|
|
||||||||
Department of Anatomy and Cell Biology, University of Iowa, Iowa City, Iowa, USA
Key Words. Stem Cells • Endothelial cell • Angiogenesis • CD34 • Monocyte • CD14
Gina C. Schatteman, Ph.D., Anatomy and Cell Biology, BSB 1402, University of Iowa, Iowa City, IA 52242, USA. Telephone: 319-335-7765; Fax: 319-335-7198; email: gina-schatteman{at}uiowa.edu
| Abstract |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
It has never been demonstrated directly that CD34+ cells are angioblasts, but several studies suggest that CD34+ cells are enriched for angioblasts and CD34 cells lack them. For example, leukocytes enriched for CD34+ cells, but not those depleted of CD34+ cells (CD34 cells), produced EC in vitro [3, 5]. Also, vital dye labeling of CD34+-enriched cells in coculture with unlabeled CD34 cells suggested that all of the cells were derived from the CD34+ cell-enriched fraction [3]. Additionally, in vivo, exogenous human leukocytes enriched for CD34+ cells, but rarely CD34 cells incorporated into the hind limb vasculature of mice recovering from hind limb ischemia [3, 7, 8]. Moreover, while exogenous CD34 cells had no effect on the rate of restoration of blood flow to the ischemic limb, CD34+ cells profoundly accelerated it [7, 8].
Nevertheless, three factors led us to consider the idea that angioblasts might be present among CD34 cells. First, over the past several years, it has become clear that subsets of both CD34+ and CD34 cells are capable of long-term hematopoietic repopulation [9-11]. Because embryologically EC progenitors and hematopoietic stem cells are related, we have postulated that the same may be true in adults [12]. Thus, if angioblasts are related to hematopoietic stem cells, they could be either CD34+ or CD34. Second, because only ~0.1% of leukocytes express CD34 and yet as many as 10% of EC in the mouse neovasculature are blood-derived cells, we questioned whether such a small population could have such a profound effect on neovascularization [8, 13, 14]. Third, since monocytes traverse the vascular wall during injury, share many antigenic characteristics with EC, and are responsive to vascular endothelial growth factor (VEGF) (and VEGF appears to mobilize angioblasts), we considered the possibility that monocytic cells might also function as EC progenitors [15-18].
In this study we examined the potential of CD34 cells, and two different subsets of CD34 cells that are enriched for monocytes to produce EC. We demonstrate that CD34 and particularly CD34 monocyte-enriched cells readily differentiate into EC-like cells in culture and that they incorporate into the neovasculature in vivo when co-injected with CD34+ cells. Our findings indicate that cells with an angioblastic potential are abundant in the blood, that monocytes probably act as angioblasts, and that leukocyte-leukocyte interactions may play an important role in modulating angioblast behavior.
While this work was under way, two studies were published that support the hypothesis that monocytic-like cells can function as angioblasts. In the first, Fernandez-Pujol and colleagues showed that under appropriate in vitro conditions, CD14+ cells (which are typically CD34) differentiate into EC-like cells exhibiting characteristics of both EC and monocytes [19]. More recently, Moldovan et al. found that when macrophages were induced to infiltrate the heart by overexpression of MCP-1, the invading macrophages appeared to form erythrocyte-containing vascular-like channels reminiscent of the tumor cell-derived vascular channels seen in some tumors [20, 21]. However, cells of the monocytic channels lack some EC antigens and may themselves be subsequently colonized by EC or angioblasts.
| METHODS |
|---|
|
|
|---|
Fluorescence-Activated Cell Sorter (FACS) Analysis
To assess the purity of leukocyte subsets, freshly isolated cells were subjected to FACS analysis using a Class 3 mouse anti-CD34 antibody (Silenius) or a rabbit anti-CD14 antibody as previously described [22, 23]. Briefly, cells were resuspended at 1 x 106 cells/ml in PBS/AC with 1% human and 1% goat serum and 4 µg/ml antibody and incubated 30 minutes on ice. Cells were washed twice then pelleted through a fetal calf serum (FCS) cushion. Cells were incubated again as above with a 1:150 dilution of fluorescein isothiocyanate (FITC)-conjugated secondary antibody (BD PharMingen; San Diego, CA; http://www.pharmingen.com). Cells were washed and pelleted through FCS as above and resuspended at 1 x 106 cells/ml in PBS for FACS. Because CD34+ cells represent less than 0.1% of leukocytes before CD34+ depletion, CD34 cells were not analyzed for CD34+ content [13, 14]. Such a small percentage would not be discriminated in our FACS assay. FACS analysis on cultured cells was done as above after cells were detached from the culture plate by incubation with 2 mM EDTA in PBS. For additional analyses, antibodies to tie-2 (Santa Cruz Biotechnology; Santa Cruz, CA; http://www.scbt.com), MUC18 (Chemicon; Temecula, CA; http://www.chemicon.com), endoglin (BD PharMingen), and CD1a and CD45 (Dako; Carpenteria, CA; http://www.dako.dk) were used. A minimum of 1 x 104 events were counted in all analyses.
Cell Culture, Counting, and Dye Labeling
Cells were plated at 4 x 105 cells per well, except as noted, in 24-well trays precoated with 5 µg/cm2 human fibronectin (BD Biosciences; Franklin Lakes, NJ; http://www.bd.com) according to manufacturer's instructions. Cells were cultured in medium D (M199 #12340, GIBCO; Gaithersburg, MD), 20% heat-inactivated fetal bovine serum, 2 ml/L bovine brain extract (#CC-4092, Clonetics; San Diego, CA; http://www.clonetics.com), and 2x antibiotic/antimycotic (#15240-0620, GIBCO). The medium was changed on the fourth day after plating and every 3 to 4 days subsequently. Experiments were done in duplicate or triplicate and all experiments with CD34+ cells were performed at least four times, and with CD34 cells at least six times. To determine the number and proportion of EC in cultures, spindle-shaped cells and total cells in 11 representative fields per well (5% of well) were counted using phase contrast microscopy at various times after plating. Spindle shape was used as the criterion for differentiation into EC because in our culture system >95% of cells are spindle-shaped by 8 days in culture, and essentially all spindle-shaped cells express Tie-2, and take up acetylated low density lipoprotein (acLDL) [3, 8].
To obtain conditioned medium (CM), CD34 cells were plated at 2 x 106 cells per well as above and cultured for 2 days. The medium was changed, and thereafter the medium was collected and replaced with fresh medium every 3 days for 9 days. For experiments testing the effects of CM, freshly isolated CD34, CD14, or monocyte-enriched cells were plated in one-third fresh medium and two-thirds CM. The medium was changed every other day.
For CM-DiI or SP-DiO (Molecular Probes; Eugene, OR; http://www.probes.com) labeling, freshly isolated CD34+ or CD34 cells were resuspended at 106 cells/ml and incubated in 2 µg/ml CM-DiI or SP-DiO in media for 5 minutes at 37°C then 15 minutes on ice. For low dye concentration experiments, cells were labeled with 0.2 µg/ml CM-DiI or 0.5 µg/ml Sp-DiO. Cells were pelleted and washed three times in medium (106 cells/ml) to remove unincorporated dye. CM-DiI or SP-DiO labeling at these concentrations had no effect on cell viability.
Cell Immunolabeling and acLDL Uptake
To assess the ability of cells to take up acLDL, 10 µg/ml DiI acLDL (Biomedical Technologies; Stoughton, MA; http://www.btiinc.com) were added to the medium and cells were returned to the incubator for 4 hours. Cells were then washed three times with PBS, and examined by confocal microscopy (due to the DiI tag). The fraction of DiI acLDL-labeled cells was determined from these data. Human coronary artery smooth muscle cells (Cascade Biologicals; Portland, OR; http://www.cascadebio.com) and mouse FTO-2B cells (ATCC; Manassas, VA; http://www.atcc.org) were cultured according to the suppliers' specifications and were used as negative control cells.
Tissue culture cells were rinsed three times in PBS, once in water, and fixed in methanol for 5 minutes. Cells were blocked for 1 hour in 4% calf serum in PBS then incubated for 1 hour at room temperature, then overnight at 4°C in 1 µg/ml anti-Tie-2 (Santa Cruz Biotech), 5 µg/ml vascular endothelial (VE)-cadherin (Chemicon), 10 µg/ml von Willebrand's factor (vWF) (Dako) or concentration and species-matched nonimmune rabbit or mouse IgG (Sigma). Cells were washed three to six times in PBS, incubated 1-2 hours in biotinylated goat anti-rabbit or mouse IgG antibody (Vector Laboratories; Burlingame, CA; http://www.vectorlabs.com), washed three to six times in PBS, then incubated for 1 hour in 1:100 streptavidin-FITC (Vector) before mounting for confocal microscopy. Cells were examined using a Bio-Rad MRC-1024 (Bio-Rad Laboratories; Hercules, CA; http://www.bio-rad.com) confocal microscope equipped with a krypton-argon laser or by conventional fluorescence microscopy.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
To test for the presence of eNOS mRNA, freshly isolated CD34 cells were plated on fibronectin in medium D as above. After 0 days, 12 days, or 16 days in culture, cells were rinsed twice in PBS and mRNA was extracted using Trizol Reagent (GIBCO) per manufacturer's instructions. Reverse transcription was carried out for 1 hour at 42°C on 1 µg of RNA in 1x First Strand Buffer (GIBCO) using Moloney murine leukemia virus (M-MLV) RT (GIBCO). For PCR amplification, 2 µg of the produced DNA were amplified for 35 cycles in First Strand Buffer using AmpliTaq DNA polymerase (Perkin Elmer; Foster City, CA; http://www.instruments.perkinelmer.com/index.asp) using the following cycles: 94°C for 3 minutes, 58°C for 1 minute, 72°C for 3 minutes for the first cycle and 94°C for 1 minute, 58°C for 1 minute, 72°C for 3 minutes for 35 cycles. Human primers were GACATTTTCGGGCTCACGCTG (forward) and TTGGGTAGGCAGTTTAGTAGTTCTC (reverse) for EC nitric oxide synthase (eNOS), CACCGTTTGCCCACCCTTCG (forward) and GCCCACTGG-GAGCCGACACT (reverse) for vWF, and GATGCAGAGG- CTCATGATGC (forward) and CTTGCGACTCACGCTTG-ACT (reverse) for VE-cadherin.
Hind Limb Ischemia, Cell Injection, and Blood Vessel Labeling
All procedures were performed on nude (HFh11nu) mice (Jackson Laboratories; Bar Harbor, ME; http://www.jax.org) according to University of Iowa Animal Care and Use Committee guidelines. Diabetes was induced using streptozotocin as described [8, 24] and surgery was performed 2-3 weeks after the last streptozotocin injection. Nude mice were used to minimize possible host-versus-graft immune responses to the transplanted human cells. Surgery to induce hind limb ischemia was completed as has been described [8, 25]. Three to 6 hours after surgery, the ischemic limb was injected i.m. with 1 x 106 freshly isolated CM-DiI-labeled CD34 or monocyte-enriched cells and 5 x 105 unlabeled CD34+ cells in 0.9% NaCl. Mice were killed 5 days later, and the thigh hind limb muscles were removed, fixed in methanol, paraffin embedded, and sectioned at 8 µm. Sections were incubated with Bandeira simplicifolia lectin B4 to identify murine EC as previously described [26].
| RESULTS |
|---|
|
|
|---|
Freshly isolated cells were plated at either high or low density on fibronectin in medium D, a medium in which human umbilical vein EC (HUVEC) thrive. As previously reported, a subset of freshly isolated CD34+-enriched cells rapidly attached and began to assume a spindle-shaped morphology by 4-6 days in culture [3, 8]. Cells morphologically similar to CD34+ cells were present in cultures of CD34, CD14+, or monocyte-enriched cells (Fig. 1A-C
). The proportion of spindle-shaped cells was higher in CD14+ cultures (82% ± 2%) than in CD34 cultures (63% ± 3%). In CD14 cell cultures no spindle-shaped cells were observed, and viable cells were rarely present after 12 days in culture (data not shown.) Cord-like structures, commonly formed by EC, were observed in low density cultures that produced spindle-shaped cells (Fig. 1D
). Since no spindle-shaped cells were produced by CD14 cells cultured in fresh medium D, we tested if factors produced by other leukocytes were required for CD14 cell differentiation. CD14, CD14+, and CD34 cells were plated in CM from cultures of CD34 cells. While CM profoundly augmented production of spindle-shaped cells in CD34 and CD14+ cell cultures, again, no spindle-shaped cells were found in CD14 cell cultures (Fig. 1E-G
).
|
|
|
FACS was used to assess expression of other antigens. The EC antigen MUC18 [27] was detected on 14% ± 5% of CD34 cells [27]. Endoglin, which is expressed on activated EC and dendritic cells (which are derived from monocytes), was found on 59% ± 5% of CD34 and 78% ± 9% of monocyte-enriched cells in 16-day cultures [28-30]. The dendritic cell antigen CD1a was detected on 83% ± 5% and 85% ± 9% of 16-day CD34 and monocyte-enriched cells, respectively. Also, the pan-leukocyte antigen CD45 was localized to 94% ± 5% of 12-day CD34 cells. Hence, the phenotype of the cultured cells was intermediate between EC and dendritic cells.
Abundance of CD34 and CD34+ EC Progenitors in the Blood
To ascertain whether CD34+ cells are enriched for angioblasts, CD34+ and CD34 cells were plated in monoculture at equal density on fibronectin in medium D. CD34+ and CD34 cells produced similar numbers of tie-2+ spindle-shaped cells regardless of the density of plating (Fig. 4A
). Additionally, when CD34+ and CD34 cells were cocultured the number of EC produced was independent of CD34+ cell: CD34 cell ratio (Fig. 4A
). That is, the number of EC produced was a function of the total number of cells plated, regardless of the proportion of CD34+ and CD34 cells in the cultures (Fig. 4A
). The possibility that the total density of cells in the cultures might alter the ability of CD34+ and CD34 cells to produce EC was also considered. Thus, cells were plated at various densities ranging from 1 x 105 to 8 x 105 cells per well. There was a nearly linear relationship between the number of cells plated and the number of EC produced in monoculture or in coculture regardless of the ratio (which varied from 5:1 to 1:5) of CD34+ to CD34 cells (Fig. 4B
). At densities of less than 1 x 105 cells per well, cultures typically were not viable.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Our data do not directly answer the question of whether at least some CD34+ cells are angioblasts. Because our CD34+ cell cultures are typically only 15.9% ± 3.3% pure, it is possible that no blood-derived EC progenitors express CD34. In support of this, Hernandez et al. [6] were unable to produce EC in CD34+-enriched cells in conditions that supported EC growth from less homogeneous leukapheresis samples. Also, while cultures of CD34 cells always produced EC, occasionally CD34+ cell cultures did not, perhaps because they were too pure. However, our CM data indicate that CD34 cells produce factors that enhance angioblast differentiation, so it is equally likely that factors produced by CD34 cells are lacking in more purified CD34+ cell-enriched cultures. Whatever the case with respect to CD34+ cells, since CD34 cells are many-fold more abundant than CD34+ cells and equal numbers of CD34+ and CD34 cells produce similar numbers of EC, at a minimum CD34 cells are the predominant form of EC progenitors in the blood. Further, because CD34CD14 fail to produce EC even when cultured in CD34 cell CM, the CD34CD14+ subset of leukocytes is probably enriched for angioblasts.
The phenotype of the EC produced by the cultured leukocytes is noteworthy. Based on immunostaining, all spindle-shaped cells in the cultures express tie-2, flk-1, and, after a long period in culture, VE-cadherin. Additionally the level of expression of eNOS mRNA roughly correlates with the fraction of spindle-shaped cells in the culture. That is, the level of eNOS mRNA expression by CD14+ cultures (82% pure) is slightly less than that of HUVEC (100% pure) and more than CD34 cells (63% pure). Similarly, the proportion of cells expressing endoglin mirrors the proportion of spindle-shaped cells in the culture. Some, but not all cells in the cultures express vWF and the EC-specific antigen MUC [27]. These findings suggest strongly that the cultured cells are EC. However, vWF, tie-2, and flk-1 are all expressed on subsets of leukocytes, and endoglin is expressed by dendritic cells. Further, most of the cultured cells express the dendritic cell antigen CD1a and the pan leukocyte antigen CD45, neither of which is thought to be expressed by EC. Thus, it appears that the cultured cells have a mixed EC-dendritic cell phenotype.
The differentiation of monocytes into macrophages, dendritic cells, or EC is presumably dependent on environmental cues, and in our culture system, some factors that drive monocytes into the EC pathway and away from differentiation into either macrophages or dendritic cells are probably lacking. These could include soluble factors, extracellular matrix interactions, an appropriate three-dimensional lattice, or specific cell-cell interactions. This idea is supported by our preliminary studies that show that when CD34CD14+ cells are plated at high density in the appropriate medium, capillary like structures are formed. Also, while Moldovan et al. report a similar phenotype for CD14+ cell-derived EC, it is not identical to that reported here, but they use different culture conditions [20].
In vivo, exogenous human leukocytes enriched for CD34+ cells, but rarely CD34 cells incorporate into the neovasculature, and exogenous CD34 cells have no effect on the rate of restoration of blood flow to the ischemic limb whereas CD34+ cells profoundly augment it [7, 8]. This has been taken to indicate that CD34+ but not CD34 cells contain angioblasts. Our in vivo data provide a surprising new interpretation of these findings. They suggest that CD34 cells act as angioblasts in vivo, and that CD34+ cells provide stimuli that induce CD34 cell incorporation into the vasculature either directly or by generally stimulating neovascularization. This idea is supported by the finding that hematopoietic stem cells are required for embryonic angiogenesis [32]. It might be argued that the intercalated cells are simply monocytes traversing the endothelium. However, the fact that the cells are elongated along the capillary longitudinal axis argues against this. Also, monocyte trafficking would be expected to occur regardless of whether CD34+ cells are co-injected.
| Acknowledgements |
|---|
|
|
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. K. Hirschi, D. A. Ingram, and M. C. Yoder Assessing Identity, Phenotype, and Fate of Endothelial Progenitor Cells Arterioscler. Thromb. Vasc. Biol., September 1, 2008; 28(9): 1584 - 1595. [Full Text] [PDF] |
||||
![]() |
R. P.W. Rouhl, R. J. van Oostenbrugge, J. Damoiseaux, J.-W. C. Tervaert, and J. Lodder Endothelial Progenitor Cell Research in Stroke: A Potential Shift in Pathophysiological and Therapeutical Concepts Stroke, July 1, 2008; 39(7): 2158 - 2165. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Kalka and I. Baumgartner Gene and stem cell therapy in peripheral arterial occlusive disease Vascular Medicine, May 1, 2008; 13(2): 157 - 172. [Abstract] [PDF] |
||||
![]() |
A. D. Bhatwadekar, J. V. Glenn, G. Li, T. M. Curtis, T. A. Gardiner, and A. W. Stitt Advanced Glycation of Fibronectin Impairs Vascular Repair by Endothelial Progenitor Cells: Implications for Vasodegeneration in Diabetic Retinopathy Invest. Ophthalmol. Vis. Sci., March 1, 2008; 49(3): 1232 - 1241. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Shantsila, T. Watson, H.-F. Tse, and G. Y.H. Lip New insights on endothelial progenitor cell subpopulations and their angiogenic properties. J. Am. Coll. Cardiol., February 12, 2008; 51(6): 669 - 671. [Full Text] [PDF] |
||||
![]() |
H. Morimoto, M. Takahashi, Y. Shiba, A. Izawa, H. Ise, M. Hongo, K. Hatake, K. Motoyoshi, and U. Ikeda Bone Marrow-Derived CXCR4+ Cells Mobilized by Macrophage Colony-Stimulating Factor Participate in the Reduction of Infarct Area and Improvement of Cardiac Remodeling after Myocardial Infarction in Mice Am. J. Pathol., September 1, 2007; 171(3): 755 - 766. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhao, Z. Liu, Z. Wang, C. Yang, J. Liu, and J. Lu Effect of Prepro-Calcitonin Gene-Related Peptide Expressing Endothelial Progenitor Cells on Pulmonary Hypertension Ann. Thorac. Surg., August 1, 2007; 84(2): 544 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Timmermans, F. Van Hauwermeiren, M. De Smedt, R. Raedt, F. Plasschaert, M. L. De Buyzere, T. C. Gillebert, J. Plum, and B. Vandekerckhove Endothelial Outgrowth Cells Are Not Derived From CD133+ Cells or CD45+ Hematopoietic Precursors Arterioscler. Thromb. Vasc. Biol., July 1, 2007; 27(7): 1572 - 1579. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Meirow, J. Dor, B. Kaufman, A. Shrim, J. Rabinovici, E. Schiff, H. Raanani, J. Levron, and E. Fridman Cortical fibrosis and blood-vessels damage in human ovaries exposed to chemotherapy. Potential mechanisms of ovarian injury Hum. Reprod., June 1, 2007; 22(6): 1626 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ishii, T.-K. Ito, K. Aoyagi, H. Fujimoto, H. Chiba, T. Hasebe, S. Fujii, K. Nagai, H. Sasaki, and A. Ochiai Presence of Human Circulating Progenitor Cells for Cancer Stromal Fibroblasts in the Blood of Lung Cancer Patients Stem Cells, June 1, 2007; 25(6): 1469 - 1477. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-K. Oh, J.-M. Ha, E. O, B. H. Lee, S. K. Lee, B.-S. Shim, Y.-K. Hong, and Y. A. Joe Tumor Angiogenesis Promoted by Ex vivo Differentiated Endothelial Progenitor Cells Is Effectively Inhibited by an Angiogenesis Inhibitor, TK1-2 Cancer Res., May 15, 2007; 67(10): 4851 - 4859. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Caballero, N. Sengupta, A. Afzal, K.-H. Chang, S. Li Calzi, D. L. Guberski, T. S. Kern, and M. B. Grant Ischemic Vascular Damage Can Be Repaired by Healthy, but Not Diabetic, Endothelial Progenitor Cells Diabetes, April 1, 2007; 56(4): 960 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Casamassimi, M. L. Balestrieri, C. Fiorito, C. Schiano, C. Maione, R. Rossiello, V. Grimaldi, V. Del Giudice, C. Balestrieri, B. Farzati, et al. Comparison Between Total Endothelial Progenitor Cell Isolation Versus Enriched Cd133+ Culture J. Biochem., April 1, 2007; 141(4): 503 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thomas-Ecker, A. Lindecke, W. Hatzmann, C. Kaltschmidt, K. S. Zanker, and T. Dittmar Alteration in the gene expression pattern of primary monocytes after adhesion to endothelial cells PNAS, March 27, 2007; 104(13): 5539 - 5544. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Yoder, L. E. Mead, D. Prater, T. R. Krier, K. N. Mroueh, F. Li, R. Krasich, C. J. Temm, J. T. Prchal, and D. A. Ingram Redefining endothelial progenitor cells via clonal analysis and hematopoietic stem/progenitor cell principals Blood, March 1, 2007; 109(5): 1801 - 1809. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shiba, M. Takahashi, T. Yoshioka, N. Yajima, H. Morimoto, A. Izawa, H. Ise, K. Hatake, K. Motoyoshi, and U. Ikeda M-CSF Accelerates Neointimal Formation in the Early Phase After Vascular Injury in Mice: The Critical Role of the SDF-1-CXCR4 System Arterioscler. Thromb. Vasc. Biol., February 1, 2007; 27(2): 283 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Schatteman, M. Dunnwald, and C. Jiao Biology of bone marrow-derived endothelial cell precursors Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H1 - H18. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kuwana, Y. Okazaki, H. Kodama, T. Satoh, Y. Kawakami, and Y. Ikeda Endothelial Differentiation Potential of Human Monocyte-Derived Multipotential Cells Stem Cells, December 1, 2006; 24(12): 2733 - 2743. [Abstract] [Full Text] [PDF] |
||||