Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Catani, L.
Right arrow Articles by Tura, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Catani, L.
Right arrow Articles by Tura, S.
Stem Cells, Vol. 19, No. 4, 339-347, July 2001
© 2001 AlphaMed Press

Interleukin-4 Downregulates Nuclear Factor-Erythroid 2 (NF-E2) Expression in Primary Megakaryocytes and in Megakaryoblastic Cell Lines

Lucia Catani, Marilina Amabile, Simona Luatti, Lelia Valdrè, Nicola Vianelli, Giovanni Martinelli, Sante Tura

Istituto di Ematologia e Oncologia Medica "L. e A. Seràgnoli;" University of Bologna-Italy

Key Words. NF-E2 • IL-4 • TGF-ß1 • Megakaryocytes • Real-time RT-PCR

Correspondence: Lucia Catani, Ph.D., Istituto di Ematologia e Oncologia Medica, "L. e A. Seràgnoli," Ospedale S. Orsola, Via Massarenti 9-40138, Bologna, Italy. Telephone: 051-636-4038; Fax: 051-636-4037; e-mail: lcatani{at}med.unibo.it


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
The trascriptional factor nuclear factor-erythroid 2 (NF-E2) is one of the few transcription factors known to be functionally linked to the megakaryocytic lineage, where it regulates terminal megakaryocyte maturation and platelet formation. However, the regulation of NF-E2 expression in megakaryocytic cells has not been extensively evaluated. In particular, no data have been reported on the effect of negative regulators of megakaryocytopoiesis on NF-E2 expression. This study investigated the in vitro effects of two negative regulators of megakaryocytopoiesis, such as interleukin-4 (IL-4) and transforming growth factor-ß1 (TGF-ß1) on the expression of NF-E2 transcription factor in megakaryoblastic cell lines (Hel and MK1) and in normal CD34-derived megakaryocytic cells. For this purpose, we used quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) to detect mRNA NF-E2 isoforms (a and f) and flow-cytometry analysis to evaluate NF-E2 protein expression. Our results demonstrated that TGF-ß1 did not inhibit NF-E2 mRNA and protein expression of either maturating or fully mature normal megakaryocytic cells as well as that of the two cell lines. By contrast, IL-4 downmodulates the expression of NF-E2 transcription factor at both mRNA and protein levels in normal maturating megakaryocytic cells and in the megakaryoblastic cell lines. NF-E2 expression of normal mature megakaryocytes was not affected by IL-4. Thus, the results of the present investigation demonstrate that NF-E2 transcription factor is involved not only in terminal megakaryocyte maturation but also in the negative regulation of the early phase of megakaryocyte development.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
The transcription factor nuclear factor-erythroid 2 (NF-E2) is an obligate heterodimer made up of two different subunits (p45 and p18), each of which contains a basic region-leucine zipper DNA binding domain [1, 2]. The p18 subunit is a small Maf protein [3-5]. Heterodimers of p45 and small Mafs can activate transcription from mares (Maf recognition elements, TGCTGAC(T/GT)CAGCA), whereas small Maf homodimers form active repressors acting on the same sites [4]. Two isoforms of the human p45 NF-E2 gene have been isolated (a and f NF-E2) which differ in the 5' untranslated region [6, 7]. The gene has 3 exons; whereas exons 2 and 3 are common to both isoforms, exon 1 differs between the two species (exon 1a and exon 1f). These isoforms produce the same protein, but they are regulated by two different promoters and are expressed in different ratios during development. Although the two isoforms are always coexpressed in every cell type, the f form predominates in fetal liver and the a form is prevalent in adult bone marrow [7]. NF-E2 is almost exclusively expressed in hematopoietic progenitors and differentiated cells of the erythroid, megakaryocyte, granulocyte, and mast cell lineages [8]. It has been shown to play an important role in the development of megakaryocytes [8, 9]. It has recently been reported that mice lacking the p45NF-E2 show megakaryocytosis and severe thrombocytopenia and die of hemorrhage. They also show mild to moderate anemia. Loss of p45 NF-E2 interferes with megakaryocytic maturation at an advanced stage; ultrastructural studies reveal a markedly reduced number of granules and failure to form platelet fields. Therefore, NF-E2-regulated genes are critical to terminal megakaryocyte maturation and platelet formation [8, 10]. The thromboxane synthase gene, which is mainly expressed in megakaryocytes [11], and the Beta1 tubulin gene [12] have recently been reported to be regulated by p45 NF-E2. It has also recently been shown that NF-E2, or genes regulated by NF-E2, seem to play a major role in integrin {alpha}IIbß3 signaling [13].

So far, the regulation of p45 NF-E2 expression in megakaryocytic cells has not been extensively investigated. A number of cytokines, including transforming growth factor-ß1 (TGF-ß1), platelet factor 4, interferons, and interleukin-4 (IL-4) have been reported to be able to inhibit megakaryocyte development, either in the proliferation or differentiation phase [14-17]. However, their molecular mechanisms have not been studied in depth. The present study was designed to investigate whether IL-4 or TGF-ß1 is able to influence the expression of NF-E2 transcription factor in megakaryocytic cells. We choose to study TGF-ß1 because it is actively synthesized by megakaryocytic cells and IL-4 because it has a paracrine effect on megakaryocytopoiesis. For this purpose we used A) primary CD34+ hematopoietic progenitor cells induced to differentiate along the megakaryocytic lineage in liquid suspension cultures by addition of thrombopoietin (TPO), and B) two megakaryoblastic cell lines (Hel and MK1).


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Cell Lines
The human megakaryoblastic cell line MK1 was kindly provided by R. Di Noto [18]. This cell line was maintained in Dulbecco's modified Eagle's medium with 4.5 g/l dextrose supplemented with 20% fetal bovine serum ([FBS], GIBCO-Life Technologies; Paisley, UK), 2 mM L-Glutamine (GIBCO), 10–5 M 2-mercaptoethanol (Sigma; St. Louis, MO) and antibiotics. Hel cells [19] obtained from American Type Culture Collection (ATCC; Rockville, MD), were cultured in RPMI-1640 (GIBCO) plus 10% FBS (GIBCO).

CD34+ Cell Purification and Liquid Suspension Cultures
Informed consent to the study was obtained from eight normal blood donors. Mononuclear cells were isolated from leukapheresis units by Ficoll-Hypaque (D = 1.077 g/ml; Pharmacia; Uppsala, Sweden) and rinsed. CD34+ cells were isolated using a magnetic cell sorting program Mini-Macs (Miltenyi Biotec; Auburn, CA) and the CD34 isolation kit in accordance with the manufacturer's reccomendations. The purity of CD34 selected cells was determined by using a monoclonal antibody (mAb) that recognizes a separate epitope of the CD34 molecule (HPCA-2; Becton Dickinson; San Jose, CA) directly conjugated to fluorescein. CD34+ cells averaged about 88% to 97%. To avoid the interference of serum, purified CD34+ cells (80,000)/ml) were resuspended in a serum-free medium: Iscove's modified Dulbecco's medium (GIBCO) containing nucleosides (10 µg/ml each), 10–4 mol/l bovine serum albumin-adsorbed cholesterol, 0.5% bovine serum albumin (Fraction V Chon), 200 µg/ml iron-saturated transferrin, 10 µg/ml insulin, and 5 x 10–5 mol/l 2-ß-mercaptoethanol (all purchased from Sigma) in the presence of 100 ng/ml of human recombinant TPO (Genzyme; Boston, MA). Every 3 days, viable cells were scored by trypan blue dye exclusion and cultures were amplified with fresh medium, readjusting the cell density to 80,000/ml. Each well was then supplemented with 100 ng/ml TPO.

Incubation with Cytokines
CD34-derived megakaryocytic cells were then washed two times with serum-free medium and incubated with or without IL-4 (100 U/ml; Endogen; Woburn, MA) or TGF-ß1 (10 ng/ml; R&D Systems Inc.; Minneapolis, MN) for 48 hours.

Cell lines (MK1 and Hel) were cultured in media plus various concentrations of IL-4 (1, 10, 100 U/ml) or TGF-ß1 (0.1, 1, 10 ng/ml) for 72 hours without medium change.

{alpha}IIbß3+ Cell Purification
CD34-derived megakaryocytic cells were purified as previously described [20]. Briefly, CD34-derived cells were incubated after two washings with an anti-CD41a mAb (Dako; Glostrup, Denmark) directed against the glycoproteic {alpha}IIbß3 complex. After 1 hour in ice, cells were washed twice and 5 x 106 immunomagnetic beads, coated with goat antimouse IgG (MPC 450 Dynabeads; Dynal; Oslo, Norway), were added to the tube for 30 minutes in ice under continuous agitation. {alpha}IIßß3+ cells were then positively selected by a magnet (MPC1; Dynabeads). The purity of megakaryocytic cells was determined for each isolation by indirect immunofluorescence using an anti-CD41b mAb, which reacts with a different epitope of {alpha}IIb subunit (Immunotech Inc.; Westbrook, ME), followed by a goat anti-mouse IgG, covalently linked to fluorescein.

Hel cells and MK-1 cell lines were also selectively purified for {alpha}IIbß3+ cells by means of positive immunomagnetic selection.

Quantitative Real Time RT-PCR
After purification, {alpha}IIbß3+ cells, either from cell lines or from primary cells, were then processed as follows. Total cellular RNA was extracted using the commercially available RNAzol TM Kit (Cinna/Biotec; Houston, TX). The amount of extracted RNA was determined by the optical density at 260 nm, and its integrity was checked by loading 1 ng on 2% agarose gel. cDNAs were prepared from 1 µg RNA template in 50 µl reaction mixtures containing 10 mM TrisHcl pH 8.3, 50 mM KCl, 4 mM MgCl2, 2.5 µM random examers (Perkin Elmer; Milan, Italy), 200 µM each of the dATP, dCTP, dGTP, dTTP (Perkin Elmer), 10 U placental ribonuclease inhibitor (Boehringer Mannheim; Milan, Italy), 200 U Moloney murine leukemia virus (Promega; Milan, Italy). The RT reaction was carried out by incubation at 37°C for 1 hour.

Primers and Taqman Probes The PCR primers and Taqman probes to amplify and detect the NF-E2 a and f isoforms were designed using the Primer Express software version 1.0 (Perkin Elmer/ Applied Biosystems; Foster City, CA) as follows: NF-E2a sense CCTGCTGTGACTCCACCACA; NF-E2f sense GGGCATTTTGCCTGGAAA; the NF-E2 antisense was common to both isoforms: GCCAGAGTCTGGTCCAG-GTTC. The resulting NF-E2a fragment was 68 bp and spanned from exon 1a to exon 2 and the NF-E2f transcript was 69 bp and spanned from exon 1f to exon 2. The PCR primers were purchased from BT Biotecnica, (Saronno, Italy). The TaqMan probe (AGAGCCATCTGGGCTTTCCGGG) was placed on exon 2 in order to detect both isoforms. The probe was purchased labeled with 6-carboxy-fluorescein as the reporter dye and 6-carboxy-tetramethyl-rhodamin as the quencher fluorescent (Perkin Elmer/Applied Biosystems). In order to minimize variability in the results due to differences in the RT efficiency and/or RNA integrity among the unknown samples, a housekeeping gene, GAPDH, was also tested. The TaqMan-GAPDH Control Reagents (Perkin Elmer/Applied Biosystems) were used to amplify and detect GAPDH as recommended by the manufacturer. GAPDH expression was quantified with a 5'-JOE (2,7 dimethoxy-4,5-dichloro-6-carboxyfluorescein)- labeled probe.

Establishment of the Standard Curves for NF-E2a, NF-E2f, and GAPDH Quantitation utilized standard curves which have been established with plasmids containing specific sequences of each gene studied. NF-E2a, f, and GAPDH transcripts were amplified by single polymerase chain reaction (PCR) from cDNA of a pure population of normal megakaryocytic cells, by using the same primers employed in the real-time PCR. The 68, 69, and 241 bp fragments, respectively, were cloned into the pCRII-Topo vector using the TOPO TA cloning kit (Invitrogen; San Diego, CA). The three plasmids of 4 kb were purified using a Qiagen Mini Prep Kit (Qiagen; Chatsworth, CA), according to the manufacturer's directions. The plasmids were then quantitated, and serial dilutions were prepared starting at 107 copies (four- to sixfold dilutions) and conserved at -20°C. A standard curve was then constructed plotting the cycle threshold (CT) versus the known copy number of each standard sample. There was a linear decrease of the CT in proportion to the log of the starting copy number with a correlation coefficient of 0.97-1.00 in the three genes. For quantitation, NF-E2 expression (a and f isoforms) was normalized by comparison with GAPDH expression. Normalized levels of unknown samples were calculated as the ratios between NF-E2a or NF-E2f and GAPDH.

Real-Time PCR Real-time PCR was performed on an ABI PRISM 7700 Sequence detector, using the ABI PRISM 7700 Sequence detector Software 1.6 (Perkin Elmer/Applied Biosystems). Optimal reaction conditions for amplification of both GAPDH and NF-E2 isoforms (a, f) were as follows: 50 cycles of a two-step PCR (95° C x 15''; 60°C x 60'') after initial denaturation (95°C x 10') with 1.25µl of cDNA reaction. PCR reactions were set up in a MicroAmp Optical 96-well reaction plate (Perkin-Elmer/Applied Biosystems). Each well was closed with MicroAmp Optical caps (Perkin Elmer/ Applied Biosystems) following complete loadings with reagents as described above. All the reactions for samples or standard were run in triplicate. The Raji cell line has been used as negative control [6].

DNA Labeling Technique and Flow Cytometric Analysis
Cells (8 x 104 CD34-derived megakaryocytic cells and 1 x 105 MK1 and Hel cells) were washed in phosphate buffered saline (PBS) and the pellets were fixed in 2 ml cold 70% ethanol and stored at 4°C. The cells were then centrifuged, washed in PBS, and resuspended in 0.4 ml PBS and treated with RNAase (1 µg/ml; Type I-A; Sigma) for 1 hour at 37°C. Propidium iodide (Sigma; 50 ug/ml in PBS) was added to each sample and, after gentle mixing, samples were incubated in the dark at 4°C for 30 min and then measured. Facscalibur (Becton Dickinson; San José, CA) was used for analysis. For each sample, up to 10,000 events were collected. The DNA content of the cells was determined by using Facscalibur (Becton Dickinson) and the Fitmode analysis software (Becton Dickinson).

CD34-derived megakaryocytic cells or MK1 and Hel cells were tested for NF-E2 protein expression with or without incubation with IL-4 (100 U/ml) or TGF-ß1 (10 ng/ml) for various time points. A double labeling technique (NF-E2/CD41) has been employed. For indirect immunofluorescence analysis, rabbit polyclonal IgG anti-NF-E2 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). After two washings with PBS, the cells were fixed with 2% paraphormaldeyde at 4°C for 10 minutes. After two washings with ice-cold PBS plus 0.1% saponin (Sigma) for permeabilization, the pelleted cells were incubated for 30 minutes at 4°C with 5 µl of anti-NF-E2 antibody. After extensive washings with PBS plus 0.1% saponin, the cells were then incubated for 30 minutes at 4°C with 5 µl of fluorescein isothiocyanate (FITC)-conjugated swine anti-rabbit immunoglobulins (IgG; Dako; Milan, Italy). Nonspecific fluorescence was assessed by using 5 µl scomplemented rabbit serum (1:50 dilution with PBS plus 0.1% saponin) followed by FITC-conjugated swine anti-rabbit immunoglobulins (5 µl; Dako). Cells were then washed twice with PBS plus 0.1% saponin and analyzed by flow cytometry. 1 x 104 to 2 x 104 events were collected for each sample. {alpha}IIbß3 expression was monitored by using a phycoerythrin (PE)-conjugated mouse anti-human glycoprotein IIb-IIIa antibody (PharMingen; San Diego, CA). Nonspecific fluorescence was assessed by using a PE-matched control antibody.

Statistics
Data are expressed as means ± standard deviation (SD). Statistical analysis was performed using the two-tailed Student's t-test.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
IL-4 and TGF-ß1 Inhibit Cell Line Proliferation
To assess the influence of IL-4 and TGF-ß1 on the proliferation of the two cell lines, increasing concentrations of IL-4 and TGF-ß1 were added to MK-1 and Hel cells for 3 days without medium change. Proliferation of cell lines was not significantly affected within 24 hours of treatment with IL-4 (100 U/ml). After 48 hours, IL-4 inhibited the growth of MK1 (44 ± 3%; p < 0.003) and Hel cells (55 ± 5%; p < 0.001). The inhibition of cell growth was 31 ± 6% for MK1 (p < 0.04) and 55 ± 3% for Hel cells (p < 0.001) after 72 hours (Fig. 1AGo). Exposure of the cell lines to different concentrations of TGF-ß1 (0.1, 1, 10 ng/ml) showed a dose-dependent inhibition of the cell growth, especially after 48 and 72 hours of incubation (Fig. 1BGo). TGF-ß1 (10 ng/ml) inhibited (24 ± 3% [p < 0.05] and 30 ± 6% [p < 0.04]) MK-1 cell proliferation after 48 and 72 hours of incubation, respectively. Hel cell growth also was inhibited (35 ± 6% at 48 hours [p < 0.03] and 39 ± 4% at 72 hours [p < 0.03]) by TGF-ß1 (10 ng/ml).




View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Counts of viable MK-1 and Hel cells at Trypan blue dye exclusion after incubation with IL-4 at different concentrations (1, 10, 100 U/ml) (A) or after incubation with TGF-ß1 (0.1, 1, 10 ng/ml) (B). Data are expressed as means of three separate experiments performed in duplicate. Standard deviations were contained within 8% of the means.

 
IL-4 and TGF-ß1 Inhibit Cell Cycle Progression of MK1 and Hel Cell Lines
We also analyzed the cell-cycle distribution of MK-1 and Hel cells after 24, 48, and 72 hours of incubation with IL-4 (100 U/ml) or TGF-ß1 (10 ng/ml). After 24 hours, IL-4 significantly increased (MK1: p < 0.03; Hel: p < 0.02) the percentages of cells in G0/G1 phase and prevented cell cycle progression (Table 1Go). The percentages of cells in G2-M phase and S phases significantly decreased (p < 0.04) in comparison with the untreated cells in both cell lines (Table 1Go). The same pattern was observed when TGF-ß1 was added to the liquid cultures of the cell lines (Table 1Go). The percentages of cells in G0-G1 phase significantly increased (MK1: p < 0.03; Hel: p < 0.01) after incubation with TGF-ß1 for 24 hours (Table 1Go) with a concomitant reduction of cells in G2-M and S phases (p < 0.05). Inhibition of cell cycle progression was also observed after 48 and 72 hours of incubation with the cytokines (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 1. Cell cycle analysis of MK1 and Hel cell lines after incubation with IL-4 (100 U/ml) and TGF-ß1 (10 ng/ml) for 24 hours
 
IL-4 Inhibits NF-E2 mRNA Expression in Cell Lines
To investigate whether NF-E2 mRNA expression may be modulated by the negative regulators of megakaryocytopoiesis such as TGF-ß1 and IL-4, we studied a and f NF-E2 mRNA expression during IL-4 and TGF-ß1 treatment of MK1 and Hel cell lines. The real-time reverse transcriptase (RT)-PCR technique allowed us to quantitate the a and f isoforms of NF-E2 mRNA in each sample by using normalized NF-E2a/GAPDH ratio and NF-E2f/GAPDH ratio. Both a and f NF-E2 mRNA were readily detectable in the two cell lines with the a form more expressed than the f (Table 2Go). IL-4 inhibited the NF-E2a and f mRNA expression in MK1 and Hel cells (Table 2Go). The mean percentage of inhibition of NF-E2a/GAPDH ratio was 75 ± 3% in MK1 cells after 2 hours of incubation with IL-4 (p < 0.001). Then it decreased to approximately 50 ± 2% at 24 hours (p < 0.01) and to 23 ± 3% at 48 hours (p < 0.02; Table 2Go). The mean percentage of inhibition of NF-E2a/GAPDH ratio of Hel cells was slightly inhibited after 2 hours (16 ± 3%) but it rapidly increased to 86 ± 2% after 24 hours of incubation with IL-4 (p < 0.001; Table 2Go). The mean inhibition of NF-E2a/GAPDH ratio in Hel cell line was 56 ± 3% at 48 hours (p < 0.01). As shown in Table 2Go, NF-E2f/GAPDH ratio showed the same pattern of inhibition.


View this table:
[in this window]
[in a new window]
 
Table 2. Real-time RT-PCR: NF-E2a/GAPDH and NF-E2f/GAPDH ratios of MK1 and Hel cell lines after incubation with IL-4 (100 U/ml) and TGF-ß1 (10 ng/ml)
 
By contrast, TGF-ß1 did not inhibit the mRNA expression of the two NF-E2 isoforms in MK1 and Hel cells. In fact, the percentage of inhibition of NF-E2a/GAPDH and NF-E2f/GAPDH values after TGF-ß1 (10 ng/ml) incubation was always very low (within 15%) at various time points (Table 2Go).

Il-4 Inhibits NF-E2 mRNA Expression in Primary Human Megakaryocytic Cells
In order to confirm our findings in cell lines, we sought to investigate whether IL-4 and TGF-ß1 are able also to influence NF-E2 gene expression of primary human megakaryocytic cells. For this purpose, peripheral blood CD34+ cells from healthy donors were isolated and cultured in a serum-free medium in the presence of TPO. CD34-derived megakaryocytic cells displayed a high level expression of {alpha}IIbß3 integrin after 14-16 days of liquid culture with 100 ng/ml TPO (Fig. 2AGo). At this time point, the morphological analysis showed that different degrees of cell maturation could be observed with the presence of small megakaryoblasts together with large polyploid cells (Fig. 2BGo). NF-E2 mRNAs (a and f isoforms) were barely detectable in normal CD34+ progenitor cells. However, when cells differentiated along the megakaryocytic lineage, a significant increase of NF-E2 mRNA level could be observed. The NF-E2a/GAPDH ratio was 0.004 ± 0.0005, and NF-E2f/GAPDH ratio was 0.0009 ± 0.0001 in purified CD34-derived megakaryocytic cells after 14-16 days of in vitro culture. In the first group of experiments, we incubated purified CD34-derived megakaryocytic cells after full maturation (14-16 days) in a serum-free medium and in the presence of IL-4 (100 U/ml) or TGF-ß1 (10 ng/ml) for 48 hours. At variance with cell lines, the two inhibitors did not significantly influence the mRNA level of NF-E2a or NF-E2f isoform at various time points (2, 24, 48 hours).




View larger version (149K):
[in this window]
[in a new window]
 
Figure 2. Analysis of {alpha}IIbß3 expression (A) and morphology (B) of CD34- derived megakaryocytic cells after liquid culture with 100 ng/ml TPO for 14 days. {alpha}IIbß3 expression (A) was examined with anti CD41a mAb directly conjugated to PE (white area) and fluorescence was analyzed by flow cytometry. Negative control (black area) is represented by cells treated with an isotype-matched irrelevant mAb directly conjugated to PE. X axis: mean fluorescence intensity; Y axis: relative number of cells. (B) Light microscopy (x 20 magnification). Note the presence of small megakaryoblasts near mature megakaryocytes.

 
Because it was previously shown that eight days represent the time required to obtain a virtually pure cell population belonging to the megakaryocytic lineage and, thereby, maturating megakaryocytic cells [21], all the following experiments were performed on purified CD34-derived megakaryocytic cells cultured in a serum-free medium for 8 days with 100 ng/ml TPO. The percentage of cells positive for the {alpha}IIbß3 (CD41a) integrin, expressed by the cells of the megakaryocytic lineage, was >92% at day 8 of culture and morphologic characterization shows few large multinucleated megakaryocytes. Once again, IL-4 significantly inhibited the expression of NF-E2a and f mRNAs of purified maturating megakaryocytes (Table 3Go). The mean percentage of inhibition of IL-4-treated cells with respect to control cells was 59 ± 3% for NF-E2a/GAPDH ratio and 51 ± 4% for NF-E2f/GAPDH ratio (p < 0.001) at 24 hours (Table 3Go). Similar findings were obtained at 48 hours (66 ± 5% and 57 ± 3%, respectively; p < 0.002) (Table 3Go). By contrast, purified maturating megakaryocytes treated with TGF-ß1 for 48 hours, showed a very low percentage of inhibition of NF-E2a/GAPDH ratio (within 10%) and no inhibition at all for NF-E2f/GAPDH ratio at different time points (Table 3Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Real-time RT-PCR: NF-E2a/GAPDH and NF-E2f/GAPDH ratios of purified maturating megakaryocytic cells after incubation with IL-4 (100 U/ml) and TGF-ß1(10 ng/ml) at various time points
 
IL-4 Inhibits NF-E2 Protein Expression
In the last group of experiments, we investigated the ability of IL-4 to inhibit the expression of NF-E2 protein in both primary megakaryocytic cells and cell lines (MK1 and Hel cells) using indirect immunofluorescence. IL-4 decreased NF-E2 protein expression at various time points, in both primary maturating megakaryocytic cells (Fig. 3Go) and in cell lines (Fig. 4Go). By contrast, there was no significant difference in the levels of expression of {alpha}IIbß3 in the same samples throughout the period of observation (data not shown).



View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. Cytofluorimetric analysis of NF-E2 protein expression after treatment of maturating megakaryocytic cells with IL-4 (100 U/ml). SSC/FSC dot plot showing the gate region (R1) used to analyze the cells. Gated cells were monitored after 24 (A) and 48 (B) hours of incubation with IL-4 (100 U/ml). Cells were double-stained with CD41a-PE mAb and a rabbit polyclonal IgG anti-NF-E2 antibody followed by an FITC-conjugated swine anti-rabbit immunoglobulin. X axis = mean fluorescence intensity; Y axis = relative number of cells. Grey area is a negative control; solid line represents control cells treated with antibody anti-NF-E2+-FITC-conjugated anti-rabbit; dotted line represents cells incubated with IL-4 and treated with antibody anti-NF-E2+ FITC-conjugated anti-rabbit. Results of one experiment representative of three separate experiments are shown.

 


View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Cytofluorimetric analysis of NF-E2 protein expression after treatment of cell lines (Hel and MK1) with IL-4 (100 U/ml) for 24 hours. Cells were double stained with CD41a-PE mAb with a rabbit polyclonal IgG anti-NF-E2 antibody followed by an FITC-conjugated swine anti-rabbit immunoglobulin. X axis = mean fluorescence intensity; Y axis = relative number of cells. Grey area is a negative control; solid line represents control cells treated with antibody anti-NF-E2+ FITC-conjugated anti-rabbit; dotted line represents cells incubated with IL-4 and treated with antibody anti-NF-E2+ FITC-conjugated anti-rabbit.

 
On the other hand, we were unable to document any decrease of NF-E2 protein expression after treatment of megakaryocytic cells, either normal or malignant-like cell lines with 10 ng/ml of TGF-ß1, at any time tested.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
NF-E2 transcription factor has recently been identified as an essential factor for terminal megakaryocyte maturation and normal platelet production [9, 22]. The expression of NF-E2 in normal hematopoiesis has previously been described by Labbaye et al. [23] in early hematopoietic progenitor cells and the cells of the erythroid or granulocytic pathways. However, the regulation of NF-E2 expression in cells of the megakaryocytic lineage has not extensively been described. It has been shown that TPO stimulates the expression of NF-E2 mRNA [24, 25] and IL-1ß induces the expression of NF-E2 in the megakaryocytic cell line, Meg-01, at mRNA and protein levels [26]. However, to our knowledge, no data have been reported on the effect of negative regulators of megakaryocytopoiesis on NF-E2 expression.

Regulation of platelet formation by growth suppressors acting directly on megakaryocytopoiesis has been proposed. Among these, IL-4, a pleiotropic cytokine produced by a subset of CD4+ T cells, by basophils and mast cells in response to receptor-mediated activation events [27], acts at an early stage of megakaryocyte development [28]. This inhibitory action is selective for megakaryocytic as well as monocytic lineage [28]. TGF-ß also inhibits megakaryocyte development. TGF-ßs are considered pleiotropic factors because they have been shown to play a regulatory role in most processes linked to the control of somatic tissue development and renewal [29]. TGF-ßs control multiple phases of erythropoiesis and granulocytic and monocytic/macrophagic cell development, together with megakaryocytopoiesis [29]. It is well documented that TGF-ß1 inhibits the proliferation of megakaryocyte progenitors in clonal assays as well as the late stage of megakaryocyte maturation [30-34]. In vivo administration of TGF-ß1 in mice reveals an inhibition of erythropoiesis and thrombopoiesis [35] and TGF-ß1 gene knockout mice show an excess of megakaryocytopoiesis with increased platelet count in circulation [36].

In the present study, we first investigated the influence of two inhibitors of megakaryocytopoiesis (IL-4 and TGF-ß1) on the NF-E2 expression of normal and malignant megakaryocytic cells. NF-E2 expression pattern was monitored at both the mRNA and protein levels by quantitative RT-PCR and immunofluorescence, respectively.

First, our findings indicate that NF-E2a and NF-E2f transcripts are expressed in normal CD34-derived megakaryocytic cells and in malignant cell lines even though the a isoform mRNA was found to be more abundant. Consistently, Toki et al. [37] also documented that the a isoform mRNA is more expressed in primary megakaryocytic cells.

Our results clearly document that IL-4 downmodulates the expression of NF-E2 transcription factor (both protein and mRNA) in normal CD34-derived megakaryocytic cells and in megakaryoblastic cell lines (MK1 and Hel). The treatment of the two cell lines with IL-4 also induces a significant inhibition of the cell growth, which is mainly due to a slowing of transit throughout the cell cycle. These observations are consistent with previous findings showing that IL-4 strongly inhibits the proliferation of megakaryocyte progenitors [28] and of a megakaryoblastic cell line [38], without affecting megakaryocyte maturation. At present, we do not know the exact role the NF-E2 gene is playing in the proliferative phase of megakaryocyte development. However, this hypothesis is supported by data showing that NF-E2 also appears to regulate replication of the progeny of committed precursors, since fetal NF-E2-deficient megakaryocyte progenitors show reduced proliferative potential in vitro [39].

The data obtained from cell lines were also confirmed in primary human megakaryocytic cells, since IL-4 inhibits the expression of NF-E2 transcription factor in maturating megakaryocytes, but not in fully matured cells. This finding further points to the importance of IL-4 in the early phase of megakaryocyte development and, once again, suggests a role of NF-E2 transcription factor in the negative regulation of megakaryocytopoiesis.

This study also shows that TGF-ß1 induced a marked reduction of cell line proliferation; however, at variance with IL-4, mRNA NF-E2 abundance was minimally affected in megakaryoblastic cell lines, either at protein or mRNA level. In addition, TGF-ß1 did not inhibit NF-E2 mRNA and protein expression of both maturating or fully mature normal megakaryocytic cells. It is therefore likely that other genes or transcription factors are involved in the control of early and late megakaryocytopoiesis by TGF-ß1. Other studies have provided evidence that the control of late megakaryocytic differentiation by TGF-ß1 could involve the transcription factors c-jun and c-fos as downstream effectors [40, 41].

Taken together, these data suggest that NF-E2 transcription factor is involved not only in the course of terminal megakaryocyte maturation and platelet production but also in the negative regulation of megakaryocytopoiesis.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
This work was supported in part by MURST.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Andrews NC, Erdjument-Bromage H, Davidson MB et al. Erythroid transcription factor NF-E2 is a haematopoietic-specific basic-leucine zipper protein. Nature 1993;362:722–728.[CrossRef][Medline]

  2. Igarashi K, Kataoka K, Itoh K et al. Regulation of transcription by dimerization of erythroid factor NF-E2p45 with small Maf proteins. Nature 1994;367:568–572.[CrossRef][Medline]

  3. Blank V, Kim MJ, Andrews NC. Human MafG is a functional partner for p45NF-E2 in activating globin gene expression. Blood 1997;89:3925–3935.[Abstract/Free Full Text]

  4. Motohashi H, Shavit JA, Igarashi K et al. The world according to Maf. Nucleic Acid Res 1997;25:2953–2959.[Abstract/Free Full Text]

  5. Shavit JA, Motohashi H, Onodera K et al. Impaired megakaryopoiesis and behavioral defects in mafG-null mutant mice. Genes Dev 1998;12:2164–2174.[Abstract/Free Full Text]

  6. Chang JY, Han X-L, Kan YW. Isolation of cDNA encoding the human NF-E2 protein. Proc Natl Acad Sci 1993;90:11366–11370.[Abstract/Free Full Text]

  7. Pischedda C, Cocco S, Melis A et al. Isolation of a differentially regulated splicing isoform of human NF-E2. Proc Natl Acad Sci USA 1995;92:3511–3515.[Abstract/Free Full Text]

  8. Andrews NC. The NF-E2 transcription factor. Int J Biochem Cell Biol 1998;30:429–432.[CrossRef][Medline]

  9. Shivdasani RA, Rosenblatt MF, Zucker-Franklin D et al. Transcription factor NF-E2 is required for platelet formation independent of the actions of thrombopoietin/MGDF in megakaryocyte development. Cell 1995;81:695–704.[CrossRef][Medline]

  10. Leucine P, Villeval J-L, Vyas P et al. Mice lacking transcription factor NF-E2 provide in vivo validation of the proplatelet model of thrombocytopoiesis and show a platelet production defect that is intrinsic to megakaryocytes. Blood 1998;92:1608–1616.[Abstract/Free Full Text]

  11. Deveaux S, Cohen-Kaminsky S, Shivdasani RA et al. p45 NF-E2 regulates expression of thromboxane synthase in megakaryocytes. EMBO J 1997;16:5654–5661.[CrossRef][Medline]

  12. Lecine P, Italiano JE Jr, Kim SW et al. Hematopoietic-specific beta 1 tubulin participates in a pathway of platelet biogenesis dependent on the transcription factor NF-E2. Blood 2000;96:1366–1373.[Abstract/Free Full Text]

  13. Shiraga M, Ritchie A, Aidoudi S et al. Primary megakaryocytes reveal a role for transcription factor NF-E2 in integrin {alpha}IIbß3 signaling. J Cell Biol 1999;147:1419–1429.[Abstract/Free Full Text]

  14. Fava RA, Casey TT, Wilcox J et al. Synthesis of transforming growth factor-beta1 by megakaryocytes and platelet alpha-granules. Blood 1990;76:1946–1955.[Abstract/Free Full Text]

  15. Hooper WC. The role of transforming growth factor-beta in hematopoiesis. A review. Leuk Res 1991;15:179–184.[CrossRef][Medline]

  16. Zauli G, Catani L. Human megakaryocyte biology and pathophysiology. Crit Rev Oncol Hematol 1995;21:135–137.[Medline]

  17. Baatout S. Megakaryocytopoiesis: growth factors, cell cycle and gene expression. Anticancer Res 1998;18:1871–1882.[Medline]

  18. Di Noto R, Luciano L, Lo Pardo C et al. JURL-MK-1 (C-kithigh/CD30/CD40) and Jurl-MK2 (c-Kitlow/CD30+/cd40+) cell lines: "two sided" model for investigating leukemic megakaryocytopoiesis. Leukemia 1997;11:1554–1564.[CrossRef][Medline]

  19. Martin P, Papayannopoulou T. HEL cells: a new human erythroleukemia cell line with spontaneous and induced globin expression. Science 1982;216:1233–1235.[Abstract/Free Full Text]

  20. Zauli G, Catani L, Gibellini D et al. Impaired survival of bone marrow GPIIb-IIIa+ megakaryocytic cells as an additional pathogenetic mechanism of HIV-1 related thrombocytopenia. Br J Haematol 1996;92:711–716.[CrossRef][Medline]

  21. Bassini A, Pierpaoli S, Falcieri E et al. Selective modulation of the cyclin B/CDK1 and Cyclin D/CDK4 complexes during in vitro human megakaryocyte development. Br J Haematol 1999;104:820–828.[CrossRef][Medline]

  22. Shivdasani RA, Orkin SH. The transcriptional control of hematopoiesis. Blood 1996;87:4025–4039.[Free Full Text]

  23. Labbaye C, Valtieri M, Barberi T et al. Differential expression and functional role of GATA-2, NF-E2 and GATA-1 in normal adult hematopoiesis. J Clin Invest 1995;95:2346–2358.

  24. Nagata Y, Nagahisa H, Aida Y et al. Thrombopoietin induces megakaryocyte differentiation in hematopoietic progenitor FDC-P2 cells. J Biol Chem 1995;270:19673–19675.[Abstract/Free Full Text]

  25. Nagata Y, Nagahisa H, Nagasawa T et al. Regulation of megakaryocytopoiesis by thrombopoietin and stromal cells. Leukemia 1997;11:435–438.

  26. Yang M, Chui CMY, Yuen PMP et al. Expression of interleukin (IL) 1 type I and type II receptors in megakaryocytic cells and enhancing effects of IL-1ß on megakaryocytopoiesis and NF-E2 expression. Br J Haematol 2000;111:371–380.[CrossRef][Medline]

  27. Seder RA, Paul WE. Acquisition of lymphokine-producing phenotype by CD4+ T-cells. Annu Rev Immunol 1994;12:635–673.[CrossRef][Medline]

  28. Sonoda Y, Kuzuyama Y, Tanaka S et al. Human interleukin-4 inhibits proliferation of megakaryocyte progenitor cells in culture. Blood 1993;81:624–630.[Abstract/Free Full Text]

  29. Fortunel NO, Hatzfeld H, Hatzfeld JA. Transforming growth factor-beta: pleiotropic role in the regulation of hematopoiesis. Blood 2000;96:2022–2036.[Abstract/Free Full Text]

  30. Greenberg SM, Chandrasekhar C, Golan DE et al. Transforming growth factor-beta inhibits endomitosis in the Dami human megakaryocytic cell line. Blood 1990;76:533–537.[Abstract/Free Full Text]

  31. Cowley SA, Groopman JE, Avraham H. Effect of transforming growth factor-beta on megakaryocytic cell fusion and endomitosis. Int J Cell Cloning 1992;10:223–231.[Abstract]

  32. Kuter DJ, Gminski DM, Rosenberg RD. Transforming growth factor beta inhibits megakaryocyte growth and endomitosis. Blood 1992;79:619–626.[Abstract/Free Full Text]

  33. Berthier R, Valiron O, Schweitzer A et al. Serum-free medium allows the optimal growth of human megakaryocyte progenitors compared with human plasma supplemented cultures: role of TGF-beta. STEM CELLS 1993;11:120–129.[Abstract]

  34. Jackson H, Williams N, Westcott KR et al. Differential effects of transforming growth factor-beta 1 on distinct developmental stages of murine megakaryocytopoiesis. J Cell Physiol 1994;161:312–318.[CrossRef][Medline]

  35. Carlino JA, Higley HR, Creson JR et al. Transforming growth factor-ß1 systemically modulates granuloid, erythroid, lymphoid, and thrombocytic cells in mice. Exp Hematol 1992;20:943–950.[Medline]

  36. Letterio JJ, Geisei AG, Kulkarni AB et al. Autoimmunity associated with TGF-ß1 deficiency in mice is dependent on MHC class II antigen expression. J Clin Invest 1996;98:2109–2114.[Medline]

  37. Toki T, Arai K, Terui K et al. Functional characterization of the two alternative promoters of human p45NF-E2 gene. Exp Hematol 2000;28:1113–1119.[CrossRef][Medline]

  38. Hassan HT, Grell S, Borrman-Danso U et al. Interleukin-4 inhibits proliferation of human leukemic megakaryoblast cell line MHH 225. Hematol Oncol 1994;12:61–66.[Medline]

  39. Levin J, Peng J, Baker GR et al. Pathophysiology of thrombocytopenia and anemia in mice lacking transcription factor NF-E2. Blood 1999;94:3037–3047.[Abstract/Free Full Text]

  40. Mouthon MA, Navarro S, Katz A et al. C-jun and c-fos are expressed by human megakaryocytes. Exp Hematol 1992;20:9909–9915.

  41. Panterne B, Hatzfeld J, Blouchard JM. C-fos mRNA constitutive expression by mature human megakaryocytes. Oncogene 1992;7:2341–2344.[Medline]

Received on April 20, 2001; accepted for publication on April 24, 2001.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Catani, L.
Right arrow Articles by Tura, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Catani, L.
Right arrow Articles by Tura, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS