| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a Department of Pathology & Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA, USA;
b Canadian Blood Services, Edmonton, Alberta, Canada;
c Department of Medicine, University of Alberta, Edmonton, Alberta, Canada;
d James Graham Brown Cancer Center, Louisville, KY, USA
Key Words. Chemokines • Lymphocytes • Apoptosis • Cellular proliferation • Protein kinases
Correspondence:
Mariusz Z. Ratajczak, M.D., Ph.D., Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, University of Pennsylvania, 405A Stellar Chance Labs, 422 Curie Blvd., Philadelphia, Pennsylvania 19104, USA. Telephone: 215-573-3434; Fax: 215-573-6317; e-mail: mariusz{at}mail.med.upenn.edu
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chemokines, binds to the seven-span transmembrane G-protein-coupled CXCR4 receptor [1, 2] and competes with T-tropic HIV (X4 HIV) for binding to CXCR4 [3-7]. Members of the ß-chemokine family such as macrophage inflammatory protein 1ß (MIP-1ß), MIP-1, and RANTES bind to the CCR5 chemokine receptor and compete with M-tropic HIV (R5 HIV). SDF-1 is a chemotactic factor for human hematopoietic progenitor CD34+ cells and plays an important role in the homing of these cells in the bone marrow [8-10]. SDF-1 stimulation of hematopoietic cells activates several intracellular signaling pathways [10-15], and the SDF-1-CXCR4 axis has been implicated in the regulation of proliferation and/or survival of these cells [16-18]. Recently we reported that stimulation of the X4 HIV-related chemokine receptor CXCR4 by SDF-1 stimulates phosphorylation of MAPK p42/44 and activation of the phosphatidylinositol (PI)-3K-AKT axis in normal human CD34+ cells and megakaryoblasts [11-12]. To our surprise, however, activation of MAPK p42/44 and the PI-3K-AKT axis did not influence proliferation or apoptosis but SDF-1 stimulated chemotaxis, adhesion, and production of VEGF and MMP-9 in these cells [11]. To clarify whether SDF-1 stimulates proliferation of various T- and B-lymphoid or myeloid cells and/or increases their survival, and to learn more about the role of HIV-related chemokine receptor-chemokine axes in human hematopoiesis, we investigated the functionality of CXCR4 and CCR5 receptors in 26 human myeloid, T-, and B-lymphoid cell lines selected on the basis of their expression of these receptors (designated as CXCR4+, CCR5+, and CXCR4+CXCR5+ cell lines). We evaluated the phosphorylation of MAPK p42/44, AKT, and STAT proteins and the ability of SDF-1 and MIP-1ß to influence cell growth, inhibit apoptosis, activate integrins and stimulate the production of vascular endothelial growth factor (VEGF), matrix metalloproteinases (MMP)s, and tissue inhibitors (TIMPs) by these cells.
We found that in these lymphohematopoietic cells: A) the CXCR4-SDF-1 axis is more functional in lymphohematopoiesis in comparison to the CCR5-MIP-1ß axis; B) SDF-1 activates the MAPK p42/44 pathway and the PI-3K-AKT axis; however, activation of these pathways does not affect either cell proliferation or apoptosis, and C) SDF-1 stimulates secretion of VEGF and adhesion to fibronectin but does not induce MMP or stimulate TIMP production in these cell lines. Thus the role of SDF-1 in lymphohematopoietic cells is primarily related to regulation of their interactions with the hematopoietic microenvironment.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell Proliferation by MTT Assay
The MTT assay was performed according to the manufacturer's recommendations (Promega; Madison, WI). Briefly, cells were seeded in 96-well plates at 5 x 104/well in 100 µl of RPMI medium containing 0.5% bovine serum albumin (BSA), 2% BCS, or 10% BCS plus various concentrations of SDF-1ß (0, 1, 10, and 100 ng/ml). After 72 hours, 20 µl of CellTiter 96 Aqueous One Solution reagent were added to each well and plates were incubated for 3-4 hours. Subsequently, plates were read at 490 nm using an automated plate-reader [11].
Apoptosis Assays
Apoptosis was assessed by staining with fluorescein isothiocyanate (FITC)-Annexin V and flow cytometric analysis (FACScan, Becton Dickinson; Mountain View, CA; http://www.bd.com) and by the apoptosis detection kit (R&D Systems; Minneapolis, MN; http://www.rndsystems.com) used according to the manufacturer's protocol. Activation of caspase-3 and poly(ADP-ribose) polymerase (PARP) cleavage was determined by fluorescence-activated cell sorting (FACS) and Western blot, respectively, according to the manufacturer's protocols (Becton Dickinson and PharMingen; San Diego, CA; http://www.pharmingen.com).
Evaluation of Adhesion Molecules
The expression of adhesion molecules on human lymphohematopoietic cells was evaluated by FACS. Cells were stained with specific anti-PECAM-1, ICAM-1, VCAM-1, E-selectin, very late acting antigen-5 (VLA-5) and VLA-4 antibodies detected with PE-conjugated secondary phycoerythrin (PE)-goat anti-mouse monoclonal antibodies (mAbs) as described previously [21-24]. The following antibodies were used for this study: 4G6 (IgG2b, mouse anti-human PECAM-1) generously provided by Dr. Steven Albelda [21]; R6.5 (BIRR-1), a murine IgG2a mAb directed against extracellular domain 2 of the ICAM-1 molecule, provided by Boehringer Ingelheim Pharmaceuticals Inc., Ridgefield, CT; http://www.boehringer-ingelheim.com [22]; 4B9, an IgG1 mAb directed against human VCAM-1, kindly provided by Dr. Roy Lobb, Biogen Inc., Cambridge MA; http://www.biogen.com [23], and ES2, (IgG1-k mouse anti-human-E-selectin mAb), generously provided by Dr. Rodger McEver, University of Oklahoma; Tulsa, OK [24].
Adhesion Assays
Adherence assays of hematopoietic cells were performed as described [11, 25, 26]. Briefly, 96 microtiter plates (Dynatech Labs; Chantilly, VA) covered with fibronectin were incubated for 30 minutes at 37°C in lymphocyte suspension buffer in the absence or presence of SDF-1 (500 ng/ml). Cell suspensions (100 µl) were applied to the wells and incubated for 1 hour at 37°C. The number of adherent cells was estimated by employing the colorimetric phosphate assay as described previously [11, 25, 26].
MMP and TIMP Evaluation
Lymphoma cell lines (JIM-1, NALM-6, 697, RS11846, RS911, HUT102B, C91PL, 2A, Sez-4, and PB-1) were incubated in serum-free RPMI (2-4 x 106 cells/ml) at 37°C in 5% CO2 for 24-48 hours with or without SDF-1 (100 ng/ml). After the incubation period, cell-conditioned media were collected for zymographic analysis of MMP-9 and MMP-2 activities and reverse zymographic analysis of TIMP-1 and TIMP-2 while the pellets were used for total RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR) analysis as described previously [27, 28]. Zymography was carried out using 12% polyacrylamide gel copolymerized with 1.5 mg/ml gelatin (Sigma; St. Louis, MO; http://www.sigma-aldrich.com) and clear bands at 92 kDa and 72 kDa against a Coomassie blue background indicated the presence of MMP-9 and MMP-2, respectively. Reverse zymography was performed using 12% polyacrylamide containing 1.75 mg/ml gelatin and 160 ng/ml recombinant MMP-2 (Oncogene Research Products; Cambridge, MA), and dark blue bands against a clear background indicated TIMP activity. Total cellular RNA was isolated using TRIZOL (GIBCO BRL; Gaithersburg, MD). The conversion of mRNA to cDNA was done using RT (AMVRT, MJS Biolynx; Brockville, ON, Canada; http://www.biolynx.ca) and the PCR using Taq DNA polymerase (GIBCO BRL; Long Island, NY) following the primer-dropping method. Sequences for human MMP-2, MMP-9, TIMP-1, TIMP-2, and GAPDH were obtained from GenBank (Los Alamos, NM) and used to design primer pairs. The primers used were as follows: MMP-2: 5'-primer, 5'GGCCCTGTCACTCCTGAGAT; 3'-primer, 5'GGCATC-CAGGT- TATCGGGGA; MMP-9: 5'-primer, 5'CAACATCACCTATTGGATCC; 3'-primer, 5'CGGGTGTAGAGTC TCTCGCT; TIMP-1: 5'-primer, 5'GCGGATCCAGCGCCCACACACAGACACC; 3'-primer, 5'TTAAGCTTCCACTC- CGGGGCAGATT; TIMP-2: 5'-primer, 5'GGCGTTTTGCAATGCAGATGTAG; 3'-primer, 5'CACAGGAGCCGTCACTTCTCTTG; and GAPDH: 5'-primer, 5'CGGAGTCA- ACGGATTTGGTCGTAT; 3'-primer, 5'AGCCTTCTCCATGGTTGGTGAAGAC. Thermocycling was performed with an Eppendorf Mastercycler personal thermocycler (Westbury, NY) at the optimum cycle number for each primer. PCR products were electrophoresed through 2% agarose gels containing 0.1 µg/µl ethidium bromide. Gels were visualized under UV light and photographed using the Kodak DC120 zoom digital camera (Eastman Kodak Co.; Rochester, NY).
VEGF Enzyme-Linked Immunosorbent Assay (ELISA)
Secretion of VEGF by human hematopoietic cell lines was evaluated by the Quantikine human VEGF immunoassay (R&D Systems) according to the manufacturer's protocol as described [11].
Phosphorylation of Intracellular Pathway Proteins
Western blots were done on extracts prepared from hematopoietic cell lines (1 x 107 cells) which were kept in RPMI medium containing low levels of BSA (0.5%) to render the cells quiescent. The cells were then divided and stimulated with optimal doses of SDF-1 or SDF-1ß (500 ng/ml) or thrombopoietin (TPO) (100 ng/ml) for 1 minute-2 hours at 37°C, and then lysed (for 10 minutes) on ice in M-Per lysing buffer (Pierce; Rockford, IL) containing protease and phosphatase inhibitors (Sigma). Subsequently, the extracted proteins were separated on either a 12% or 15% SDS-PAGE gel and the fractionated proteins transferred to a nitrocellulose membrane (Schleicher & Schuell; Keene, NH) as previously described [11, 12, 29]. Phosphorylation of each of the intracellular kinases, 44/42 MAPK (Thr 202/Tyr 204), p38 MAPK, AKT, and STAT-1, -3, -5, and -6 was detected using commercial mouse phospho-specific mAb (p44/42) or rabbit phospho-specific polyclonal antibodies for each of the remainder (all from New England Biolabs; Beverly, MA) with horseradish peroxidase-conjugated goat anti-mouse IgG or goat anti-rabbit IgG as a secondary antibody (Santa Cruz Biotech; Santa Cruz, CA; http://www.scbt.com) as described [11, 12, 29]. Equal loading in the lanes was evaluated by stripping the blots and reprobing with appropriate mAbs: p42/44 anti-MAPK antibody clone #9102, anti-AKT antibody clone #9272, anti-STAT 3 #9132 (New England Biolabs; http://www.neb.com/), anti-STAT 1 #sc-464, and STAT 6 #sc-1689 (Santa Cruz Biotech) and anti-STAT 5 #89 (Transduction Laboratories; Lexington, KY). The membranes were developed with an ECL reagent (Amersham Life Sciences; Little Chalfont, UK), dried, and subsequently exposed to film (HyperFilm, Amersham). Densitometric analysis was performed using exposures that were within the linear range of the densitometer (Personal Densitometer SI, Molecular Dynamics; Sunnyvale, CA) and ImageQuant software (Molecular Dynamics).
Statistical Analysis
Arithmetic means and standard deviations were calculated on a Macintosh computer using Instat 1.14 (GraphPad; San Diego, CA; http://www.graphpad.com) software. Data were analyzed using the Student t-test for unpaired samples. Statistical significance was defined as p < 0.05.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). We found that MAPK p42/44 and AKT were constitutively activated in some of these cell lines: MAPK p42/44 was constitutively phosphorylated in Sez4, 697, DAUDI, YT, and HL-60 cells (Table 1; Fig. 1, panel A) and AKT in L428, HS Sultan, DAUDI, YT, Jurkat, MOLT4, 20A, 15A, and SUDHL-6. Addition of SDF-1 did not affect the phosphorylation status of these proteins (Table 2; Fig. 1, panel B).
|
|
|
|
; Fig. 2). Similarly, AKT was phosphorylated in 10 of 12 CXCR4+ CCR5+ or CXCR4+ cell lines (PB-1, 2A, Sez4, C91PL, 697, RS11846, HUT102B, JIM-1, NALM-6, and RS911) (Table 2; Fig. 3), the exceptions being ATL-2 and HL-60 cells. Hence, SDF-1 activated MAPK p42/44 in all, and AKT in 85%, of the CXCR4+ cell lines selected for this study.
|
|
and Figure 4 and AKT phosphorylation in none of them (Table 2).
|
). We noticed that except for the L428 cell (Hodgkin's disease), the status of phosphorylation of STAT-1, -3, and -5 proteins at tyrosine residues did not change after stimulation of CXCR4+ and/or CCR5+ cell lines with either SDF-1 or MIP-1ß (Table 3). This finding is consistent with our previous observations of normal human megakaryoblasts [11].
Phosphorylation of MAPK p42/44 by SDF-1 or MIP-1ß Does Not Affect Cell Proliferation
It has been postulated that the phosphorylation of MAPK p42/44 plays an important role in regulating cell proliferation [30, 31]. In this study we examined whether SDF-1 stimulates the growth of the 16 cell lines (Table 1) we found to respond positively to stimulation with SDF-1 by phosphorylation of MAPK p42/44. Using the colorimetric MTT assay, cell proliferation was evaluated 72 hours after stimulation by SDF-1. SDF-1 (1-100 ng/ml) had no effect on proliferation of these cells regardless of whether the cell lines were cultured in media containing 10% or 2% BCS and 0.5% BSA. A representative experiment is shown in Figure 5. MIP-1ß did not influence the proliferation of HS Sultan and HEL cells, either; however, MAPK p42/44 was phosphorylated after stimulation of these cells by MIP-1ß (Fig 4).
|
) that responded to SDF-1 stimulation by activation of AKT. Apoptosis was induced by culturing hematopoietic cells in 0.5% BSA either with or without SDF-1, or by irradiating these cells by 1,000-2,000 cGy in the presence or absence of SDF-1. The number of apoptotic cells was evaluated by the Annexin-V binding assay, presence of activated intracellular caspase-3, and cleavage of PARP. We found that lymphohematopoietic cells spontaneously underwent apoptosis after prolonged culture in medium supplemented with 0.5% BSA or after 
-irradiation and that the addition of SDF-1 to media did not improve the survival of serum-starved cells (data not shown) or -irradiated cells (Figs. 6, 7). Representative data show Annexin-V binding (Fig. 6, panel A), caspase-3 activation (Fig. 6, panel B) and PARP cleavage (Fig. 6, panel C) in cells that were -irradiated and cultured in the absence or presence of SDF-1. Apoptosis was induced by -irradiation in JIM-1, NALM-6, and RS911 B-lymphoid cell lines, and the survival of irradiated cells was not improved by the presence of SDF-1 in the culture media (Fig. 6). Similarly, as shown in Figure 7, -irradiation induced apoptosis in PB-1 and 2A T-lymphoid cells and, again, survival of these cells was not affected. Of note, while -irradiation increased the number of Annexin V binding cells in the 2A cell line (an early sign of apoptosis) (Fig. 7, right panel), activation of caspase-3 and consequently PARP cleavage was somewhat delayed in this cell line as compared with PB-1 cells (Fig. 7, left panel).
|
|
B in a PI-3K-AKT-dependent manner [11] and, since NF-B binding sites are present in the promoters of several adhesion molecules [36, 37], in this study we investigated whether SDF-1 regulates expression of these proteins on the cell surface. We phenotyped the cell lines that responded to stimulation by SDF-1 (Tables 1, 2) for expression of PECAM-1, ICAM-1, VCAM-1, E-selectin, VLA-5, and VLA-4. We demonstrated that several of these molecules are expressed on these lymphohematopoietic cell lines (Table 4) but, to our surprise, SDF-1 stimulation did not affect the level of their expression (data not shown), indicating that SDF-1 does not play a role in regulating their cell surface expression. Moreover, since we and others reported that SDF-1 may regulate the function of several integrins on normal human hematopoietic cells [14], we selected eight cell lines from among the VLA-4+ and VLA-5+ cell lines (Table 4) and investigated whether SDF-1 regulates their adhesion to fibronectin. We found that SDF-1 significantly increased adhesion to fibronectin in two B-lymphocytic cell lines (RS11846) as well as three T-lymphocytic cell lines (Jurkat, PB-1, and 2A) (Fig. 8). Since 2A cells did not express VLA-4 on their surface, we assumed that the binding of 2A cells to the fibronectin is most probably regulated by other members of the integrin family.
|
|
B axis-dependent manner in normal human megakaryoblasts [11]. As both VEGF and MMP-9 proteins play a role in cell migration [11, 27, 28, 38-40] and cellular interactions with endothelium, we asked whether a similar mechanism operates in cells derived from T- and B-lymphoid lineages. Cells were made quiescent and subsequently stimulated or not (control) with SDF-1. The VEGF levels in media conditioned by cells in the absence or presence of SDF-1 are shown in Table 5. We found that VEGF was constitutively secreted by all cell lines except NALM-6, and secretion was upregulated by SDF-1 stimulation in eight of the nine cell lines evaluated. VEGF secretion was enhanced up to 10-fold in C19PL, threefold in Jurkat and RS11846, and two-fold in 2A and PB-1 cell lines as compared with unstimulated cells (Table 5).
|
). Moreover, stimulation of these cells by SDF-1 did not have any effect on either expression of MMP-2 or MMP-9 (Fig. 9) or their secretion (not shown). TIMP-1 was constitutively expressed by NALM 6, RS911, Sez-4, HUT102B, 2A, 697, JIM-1, and RS11846 but was not stimulated by SDF-1. These cell lines also constitutively expressed TIMP-2 except for HUT102B, 2A, and RS11846 (Fig. 9).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To further address the question of whether SDF-1 regulates proliferation and/or survival of human lymphohematopoietic cells, we selected CXCR4+ cell lines which responded to stimulation by SDF-1 by phosphorylation of MAPK p42/44 and/or AKT and we found that MAPK p42/44 became phosphorylated in all the cell lines studied, and AKT in 85%. In contrast, we demonstrated that in CCR5+ cell lines, the CCR5 specific ligand MIP-1ß stimulated phosphorylation of MAPK p42/44 in only 20%, and of AKT in none of the cell lines studied. Thus, these results are consistent with our previous calcium flux and chemotaxis investigations, indicating that in human hematopoietic cells the CXCR4 receptor is more functional than the CCR5 receptor [11, 12, 29].
Although in our human lymphohematopoietic cell lines both the MAPK p42/44 and PI-3K-AKT axes were activated by SDF-1, none of them responded to SDF-1 stimulation with increased proliferation and/or reduced apoptosis. This could suggest that activation of other parallel or downstream signaling pathways/proteins (not activated by the SDF-1-CXCR4 axis) may be important for stimulating proliferation and/or inhibiting apoptosis in lymphohematopoietic cells.
Recently we showed activation of STAT proteins after stimulation with TPO but not with SDF-1, which explains why thrombopoietin, but not SDF-1, stimulates proliferation and inhibits apoptosis in normal human megakaryoblasts [11]. Significant experimental evidence suggests that STAT proteins are involved both in stimulation of proliferation [45-47] and inhibition of apoptosis [48]. For example, STAT-5 has been found to regulate expression of the antiapoptotic bcl-xl protein in hematopoietic cells, and STAT protein binding sites have been shown in the promoters of several antiapoptotic genes [48]. However, in this study of 26 human lymphohematopoietic cell lines, except for L428 (Hodgkin's disease) STAT proteins were not phosphorylated at tyrosine residues after stimulation with either SDF-1 or MIP-1ß. Hence, we suggest that in human normal as well as malignant hematopoietic cells, STAT proteins are not primary targets for chemokine signaling.
Interestingly, in certain of the cell lines studied we found that some STAT proteins are activated constitutively, but that additional costimulation of these cells with SDF-1, although resulting in activation of MAPK p42/44 and/or AKT in these cells, did not affect their proliferation or survival. Hence, we postulate that the regulatory role of SDF-1 is not concerned with stimulating either proliferation or survival of lymphohematopoietic cells [11, 12, 19, 43, 49].
In contrast, we found that SDF-1 activates integrins and stimulates secretion of VEGF by these cells. These data are in agreement with our previous studies performed on normal human megakaryoblasts [11]. Activation of integrins and VEGF secretion are crucial in regulating the interactions of hematopoietic cells with endothelial and stromal cells. Whereas VEGF activates endothelial cells and stimulates angiogenesis, integrins regulate adhesion of hematopoietic cells to the fibronectin and other ligands in the bone marrow microenvironment. Other factors which participate in cellular interactions and angiogenesis include MMPs. Various cytokines and chemokines were shown to induce MMP production in normal T cells [50], and we recently suggested that interleukin 6 stimulated the production of MMPs and may play a role in the development of lymphoid malignancies [51]. In this study, the majority of the cell lines of T- and B-lymphoid origin did not express or secrete MMP-9 and MMP-2, and SDF-1 had no effect on their expression as it did in normal human megakaryoblasts and CD34+ progenitor cells [11, 38]. On the other hand, we found that all the lymphoid cell lines studied (JIM-1, NALM-6, 697, RS11846, RS911, HUT102B, 2A, and Sez-4) expressed MMP inhibitors (TIMP-1 and/or TIMP-2) but, again, SDF-1 did not affect TIMP expression as it did in peripheral blood CD34+ cells [38]. This suggests that in lymphoid cells, regulation of MMPs and TIMPs may operate by mechanisms other than those occurring in cells of myeloid origin.
We believe that these studies may shed light on certain processes taking place during HIV infection as several HIV envelope proteins as well the HIV tat protein have been reported to affect the biological function of the SDF-1-CXCR4 axis [52]. We suggest that the blockage of the CXCR4 receptor by such proteins could perturb the interaction of lymphoid cells with their microenvironment. Such perturbation of the CXCR4-SDF-1 axis may lead to altered interaction of lymphoid cells with their physiological microenvironment in various lymphohematopoietic organs. Perturbation of adhesion may decrease signaling from integrin receptors [15], leading to a decrease in cell survival by the anoikis-dependent mechanism [53]. We are currently investigating this latter possibility in our laboratory.
Based on these and our other observations [11, 12, 19, 38], we conclude that SDF-1 is an important factor regulating the interaction of lymphohematopoietic cells with the microenvironment but is not primarily involved in regulating proliferation or survival of these cells.
|
ACKNOWLEDGMENT |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and stem cell factor/kit ligand share signaling pathways in hemopoietic progenitors: a potential mechanism for cooperative induction of chemotaxis. J Immunol 1998;161:3652–3658., binds to the transmembrane G-protein-coupled CXCR-4 receptor and activates multiple signal transduction pathways. J Biol Chem 1998;273:23169–23175. stimulates tyrosine phosphorylation of multiple focal adhesion proteins and induces migration of hematopoietic progenitor cells: roles of phosphoinositide-3 kinase and protein kinase C. Blood 2000;95:2505–2513. (SDF-1) to CXCR4 chemokine receptor in normal human megakaryoblasts but not in platelets induces phosphorylation of mitogen-activated protein kinase p42/44 (MAPK), ELK-1 transcription factor and serine/threonine kinase AKT. Eur J Haematol 2000;64:164–172.[CrossRef][Medline]B and rel proteins: evolutionarily conserved mediators of immune response. Annu Rev Immunol 1998;16:225–260.[CrossRef][Medline]This article has been cited by other articles:
|
|
 |
|
  M. T. Scupoli, M. Donadelli, F. Cioffi, M. Rossi, O. Perbellini, G. Malpeli, S. Corbioli, F. Vinante, M. Krampera, M. Palmieri, et al. Bone marrow stromal cells and the upregulation of interleukin-8 production in human T-cell acute lymphoblastic leukemia through the CXCL12/CXCR4 axis and the NF-{kappa}B and JNK/AP-1 pathways Haematologica, April 1, 2008; 93(4): 524 - 532. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. L. Ebos, C. R. Lee, J. G. Christensen, A. J. Mutsaers, and R. S. Kerbel Multiple circulating proangiogenic factors induced by sunitinib malate are tumor-independent and correlate with antitumor efficacy PNAS, October 23, 2007; 104(43): 17069 - 17074. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Xu, A. Mora, H. Shim, A. Stecenko, K. L. Brigham, and M. Rojas Role of the SDF-1/CXCR4 Axis in the Pathogenesis of Lung Injury and Fibrosis Am. J. Respir. Cell Mol. Biol., September 1, 2007; 37(3): 291 - 299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Yoon, Z. Liang, X. Zhang, M. Choe, A. Zhu, H. T. Cho, D. M. Shin, M. M. Goodman, Z. Chen, and H. Shim CXC Chemokine Receptor-4 Antagonist Blocks Both Growth of Primary Tumor and Metastasis of Head and Neck Cancer in Xenograft Mouse Models Cancer Res., August 1, 2007; 67(15): 7518 - 7524. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N Cabioglu, Y Gong, R Islam, K. Broglio, N Sneige, A Sahin, A. Gonzalez-Angulo, P Morandi, C Bucana, G. Hortobagyi, et al. Expression of growth factor and chemokine receptors: new insights in the biology of inflammatory breast cancer Ann. Onc., June 1, 2007; 18(6): 1021 - 1029. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. C. Schatteman, M. Dunnwald, and C. Jiao Biology of bone marrow-derived endothelial cell precursors Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H1 - H18. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Zheng, S.-h. Oh, Y. Jung, and B. E. Petersen Oval Cell Response in 2-Acetylaminofluorene/Partial Hepatectomy Rat Is Attenuated by Short Interfering RNA Targeted to Stromal Cell-Derived Factor-1 Am. J. Pathol., December 1, 2006; 169(6): 2066 - 2074. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Cassol, M. Alfano, P. Biswas, and G. Poli Monocyte-derived macrophages and myeloid cell lines as targets of HIV-1 replication and persistence J. Leukoc. Biol., November 1, 2006; 80(5): 1018 - 1030. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B.-R. Son, L. A. Marquez-Curtis, M. Kucia, M. Wysoczynski, A. R. Turner, J. Ratajczak, M. Z. Ratajczak, and A. Janowska-Wieczorek Migration of Bone Marrow and Cord Blood Mesenchymal Stem Cells In Vitro Is Regulated by Stromal-Derived Factor-1-CXCR4 and Hepatocyte Growth Factor-c-met Axes and Involves Matrix Metalloproteinases Stem Cells, May 1, 2006; 24(5): 1254 - 1264. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. N. Gomperts and R. M. Strieter CXC Chemokines in Angiogenesis and Metastases Am. Assoc. Cancer Res. Educ. Book, April 1, 2006; 2006(1): 11 - 18. [Full Text] [PDF]
|
|
|
|
|
|
M. Kucia, R. Reca, K. Miekus, J. Wanzeck, W. Wojakowski, A. Janowska-Wieczorek, J. Ratajczak, and M. Z. Ratajczak Trafficking of Normal Stem Cells and Metastasis of Cancer Stem Cells Involve Similar Mechanisms: Pivotal Role of the SDF-1-CXCR4 Axis Stem Cells, August 1, 2005; 23(7): 879 - 894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Moriguchi, B. D. Hissong, M. Gadina, K. Yamaoka, H. L. Tiffany, P. M. Murphy, F. Candotti, and J. J. O'Shea CXCL12 Signaling Is Independent of Jak2 and Jak3 J. Biol. Chem., April 29, 2005; 280(17): 17408 - 17414. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Piovan, V. Tosello, S. Indraccolo, A. Cabrelle, I. Baesso, L. Trentin, R. Zamarchi, H. Tamamura, N. Fujii, G. Semenzato, et al. Chemokine receptor expression in EBV-associated lymphoproliferation in hu/SCID mice: implications for CXCL12/CXCR4 axis in lymphoma generation Blood, February 1, 2005; 105(3): 931 - 939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Kryczek, A. Lange, P. Mottram, X. Alvarez, P. Cheng, M. Hogan, L. Moons, S. Wei, L. Zou, V. Machelon, et al. CXCL12 and Vascular Endothelial Growth Factor Synergistically Induce Neoangiogenesis in Human Ovarian Cancers Cancer Res., January 15, 2005; 65(2): 465 - 472. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Perissinotto, G. Cavalloni, F. Leone, V. Fonsato, S. Mitola, G. Grignani, N. Surrenti, D. Sangiolo, F. Bussolino, W. Piacibello, et al. Involvement of Chemokine Receptor 4/Stromal Cell-Derived Factor 1 System during Osteosarcoma Tumor Progression Clin. Cancer Res., January 15, 2005; 11(2): 490 - 497. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wysoczynski, R. Reca, J. Ratajczak, M. Kucia, N. Shirvaikar, M. Honczarenko, M. Mills, J. Wanzeck, A. Janowska-Wieczorek, and M. Z. Ratajczak Incorporation of CXCR4 into membrane lipid rafts primes homing-related responses of hematopoietic stem/progenitor cells to an SDF-1 gradient Blood, January 1, 2005; 105(1): 40 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. P. Smith, K. E. Luker, J. R. Garbow, J. L. Prior, E. Jackson, D. Piwnica-Worms, and G. D. Luker CXCR4 Regulates Growth of Both Primary and Metastatic Breast Cancer Cancer Res., December 1, 2004; 64(23): 8604 - 8612. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Jaleel, A. C. Tsai, S. Sarkar, P. V. Freedman, and L. P. Rubin Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival Mol. Hum. Reprod., December 1, 2004; 10(12): 901 - 909. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. L. Brooks Jr, S. Caballero Jr, C. K. Newell, R. L. Steinmetz, D. Watson, M. S. Segal, J. K. Harrison, E. W. Scott, and M. B. Grant Vitreous Levels of Vascular Endothelial Growth Factor and Stromal-Derived Factor 1 in Patients With Diabetic Retinopathy and Cystoid Macular Edema Before and After Intraocular Injection of Triamcinolone Arch Ophthalmol, December 1, 2004; 122(12): 1801 - 1807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Liang, T. Wu, H. Lou, X. Yu, R. S. Taichman, S. K. Lau, S. Nie, J. Umbreit, and H. Shim Inhibition of Breast Cancer Metastasis by Selective Synthetic Polypeptide against CXCR4 Cancer Res., June 15, 2004; 64(12): 4302 - 4308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B.-C. Lee, T.-H. Lee, S. Avraham, and H. K. Avraham Involvement of the Chemokine Receptor CXCR4 and Its Ligand Stromal Cell-Derived Factor 1{alpha} in Breast Cancer Cell Migration Through Human Brain Microvascular Endothelial Cells Mol. Cancer Res., June 1, 2004; 2(6): 327 - 338. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tavor, I. Petit, S. Porozov, A. Avigdor, A. Dar, L. Leider-Trejo, N. Shemtov, V. Deutsch, E. Naparstek, A. Nagler, et al. CXCR4 Regulates Migration and Development of Human Acute Myelogenous Leukemia Stem Cells in Transplanted NOD/SCID Mice Cancer Res., April 15, 2004; 64(8): 2817 - 2824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Ratajczak, R. Reca, M. Kucia, M. Majka, D. J. Allendorf, J. T. Baran, A. Janowska-Wieczorek, R. A. Wetsel, G. D. Ross, and M. Z. Ratajczak Mobilization studies in mice deficient in either C3 or C3a receptor (C3aR) reveal a novel role for complement in retention of hematopoietic stem/progenitor cells in bone marrow Blood, March 15, 2004; 103(6): 2071 - 2078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Jankowski, M. Kucia, M. Wysoczynski, R. Reca, D. Zhao, E. Trzyna, J. Trent, S. Peiper, M. Zembala, J. Ratajczak, et al. Both Hepatocyte Growth Factor (HGF) and Stromal-Derived Factor-1 Regulate the Metastatic Behavior of Human Rhabdomyosarcoma Cells, But Only HGF Enhances Their Resistance to Radiochemotherapy Cancer Res., November 15, 2003; 63(22): 7926 - 7935. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Phillips, M. D. Burdick, M. Lutz, J. A. Belperio, M. P. Keane, and R. M. Strieter The Stromal Derived Factor-1/CXCL12-CXC Chemokine Receptor 4 Biological Axis in Non-Small Cell Lung Cancer Metastases Am. J. Respir. Crit. Care Med., June 15, 2003; 167(12): 1676 - 1686. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Papayannopoulou, G. V. Priestley, H. Bonig, and B. Nakamoto The role of G-protein signaling in hematopoietic stem/progenitor cell mobilization Blood, June 15, 2003; 101(12): 4739 - 4747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Helbig, K. W. Christopherson II, P. Bhat-Nakshatri, S. Kumar, H. Kishimoto, K. D. Miller, H. E. Broxmeyer, and H. Nakshatri NF-{kappa} B Promotes Breast Cancer Cell Migration and Metastasis by Inducing the Expression of the Chemokine Receptor CXCR4 J. Biol. Chem., June 6, 2003; 278(24): 21631 - 21638. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Reca, D. Mastellos, M. Majka, L. Marquez, J. Ratajczak, S. Franchini, A. Glodek, M. Honczarenko, L. A. Spruce, A. Janowska-Wieczorek, et al. Functional receptor for C3a anaphylatoxin is expressed by normal hematopoietic stem/progenitor cells, and C3a enhances their homing-related responses to SDF-1 Blood, May 15, 2003; 101(10): 3784 - 3793. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Z. Ratajczak, M. Majka, M. Kucia, J. Drukala, Z. Pietrzkowski, S. Peiper, and A. Janowska-Wieczorek Expression of Functional CXCR4 by Muscle Satellite Cells and Secretion of SDF-1 by Muscle-Derived Fibroblasts is Associated with the Presence of Both Muscle Progenitors in Bone Marrow and Hematopoietic Stem/Progenitor Cells in Muscles Stem Cells, May 1, 2003; 21(3): 363 - 371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. E. Broxmeyer, S. Cooper, L. Kohli, G. Hangoc, Y. Lee, C. Mantel, D. W. Clapp, and C. H. Kim Transgenic Expression of Stromal Cell-Derived Factor-1/CXC Chemokine Ligand 12 Enhances Myeloid Progenitor Cell Survival/Antiapoptosis In Vitro in Response to Growth Factor Withdrawal and Enhances Myelopoiesis In Vivo J. Immunol., January 1, 2003; 170(1): 421 - 429. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Ferrero, D. Belloni, P. Contini, C. Foglieni, M. E. Ferrero, M. Fabbri, A. Poggi, and M. R. Zocchi Transendothelial migration leads to protection from starvation-induced apoptosis in CD34+CD14+ circulating precursors: evidence for PECAM-1 involvement through Akt/PKB activation Blood, January 1, 2003; 101(1): 186 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Murakami, W. Maki, A. R. Cardones, H. Fang, A. Tun Kyi, F. O. Nestle, and S. T. Hwang Expression of CXC Chemokine Receptor-4 Enhances the Pulmonary Metastatic Potential of Murine B16 Melanoma Cells Cancer Res., December 1, 2002; 62(24): 7328 - 7334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Libura, J. Drukala, M. Majka, O. Tomescu, J. M. Navenot, M. Kucia, L. Marquez, S. C. Peiper, F. G. Barr, A. Janowska-Wieczorek, et al. CXCR4-SDF-1 signaling is active in rhabdomyosarcoma cells and regulates locomotion, chemotaxis, and adhesion Blood, September 18, 2002; 100(7): 2597 - 2606. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Lee, A. Gotoh, H.-J. Kwon, M. You, L. Kohli, C. Mantel, S. Cooper, G. Hangoc, K. Miyazawa, K. Ohyashiki, et al. Enhancement of intracellular signaling associated with hematopoietic progenitor cell survival in response to SDF-1/CXCL12 in synergy with other cytokines Blood, May 29, 2002; 99(12): 4307 - 4317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Hideshima, D. Chauhan, T. Hayashi, K. Podar, M. Akiyama, D. Gupta, P. Richardson, N. Munshi, and K. C. Anderson The Biological Sequelae of Stromal Cell-derived Factor-1{alpha} in Multiple Myeloma Mol. Cancer Ther., May 1, 2002; 1(7): 539 - 544. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
