Xiao M, Leemhuis T, Broxmeyer HE et al. Influence of combinations of cytokines on proliferation of isolated single cell-sorted human bone marrow hematopoietic progenitor cells in the absence and presence of serum. Exp Hematol 1992;20:276-279.[Medline]

  3. Lu L, Xiao M, Shen R-N et al. Enrichment, characterization, and responsiveness of single primitive CD34+++ human umbilical cord blood hematopoietic progenitors with high proliferative and replating potential. Blood 1993;81:41-48.[Abstract/Free Full Text]

  4. Siena S, Bregni M, Brando B et al. Circulation of CD34+ hematopoietic stem cells in the peripheral blood of high-dose cyclophosphamide-treated patients: enhancement by intravenous recombinant human granulocyte-macrophage colony-stimulating factor. Blood 1989;74:1905-1914.[Abstract/Free Full Text]

  5. Hao Q-L, Shah AJ, Thiemann FT et al. A functional comparison of CD34+CD38 cells in cord blood and bone marrow. Blood 1995;86:3745-3753.[Abstract/Free Full Text]

  6. Murray L, Chen B, Galy A et al. Enrichment of human hematopoietic stem cell activity in the CD34+Thy-1+Lin subpopulation from human mobilized peripheral blood. Blood 1995;85:368-378.[Abstract/Free Full Text]

  7. Craig W, Kay R, Cutler RL et al. Expression of Thy-1 on human hematopoietic progenitor cells. J Exp Med 1993;177:1331-1342.[Abstract/Free Full Text]

  8. Mayani H, Lansdorp PM. Thy-1 expression is linked to functional properties of primitive hematopoietic progenitor cells from human umbilical cord blood. Blood 1994;83:2410-2417.[Abstract/Free Full Text]

  9. Murray LJ, Mandich D, Bruno E et al. Fetal bone marrow CD34+CD41+ cells are enriched for multipotent hematopoietic progenitors, but not for pluripotent stem cells. Exp Hematol 1996;24:236-245.[Medline]

  10. Srour EF, Brandt JE, Briddell RA et al. Human CD34+HLA-DR bone marrow cells contain progenitor cells capable of self-renewal, multilineage differentiation, and long-term in vitro hematopoiesis. Blood Cells 1991;17:287-295.[Medline]

  11. Traycoff CM, Abboud MR, Laver J et al. Evaluation of in vitro behavior of phenotypically defined populations of umbilical cord blood hematopoietic progenitor cells. Exp Hematol 1994;22:215-222.[Medline]

  12. Katayama N, Clark SC, Ogawa M. Growth factor requirement for survival in cell-cycle dormancy of primitive murine lymphohematopoietic progenitors. Blood 1993;81:610-616.[Abstract/Free Full Text]

  13. Tsuji K, Lyman SD, Sudo T et al. Enhancement of murine hematopoiesis by synergistic interactions between steel factor (ligand for c-kit), interleukin-11, and other early acting factors in culture. Blood 1992;79:2855-2860.[Abstract/Free Full Text]

  14. Simmons PJ, Aylett GW, Niutta S et al. c-kit is expressed by primitive human hematopoietic cells that give rise to colony-forming cells in stroma-dependent or cytokine-supplemented culture. Exp Hematol 1994;22:157-165.[Medline]

  15. Gore SD, Amin S, Weng L-J et al. Steel factor supports the cycling of isolated human CD34+ cells in the absence of other growth factors. Exp Hematol 1995;23:413-421.[Medline]

  16. Laver JH, Abboud MR, Kawashima I et al. Characterization of c-kit expression by primitive hematopoietic progenitors in umbilical cord blood. Exp Hematol 1995;23:1515-1519.[Medline]

  17. Briddell RA, Broudy VC, Bruno E et al. Further phenotypic characterization and isolation of human hematopoietic progenitor cells using a monoclonal antibody to the c-kit receptor. Blood 1992;79:3159-3167.[Abstract/Free Full Text]

  18. Gunji Y, Nakamura M, Osawa H et al. Human primitive hematopoietic progenitor cells are more enriched in KITlow cells than in KIThigh cells. Blood 1993;82:3283-3289.[Abstract/Free Full Text]

  19. Kawashima I, Zanjani ED, Almaida-Porada G et al. CD34+ human marrow cells that express low levels of kit protein are enriched for long-term marrow-engrafting cells. Blood 1996;87:4136-4142.[Abstract/Free Full Text]

  20. De Jong MO, Wagemaker G, Wognum AW. Separation of myeloid and erythroid progenitors based on expression of CD34 and c-kit. Blood 1995;86:4076-4085.[Abstract/Free Full Text]

  21. Uoshima N, Ozawa M, Kimura S et al. Changes in c-kit expression and effects of SCF during differentiation of human erythroid progenitor cells. Br J Haematol 1995;91:30-36.[Medline]

  22. Doi H, Inaba M, Yamamoto Y et al. Pluripotent hematopoietic stem cells are c-kit<low. Proc Natl Acad Sci USA 1997;94:2513-2517.[Abstract/Free Full Text]

  23. Krause DS, Fackler MJ, Civin CI et al. CD34: structure, biology and clinical utility. Blood 1996;87:1-13.[Free Full Text]

  24. Young JC, Varma A, DiGiusto D et al. Retention of quiescent hematopoietic cells with high proliferative potential during ex vivo stem cell culture. Blood 1996;87:545-556.[Abstract/Free Full Text]

  25. Uchida N, Combs J, Chen S et al. Primitive human hematopoietic cells displaying differential efflux of the rhodamine 123 dye have distinct biological activities. Blood 1996;88:1297-1305.[Abstract/Free Full Text]

  26. Ikuta K, Weissman IL. Evidence that hematopoietic stem cells express c-kit, but do not depend on steel factor for their generation. Proc Natl Acad Sci USA 1992;89:1502-1506.[Abstract/Free Full Text]

  27. Orlic D, Fischer R, Nishikawa S-I et al. Purification and characterization of heterogeneous pluripotent hematopoietic stem cell populations expressing high levels of c-kit receptor. Blood 1993;82:762-770.[Abstract/Free Full Text]

  28. Ogawa M, Matsuzaki Y, Nishikawa S et al. Expression and function of c-kit in hematopoietic progenitor cells. J Exp Med 1991;174:63-71.[Abstract/Free Full Text]

  29. Taniguchi H, Toyoshima T, Fukao K et al. Presence of hematopoietic stem cells in the adult liver. Nat Med 1996;2:198-203.[Medline]

  30. Okada S, Nakauchi H, Nagayoshi K et al. Enrichment and characterization of murine hematopoietic stem cells that express c-kit molecules. Blood 1991;78:1706-1712.[Abstract/Free Full Text]

  31. Shah AJ, Smogorzewska EM, Hannum C et al. Flt3 ligand induces proliferation of quiescent human bone marrow CD34+CD38 cells and maintains progenitor cells in vitro. Blood 1996;87:3563-3570.[Abstract/Free Full Text]

  32. Ikebuchi K, Wong GG, Clark SC et al. Interleukin-6 enhancement of interleukin-3-dependent proliferation of multipotential hematopoietic progenitors. Proc Natl Acad Sci USA 1987;84:9035-9039.[Abstract/Free Full Text]

  33. Ikebuchi K, Ihle JN, Hirai Y et al. Synergistic factors for stem cell proliferation: further studies of the target stem cells and the mechanism of stimulation by interleukin-1, interleukin-6, and granulocyte colony-stimulating factor. Blood 1988;72:2007-2014.[Abstract/Free Full Text]

  34. Leary AG, Ikebuchi K, Hirai Y et al. Synergism between interleukin-6 and interleukin-3 is supporting proliferation of human hematopoietic stem cells: comparison with interleukin-1 alpha. Blood 1988;71:1759-1763.[Abstract/Free Full Text]

  35. Jacobsen FW, Rusten LS, Jacobsen SEW. Direct synergistic effects of interleukin-7 on in vitro myelopoiesis of human CD34+ bone marrow progenitors. Blood 1994;84:775-779.[Abstract/Free Full Text]

  36. Majdic O, Stockl J, Pickl WF et al. Signaling and induction of enhanced cytoadhesiveness via the hematopoietic progenitor cell surface molecule CD34. Blood 1994;83:1226-1234.[Abstract/Free Full Text]

  37. Healy L, May G, Gale K et al. The stem cell antigen CD34 functions as a regulator of hemopoietic cell adhesion. Proc Natl Acad Sci USA 1995;92:12240-12244.[Abstract/Free Full Text]

  38. Dubois CM, Ruscetti FW, Stankova J et al. Transforming growth factor-ß regulates c-kit message stability and cell-surface protein expression in hematopoietic progenitors. Blood 1994;83:3138-3145.[Abstract/Free Full Text]

  39. Sansilvestri P, Cardoso AA, Batard P et al. Early CD34high cells can be separated into KIThigh cells in which transforming growth factor-ß (TGF-ß) downmodulates c-kit and KITlow cells in which anti-TGF-ß upmodulates c-kit. Blood 1995;86:1729-1735.[Abstract/Free Full Text]

  40. Khoury E, Andre C, Pontvert-Delucq S et al. Tumor necrosis factor {alpha} (TNF{alpha}) downregulates c-kit proto-oncogene product expression in normal and acute myeloid leukemia CD34+ cells via p55 TNF{alpha} receptors. Blood 1994;84:2506-2514.[Abstract/Free Full Text]

  41. Allen TD, Dexter TM. The essential cells of the hemopoietic microenvironment. Exp Hematol 1984;12:517-521.[Medline]

  42. Verfaillie CM. Soluble factor(s) produced by human marrow stroma increase cytokine-induced proliferation and maturation of primitive hematopoietic progenitors while preventing their terminal differentiation. Blood 1993;82:2045-2053.[Abstract/Free Full Text]

  43. Verfaillie C, Blakolmer K, McGlave P. Purified primitive human hematopoietic progenitor cells with long-term in vitro repopulating capacity adhere selectively to irradiated bone marrow stroma. J Exp Med 1990;172:509-520.[Abstract/Free Full Text]

  44. Liesveld JL, Winslow JM, Kempski MC et al. Adhesive interactions of normal and leukemic human CD34+ myeloid progenitors: role of marrow stromal, fibroblast and cytomatrix components. Exp Hematol 1991;19:63-70.[Medline]

  45. Young JC, Varma A, DiGiusto D et al. Retention quiescent hematopoietic cells with high proliferative potential during ex vivo stem cell culture. Blood 1996;87:545-556.

  46. Hong D-S, Beckham C, Huss R et al. Major histocompatibility complex class II-mediated inhibition of hematopoiesis in long-term marrow cultures involves apoptosis and is prevented by c-kit ligand. Blood 1995;86:3341-3352.[Abstract/Free Full Text]

  47. Levesque J-P, Haylock DN, Simmons PJ. Cytokine regulation of proliferation and cell adhesion are correlated events in human CD34+ hemopoietic progenitors. Blood 1996;88:1168-1176.[Abstract/Free Full Text]

  48. Chaudhary PM, Roninson IB. Expression and activity of P-glycoprotein, a multidrug efflux pump, in human hematopoietic stem cells. Cell 1991;66:85-94.[Medline]

  49. Nishio N, Hisha H, Ogata H et al. Changes in markers, receptors and adhesion molecules expressed on murine hematopoietic stem cells after a single injection of 5-fluorouracil. STEM CELLS 1996;14:584-591.[Abstract]

  50. Katayama N, Shih J-P, Nishikawa S-I et al. Stage-specific expression of c-kit protein by murine hematopoietic progenitors. Blood 1993;82:2353-2360.[Abstract/Free Full Text]

accepted for publication August 14, 1997.



This article has been cited by other articles:


Home page
Stem CellsHome page
T. Kimura, R. Asada, J. Wang, T. Kimura, M. Morioka, K. Matsui, K. Kobayashi, K. Henmi, S. Imai, M. Kita, et al.
Identification of Long-Term Repopulating Potential of Human Cord Blood-Derived CD34-flt3- Severe Combined Immunodeficiency-Repopulating Cells by Intra-Bone Marrow Injection
Stem Cells, June 1, 2007; 25(6): 1348 - 1355.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Matsumura-Takeda, S. Sogo, Y. Isakari, Y. Harada, K. Nishioka, T. Kawakami, T. Ono, and T. Taki
CD41+/CD45+ Cells Without Acetylcholinesterase Activity Are Immature and a Major Megakaryocytic Population in Murine Bone Marrow
Stem Cells, April 1, 2007; 25(4): 862 - 870.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
G. Yang, H. Hisha, Y. Cui, T. Fan, T. Jin, Q. Li, Z. Lian, N. Hosaka, Y. Li, and S. Ikehara
A New Assay Method for Late CFU-S Formation and Long-Term Reconstituting Activity Using a Small Number of Pluripotent Hemopoietic Stem Cells
Stem Cells, May 1, 2002; 20(3): 241 - 248.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
S. Ikehara
Pluripotent Hemopoietic Stem Cells in Mice and Humans
Experimental Biology and Medicine, February 1, 2000; 223(2): 149 - 155.
[Abstract] [Full Text]


Home page
Stem CellsHome page
B. Feng, M. Inaba, Z. Lian, Y. Cui, J. Toki, T. Ito, T. Jin, T. Fan, G. Yang, C. Yu, et al.
Development of Mouse Dendritic Cells from Lineage-Negative c-kit‹low Pluripotent Hemopoietic Stem Cells In Vitro
Stem Cells, January 1, 2000; 18(1): 53 - 60.
[Abstract] [Full Text]


Home page
BloodHome page
S. Reid, A. Ritchie, L. Boring, J. Gosling, S. Cooper, G. Hangoc, I. F. Charo, and H. E. Broxmeyer
Enhanced Myeloid Progenitor Cell Cycling and Apoptosis in Mice Lacking the Chemokine Receptor, CCR2
Blood, March 1, 1999; 93(5): 1524 - 1533.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Z. Lian, B. Feng, K. Sugiura, M. Inaba, C. Yu, T. Jin, T. Fan, Y. Cui, R. Yasumizu, J. Toki, et al.
c-kit
Stem Cells, January 1, 1999; 17(1): 39 - 44.
[Abstract] [Full Text]


Home page
Stem CellsHome page
C.-Z. Yu, H. Hisha, Y. Li, Z. Lian, T. Nishino, J. Toki, Y. Adachi, M. Inaba, T.-X. Fan, T. Jin, et al.
Stimulatory Effects of Hepatocyte Growth Factor on Hemopoiesis of SCF/c-kit System-Deficient Mice
Stem Cells, January 1, 1998; 16(1): 66 - 77.
[Abstract] [Full Text]


Home page
Stem CellsHome page
Z. Lian, J. Toki, C. Yu, H. Hayashi, R. Yasumizu, K. Sugiura, T. Jin, M. Inaba, H. Hisha, Y. Li, et al.
Intrathymically Injected Hemopoietic Stem Cells Can Differentiate into All Lineage Cells in the Thymus: Differences Between c-kit+ Cells and c-kit
Stem Cells, November 1, 1997; 15(6): 430 - 436.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sogo, S.
Right arrow Articles by Ikehara, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sogo, S.
Right arrow Articles by Ikehara, S.