HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Adachi, Y. Articles by Ikehara, S. Search for Related Content PubMed PubMed Citation Articles by Adachi, Y. Articles by Ikehara, S.

Marked Increase in Number of Dendritic Cells in Autoimmune-Prone (NZW x BXSB)F1 Mice with Age

^a First Department of Pathology, Kansai Medical University, Moriguchi City, Osaka;
^b Department of Biotechnology, Kyoto Institute of Technology, Sakyo-ku, Kyoto;
^c Third Department of Internal Medicine, Kansai Medical University, Moriguchi City, Osaka;
^d First Department of Internal Medicine, Kansai Medical University, Moriguchi City, Osaka;
^e Second Department of Internal Medicine, Kansai Medical University, Moriguchi City, Osaka, Japan

Key Words. Autoimmune disease • Dendritic cell • Flt-3 ligand • (NZW x BXSB)F1 mouse

Susumu Ikehara, M.D., Ph.D., First Department of Pathology, Kansai Medical University, Fumizono-cho, Moriguchi City, Osaka 570-8506, Japan. Telephone: 81-6-6993-9429; Fax: 81-6-6994-8283; e-mail: ikehara{at}takii.kmu.ac.jp

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
Here, we report that the number of CD11c⁺CD3^– B220^– cells increases in autoimmune-prone male (NZW x BXSB)F1 (W/BF1) mice with age. The CD11c⁺CD3^–B220^– cells from W/BF1 mice show a typical stellate shape and induce the proliferation of T cells. In the CD11c⁺CD3^–B220^– cells from W/BF1 mice, CD11b (Mac-1), NK 1.1, and CD95 (Fas) are upregulated in comparison with normal mice, while the expression of CD8, CD117 (c-kit), CD135 (Flk-2/Flt-3), and Sca-1 decreases. There is a significant increase in Flt-3L (FL) mRNA in the bone marrow of W/BF1 mice with age. Moreover, activated hemopoietic cells express high levels of FL. The injection of CD11c⁺CD3^–B220^– cells from old W/BF1 mice to young W/BF1 mice transiently induces autoimmune disease (thrombocytopenia). These results suggest that hyperproduction of FL from activated hemopoietic cells induces a dramatic increase in the number of dendritic cells in aged W/BF1 mice, followed by the acceleration of autoimmunity.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
(NZW x BXSB)F1 (W/BF1) mice are known as autoimmune-prone mice that show lupus nephritis [1], thrombocytopenia [2–4], leukocytosis [2], hypertension [5], hypergammaglobulinemia [6], thymic atrophy [7], and myocardial infarction [1, 5]. We have previously reported that the number of white blood cells, particularly Mac-1⁺ or Gr-1⁺ cells, increases in the peripheral blood of W/BF1 mice, and that day 14 colony-forming units-granulocyte, erythroid, macrophage, megakaryocyte (CFU-GEMM) and CFU-GM counts of the bone marrow (BM) cells in aged W/BF1 mice increase [8]. In addition, we have found that GM-CSF mRNA decreases in the BM of aged W/BF1 mice, while G-CSF mRNA increases [8].

Dendritic cells (DCs), which differentiate from hematopoietic stem cells in the BM, are well known to have the strong capacity to present antigens to T cells and induce the activation of T cells [9]. Although DCs reside in all organs, their numbers are very small [10]. It has been reported that GM-CSF plays a crucial role in the differentiation of DCs [11], and that the in vivo administration of Flt-3 ligand (FL) dramatically increases their number [12]; however, it is still unclear which cytokine(s) or what other factor(s) are actually involved in the differentiation of DCs in vivo.

In the present study, we show that the number of DCs increases in autoimmune-prone W/BF1 mice with age due to the upregulation of FL and that DCs accelerate autoimmune disease.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mice
W/BF1 mice were purchased from Kiwa Animal Center (Wakayama, Japan) and SLC (Shizuoka, Japan). C57BL/6 (B6), NZW, NZB, (NZBxNZW)F1 (B/WF1), BXSB mice, and (BALB/cxDBA2)F1 (CDF1) mice were obtained from SLC.

Reagents
Phycoerythrin (PE)- or fluorescein isothiocyanate (FITC)-labeled anti-CD11c, FITC-labeled anti-CD4, FITC-labeled anti-CD8, FITC-labeled anti-Thy1.2, FITC-labeled anti-Gr-1, FITC-labeled anti-Mac-1, FITC-labeled anti-Ia^b, FITC-labeled anti-B7-1 (CD80), FITC-labeled anti-B7-2 (CD86), FITC-labeled anti-B220, FITC-labeled anti-Igh^a (Igh6^a), FITC-labeled anti-CD40, FITC-labeled anti-ICAM-1, FITC-labeled anti-VCAM-1, FITC-labeled anti-CD62L, FITC-labeled anti-CD72a (Lyb-2.1), FITC-labeled anti-CD43, FITC-labeled anti-Fas, and PE-labeled anti-CD14, PE-labeled anti-CD135 were purchased from PharMingen (San Diego, CA; http://www.pharmingen.com). FITC-labeled anti-CD3, FITC-labeled anti-CD32/16, and FITC-labeled anti-CD11a were from Coulter-Immunotech (Marseille, France; http://www.coulter.com). FITC-labeled F4/80 and NLDC-145 (anti-DEC-205) were from Cosmo Bio (Tokyo, Japan; http://www.cosmobio.co.jp). FITC-labeled anti-rat IgG was from Biosource (Camarillo, CA; http://www.biosource.com). PE-labeled 33D1 was from Leinco Technologies (Ballnin, MO; http://www.leinco.com). FITC-labeled anti-CD5 was from Becton Dickinson (San Jose, CA; http://www.bd.com). Red PE-Cy5-labeled streptavidin was from DAKO Japan (Kyoto, Japan; http://www.dako.dk). Fluorescent Dextran beads and type IV collagenase were from Sigma Chemical (St. Louis, MO; http://www.sigma-aldrich.com). MACS^® magnetic microbeads were from Miltenyi Biotec (Bergisch Gladbach, Germany; http://www.miltenyibiotec.com). Escherichia coli (K-12 strain) BioParticles^®, fluorescein-conjugated, was from Molecular Probes, Inc. (Eugene, OR; http://www.probes.com).

Mixed Lymphocyte Reaction
To obtain highly purified T cells as responders, splenocytes from BALB/c mice were incubated with anti-Thy1-coupled MACS, followed by passing through a MACS cell sorter (Milteneyi Biotec; Bergisch Gladbach, Germany; http://www.miltenyibiotec.com). The purity of the CD3⁺ cells, which were positively sorted using MACS cell sorter, was more than 90%. To obtain purified splenic CD11c⁺ cells, splenic cells from W/BF1 mice or B6 mice were incubated with anti-CD11c-coupled MACS, followed by passing through a MACS cell sorter. Positively sorted cells were incubated with PE-labeled anti-CD11c and FITC-labeled anti-CD3 and anti-B220. CD11c⁺CD3^–B220^– cells were further positively sorted with EPICS ALTRA^TM (Coulter; Hialeah, FL; http://www.coulter.com). The purity of CD11c⁺CD3^–B220^– cells was more than 90%. To obtain Mac-1⁺CD11c^–CD3^–B220^– cells, splenocytes from W/BF1 mice were incubated with anti-Mac-1-coupled MACS, followed by passing through a MACS cell sorter. Positively sorted cells were incubated with PE-labeled anti-Mac-1 and FITC-labeled anti-CD3, CD11c, and anti-B220. Mac-1⁺ CD11c^– cells were further positively sorted with EPICS ALTRA^TM. The purity of the Mac-1⁺CD11c^–CD3^–B220^– cells was more than 90%. After 20 Gy irradiation, the indicated stimulator cells were added to T cells (3 x 10⁵) in each well of a 96-well tissue-culture plate (Corning Incorporated; Corning, NY; http://www.corning.com). After incubation at 37°C for 4 days, cell proliferation was determined using 2-(2-methoxy-4-nitrophenyl) -3-(4-nitrophenyl)-5-(2,4-disulfophenyl) -2H-tetrazolium, monosodium salt (WST-8; Nakarai; Kyoto, Japan). In brief, 10 µl of WST-8 (5 mM) were added into each well and the plates were incubated at 37°C for an additional 4 hours. The resultant absorbance at 450 nm was read using a microplate reader (Bio-Rad Laboratories; Hercules, CA; http://www.bio-rad.com).

Endocytosis and Phagocytosis
The endocytosis or phagocytosis experiments were performed as previously described [13]. For the endocytosis experiment, the cells were incubated with FITC-Dextran at 37°C or 0°C for 60 minutes. For the phagocytosis experiment, the cells were incubated with FITC-E. coli at 37°C or 0°C for 3 hours. After incubation, ice-cold phosphate-buffered saline (PBS) containing 5% bovine serum albumin and 0.01% sodium azide was added. Cells were stained with PE-labeled anti-CD11c. Analyses were performed in gated CD11c⁺ cells.

Isolation of Mononuclear Cells from Various Organs
Peripheral blood mononuclear cells (PBMC) were obtained from heparinized peripheral blood using Lympholyte-Mammal (Cedarlane Laboratories; Ontario, Canada; http://cedarlanelabs.com), following the manufacturer's instructions. Hepatic mononuclear cells were prepared as previously described [14]. In brief, the liver was perfused in situ from the portal vein with 10 ml pre-warmed PBS containing 150 U/ml type IV collagenase. The liver was removed, cut into small pieces, and digested in the PBS with collagenase for 30 minutes at 37°C. The debri and parenchymal cells were removed using Lympholyte-Mammal. To obtain cells from the lymph node, spleen and thymus, we injected pre-warmed PBS containing 150 U/ml type IV collagenase into the organs. The organs were cut into small pieces, and then digested in the PBS with collagenase for 30 minutes at 37°C.

Cell Surface Staining
For flow cytometric analyses, cells were stained with biotin-labeled anti-CD3 plus biotin-labeled anti-B220, FITC- or PE-labeled anti-CD11c antibody, and PE- or FITC- labeled indicated antibodies followed by staining with Red PE-Cy5-avidin, except for the staining of NLDC-145. For NLDC-145 staining or its negative control, we incubated cells with PE-labeled anti-CD11c plus NLDC-145 or rat IgG, followed by staining with FITC-labeled anti-rat IgG, followed by biotin-labeled anti-CD3 and biotin-labeled anti-B220 plus Red PE-Cy5-avidin. The samples were analyzed using a FACScan flow cytometer (Becton Dickinson).

Electron Microscopy
Purified CD11c⁺CD3^–B220^– cells were pelleted by centrifugation using an Eppendorf centrifuge. The cell pellets were fixed for 1 hour with cold glutaraldehyde (2%) in 0.1 M phosphate buffer (pH 7.4) and postfixed for 1 hour with OsO₄. After dehydration with graded ethanol, the pellets were embedded in Spurr. Ultrathin sections cut on a Porter-Blum ultramicrotome were observed through a Hitachi H-600 electron-microscope after counter-staining with uranyl acetate and lead citrate.

Injection of CD11c⁺ Cells or CD4⁺ Cells
CD11c⁺CD3^–B220^– cells or CD4⁺CD11c^– cells, which had been obtained from the spleen of aged (12-20-week-old) W/BF1 mice (platelet count less than 100,000/mm³), were injected into the spleen, the subcutaneous tissue, or the vein. For the purification of CD11c⁺ cells, spleen cells from W/BF1 mice were incubated with anti-Thy 1 antibody (Ab)-bearing MACS beads and anti-B220 Ab-bearing MACS beads, followed by passing through the MACS column. Cells that passed through were incubated with anti-CD11c Ab-bearing MACS beads, followed by positive selection using the MACS column. The purification of CD11c⁺ cells was more than 80%. For the purification of CD4⁺ T cells, spleen cells were incubated with anti-CD11c Ab-bearing MACS beads, anti-Mac-1 Ab-bearing MACS beads and anti-B220 Ab-bearing MACS beads, followed by passing through the MACS column. The cells that passed through were incubated with FITC-labeled anti-CD4 Ab, followed by incubation with anti-FITC-labeled MACS beads. The cells were selected by passing them through the MACS column. The purification of CD4⁺ cells was more than 80%. For intrasplenic injection, 6-week-old female W/BF1 mice were anesthetized with ether. A left abdominal incision was made to expose the spleen. CD11c⁺ cells or CD4⁺ cells were injected into the spleen using a 26-gauge needle. For subcutaneous injection, the cells were injected under the dorsal skin. For intravenous injection, the cells were injected in the tail vein.

Detection of Anti-Platelet Ab-Bearing Platelets
Five days after the injection of CD11c⁺ cells from aged W/BF1 mice to young W/BF1 mice, platelets were collected from the recipient mice, and platelet-bearing Abs were examined using a FACScan, as previously described [15].

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Detection of mRNA Expression
RNA preparation, cDNA synthesis, and PCR were carried out. Total cellular RNA was prepared using a nucleic acid extractor (TRIZOL Reagent, Life Technologies, Inc.; Grand Island, NY; http://www.lifetech.com) followed by chloroform extraction and isopropanol precipitation. cDNA was synthesized using RT (M-MLV Rtase in RT-PCR high [RT-PCR Kit], TOYOBO; Tokyo, Japan; http://www.toyobo.co.jp/e/) and Oligo(dT)₂₀·P7 primers (RT-PCR high). PCR was performed on the cDNA using the following primers for FL (forward primer: GTTTAGAGAGTTGCTGACCACC; reverse primer: CGTCCTCCAGAAGCGTTTG), G3PDH (RT-PCR high), interleukin-3 (IL-3) (Maxim Biotech; San Francisco, CA; http://www.maximbio.com), tumor necrosis factor-alpha (TNF-) (Maxim Biotech), and stem cell factor (SCF) (Maxim Biotech) with thermal cycling amplification using Takara PCR Thermal Cycler MP (Takara; Otsu, Japan; http://www.takara.co.jp/index.htm). PCR products were separated on a 1.2% agarose gel (GIBCO BRL, Rockville, MD; http://www.tmc.tulane.edu/sif/tulgib.htm) and visualized by ethidium bromide (Nakarai) staining.

Statistical Analyses
Differences were evaluated using the Student's t-test. p values of less than 0.05 were considered to be statistically significant.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Increase in Number of CD11c⁺ Cells in W/BF1 Mice and Characterization of Their Surface Markers
We have previously reported that the number of white blood cells, particularly Mac-1⁺ or Gr-1⁺ cells, increases in the PBMC of W/BF1 mice [3, 8]. Since it has been reported that some Mac-1⁺ cells express CD11c⁺, we examined the number of CD11c⁺ cells that did not express CD3 or B220 in W/BF1 mice. As shown in Figure 1, the number of CD11c⁺CD3^–B220^– cells significantly increased in various organs of aged W/BF1 mice in comparison with normal mice (C57BL/6 [B6] mice): the percentages of CD11c⁺Mac-1⁺CD3^–B220^– cells increased in the spleen, peripheral blood, liver, thymus, and BM of aged W/BF1 mice, while there were no significant differences in the percentages of CD11c⁺Mac-1^–CD3^–B220^– cells among 12-week-old W/BF1, 6-week-old W/BF1, and 12-week-old B6 mice. The percentages of CD11c^–Mac-1⁺CD3^–B220^– cells also increased in the spleen and peripheral blood. We have previously reported that the cell counts in the spleen, peripheral blood and liver from aged W/BF1 mice increased in an age-dependent manner. Therefore, net CD11c⁺CD3^–B220^– cell counts in the spleen, peripheral blood and liver increased significantly (Figs. 1B and 1C).

View larger version (38K): [in this window] [in a new window]   Figure 1. Age-dependent increases in percentages of CD11c+CD3–B220–cells in the various organs in W/BF1 mice.A) Percentages of CD11c+CD3–B220–cells in the various organs of W/BF1 mice. Single-cell suspensions were obtained from indicated organs, as described in Materials and Methods. Cells were stained with PE-labeled anti-CD11c, FITC-labeled anti-Mac-1, biotin-labeled anti-CD3 and biotin-labeled anti-B220 Abs, followed by staining with Red PE-Cy5-labeled streptavidin. CD3–and B220–cells were gated, and the profiles of CD11c and Mac-1 are shown. Figures show the percentages of each fraction in total cells in the indicated organs. Representative data are shown from three independent experiments. B) Cell numbers in the spleen of W/BF1 mice. Cell numbers of CD11c+CD3–B220–cells in the spleen of W/BF1 mice were calculated from the percentage of CD11c+CD3–B220–cells and the number of splenocytes. Means and standard deviations are shown from three independent experiments. C) Cell numbers of CD11c+CD3–B220–cells of the peripheral blood in W/BF1 mice. Means and standard deviations are shown from three independent experiments.

View larger version (57K): [in this window] [in a new window]   Figure 2. Phenotype analyses of CD11c+CD3–B220–cells from W/BF1 mice.Single-cell suspensions were obtained from the spleens of 12-week-old W/BF1 and age-matched B6 mice using PBS with collagenase as described in Materials and Methods. Splenocytes were stained with PE-labeled or FITC-labeled anti-CD11c Ab, Abs for indicated surface markers and biotin-labeled anti-CD3 plus biotin-labeled anti-B220 Ab, followed by staining with Red PE-Cy5-labeled streptavidin. CD11c+CD3–B220–cells were gated, and the profiles of indicated Abs are shown. Representative data are shown in two independent experiments.

View larger version (123K): [in this window] [in a new window]   Figure 3. Morphology of CD11c+CD3–B220–cells of aged W/BF1 mice.CD11c+CD3–B220–cells were obtained from the spleen of aged W/BF1 mice, as described inMaterials and Methods, followed by staining with Giemsa (Ax100; Bx250) and examined with electron microscope (C).

View larger version (13K): [in this window] [in a new window]   Figure 4. In vitro functional analyses of CD11c+CD3–B220–cells from aged WBF1 mice. A) Ability of whole spleen cells and CD11c+CD3–B220–cells to stimulate allogeneic T cells. CD11c+CD3–B220–cells and T cells were purified as described in Materials and Methods. After splenocytes from aged W/BF1 mice () or age-matched B6 mice () and CD11c+CD3–B220–cells from aged W/BF1 mice () or age-matched B6 mice () were irradiated with 20Gy, the indicated number of whole spleen cells or CD11c+CD3–B220–cells from the spleens was added to 3x105splenic T cells from BALB/c mice. After incubation for 4 days at 37°C, WST-8 was added to wells, followed by measurement of OD450 using a microplate reader. B) Comparison of ability to promote the proliferation of allogeneic T cells between CD11c+CD3–B220–cells and Mac-1+CD11c–CD3–B220–cells in aged W/BF1. CD11c+CD3–B220–cells and Mac-1+CD11c–CD3–B220–cells from the spleens of aged W/BF1 mice were purified as described in Materials and Methods. After irradiation at 20Gy, the indicated cell number of CD11c+CD3–B220–cells () or Mac-1+CD11c–CD3–B220–cells () were cultured with 3x105T cells from BALB/c mice for 4 days. C) Comparison of ability of PBMC to promote the proliferation of allogeneic T cells between aged W/BF1 and B6 mice. PBMC were obtained from aged W/BF1 () and B6 mice (). After 20 Gy irradiation, the indicated number of PBMC from W/BF1 and B6 mice was incubated with 3x105splenic T cells from BALB/c mice for 4 days. D) Functional analyses of endocytosis of CD11c+CD3–B220–cells from W/BF1 mice. Splenocytes of aged W/BF1 mice were incubated with FITC-labeled Dextran for 60 minutes at 0°C (---) or 37°C (—). After incubation, the cells were stained with PE-labeled anti-CD11c, and the endocytotic function of the CD11c+cells then examined. E) Functional analyses for phagocytosis of CD11c+CD3–B220–cells from W/BF1 mice. Spleen cells of aged W/BF1 mice were incubated with FITC-labeled E. coli for 60 minutes at 0°C (---) or 37°C (—). After incubation, the cells were stained with PE-labeled anti-CD11c Ab, and the endocytotic function of the CD11c+cells then examined.

Functional Analyses of CD11c⁺ Cells from W/BF1 Mice for Induction of Autoimmune Disease in Vivo
DCs have previously been shown to initiate antigenspecific immune responses when pulsed with soluble antigens in vivo and in vitro [9]. We therefore analyzed whether the increased DCs are associated with autoimmune diseases in W/BF1 mice. The CD11c⁺CD3^–B220^– cells from aged W/BF1 mice, showing thrombocytopenia and proteinuria, were injected into the spleens, subcutaneous tissues or veins of young female W/BF1 mice. As shown in Figure 5, young W/BF1 mice, into which CD11c⁺CD3^–B220^– cells had been injected via the spleen or subcutaneously, showed thrombocytopenia, although this was mild and transitory. Platelet counts had normalized by about 2 weeks after the injection, while proteinuria and WBC counts remained unchanged. These results suggest that the injected CD11c⁺CD3^–B220^– cells could induce anti-platelet Ab production, which resulted in thrombocytopenia. It should be noted that the injection of CD4⁺CD11c^– T cells into the spleen and the injection of CD11c⁺CD3^–B220^– cells in the vein are not effective in the reduction of platelet counts. We have already reported that almost all T cells from aged W/BF1 mice are activated [18]; therefore it is conceivable that activated T cells die due to activated T cell death a short time after the injection. To exclude the possibility that thrombocytopenia develops due to hypersplenomegaly induced by the injection of CD11c⁺CD3^–B220^– cells, we injected CD11c⁺CD3^–B220^– cells from normal mice (CDF1 mice) into the spleens of CDF1 mice. However, no thrombocytopenia developed.

View larger version (21K): [in this window] [in a new window]   Figure 5. In vivo functional analyses of CD11c+CD3–B220–cells from aged WBF1 mice. A) CD11c+CD3–B220–cells (1x107), CD11b+CD11c–CD3–B220–cells (1x107), or CD4+CD11c–cells (1x107), which were obtained from aged W/BF1 mice, were inoculated into 6-week-old female W/BF1 mice. CD11c+cells were inoculated into the spleen (), subcutaneously (), or intravenously (). CD4+CD11c–cells were inoculated into the spleen () or vein (). Before and after inoculation, platelet numbers were examined. Means and standard deviations are shown from three independent experiments. *p < 0.005 versus platelet numbers before inoculation. B-E) Production of anti-platelet Abs was examined, as described inMaterials and Methods. Solid lines B, C, D, and E show anti-platelet Ab-bearing platelets in an untreated mouse, a mouse injected with CD11c+cells into the subcutaneous tissue, a mouse injected with CD11c+cells into the spleen, and an untreated aged W/BF1 mouse, respectively, while dotted lines show negative controls.

Mechanisms Underlying Increase in Number of DCs in Aged W/BF1 Mice
It has been reported that GM-CSF accelerates the differentiation of DCs from the BM [11]. However, we have previously found that GM-CSF mRNA expression decreases in the BM cells from aged W/BF1 mice in comparison with the BM cells from young W/BF1 mice and age-matched C3H mice [8], although G-CSF mRNA expression increases and macrophage-CSF (M-CSF) mRNA expression remains unchanged [8]. We therefore compared the expression of mRNA of G-CSF, GM-CSF, and M-CSF between the BM cells from aged W/BF1 and age-matched B6 mice, and similar results were obtained, as we previously reported [8]. Since Maraskovsky et al. have reported that G-CSF and FL augment the DC production [12], we next examined the expression of mRNA of FL. As shown in Figure 6, the BM cells from aged W/BF1 mice showed a higher expression of mRNA of FL than those from young W/BF1 and age-matched B6 mice. It has been reported that SCF sustains the growth of DC progenitors [19], and that IL-3 enhances the DC differentiation into the intermediate stage, whereas TNF- stimulates the final maturation of DCs [20]. Therefore, we addressed the mRNA expression of IL-3, SCF, and TNF- in the BM cells from aged W/BF1 mice. As shown in Figure 6, the mRNA expression of SCF and TNF- remained unchanged, while the IL-3 mRNA expression increased in the BM cells from aged W/BF1 mice. These results suggest that FL, IL-3, and G-CSF accelerate the generation of DCs, and that GM-CSF is not associated with the generation of DCs in W/BF1 mice. It has been reported that in vivo administration of FL augments the number of DCs, and that not only stromal cells but also hemopoietic cells produce FL [21, 22]. Therefore, we examined the expression of FL in the spleen of W/BF1 and normal mice, since the spleen contains plentiful numbers of mature hemopoietic cells, which were activated in W/BF1 mice. The mRNA expression of FL in the spleen is similar to that in BM in aged W/BF1 mice (data not shown). Next, we performed RT-PCR to clarify which lineage(s) of hemopoietic cells produce FL in the spleen of W/BF1 mice. In Figure 7, FL expression of the spleen in aged W/BF1 mice increased in comparison with age-matched B6 mice, and each lineage of hematopoietic cells expresses mRNA of FL, especially T cells, B cells and CD11c⁺CD3^–B220^– cells. These results suggest that activated autoreactive hemopoietic cells produce FL, which augment the number of DCs. Namely, increases in DCs could be the result of autoimmune disease, but, from our experiments, might also accelerate the progress of the autoimmune disease.

View larger version (59K): [in this window] [in a new window]   Figure 6. Expression of mRNA of FL, SCF, IL-3, and TNF-. cDNA was obtained from the BM cells of 12-week-old W/BF1, 6-week-old W/BF1 or 12-week-old B6 mice, and RT-PCR was performed for detection of the mRNA of FL, SCF, IL-3, and TNF-, as described in Materials and Methods.

View larger version (19K): [in this window] [in a new window]   Figure 7. Expression of mRNA of FL in hemopoietic cells. Splenocytes of aged W/BF1 mice and age-matched B6 mice were obtained and the mRNA of FL was examined. The indicated lineages of hemopoietic cells in the spleen of aged W/BF1 mice were sorted and their mRNA expression of FL was then examined.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

DCs, which are the most efficient antigen-presenting cells for T cells, are very rare, but are found in every tissue of the body [10]. DCs have been reported to express MHC class II proteins, CD11c [16], CD80, CD86, CD40 [23], and the mannose receptor-like protein DEC-205 [24]. It has been shown that myeloid DCs express 33D1, whereas lymphoid DCs express DEC-205 and CD8 [23]. In the CD11c⁺CD3^–B220^– cells of aged W/BF1 mice, the expression of CD11b, NK1.1, and CD95 increased, but the expression of CD8, CD117, CD135, and Sca-1 decreased. Therefore, the surface markers of the CD11c⁺CD3^–B220^– cells from W/BF1 mice were somewhat different from those of conventional DCs. The reduced expression of CD135 (Flk-2/Flt-3) in aged W/BF1 mice is possibly associated with the augmented production of FL. However, the CD11c⁺CD3^–B220^– cells from aged W/BF1 mice showed a dendritic shape, and they have a similar capacity to CD11c⁺CD3^–B220^– cells from normal mice in allo- and auto-MLR.

It has been reported that FL augments DC production, as well as the number of both CD11c⁺Mac-1⁺ cells and CD11c⁺Mac-1^– cells [12]; the CD11c⁺ cells induced by FL express a high level of MHC class II and CD86, while they partially express DEC-205 and CD8 [12]. They do not express CD3, B220, NK1.1, or CD80 [12]. Although the BM cells from aged W/BF1 mice expressed a high level of FL mRNA, the surface markers of DCs in aged W/BF1 mice were somewhat different from those of DCs in FL-treated mice. These differences could be attributable to other cytokines of BM cells, and/or intrinsic abnormalities of hemopoietic stem cells in aged W/BF1 mice, because the mRNA expression of IL-3 and G-CSF of the BM cells from aged W/BF1 mice increases, while the GM-CSF expression decreases in comparison with the BM cells from young W/BF1 or age-matched normal mice. It has also been reported that both GM-CSF and FL generate a large number of DCs [11, 12], whereas no augmented DC production has been observed in GM-CSF transgenic mice [25]. These findings suggest that FL mainly regulates the production of DCs in vivo, although GM-CSF and/or other cytokines are also essential for the generation of DCs.

Previously, Hang et al. examined the effects of neonatal thymectomy on MRL/lpr, BXSB, B/WF1, and W/BF1 mice [26]. In their report, neonatal thymectomy prevented autoimmune diseases in MRL/lpr mice, but not in BXSB, B/WF1, or W/BF1 mice. Therefore, MRL/lpr mice are referred to as "T-lupus mice" and other autoimmune-prone mice, in which thymectomy is ineffective in the development of autoimmune diseases, as "B-lupus mice." In our experiments, the percentage of CD11c⁺CD3^–B220^– cells in the spleen increased in the "B-lupus mice," but not in the MRL/lpr mice ("T-lupus mice"). These findings suggest that not only activated T cells but also increased numbers of CD11c⁺CD3^–B220^– cells play a role in the induction and/or acceleration of autoimmune diseases in the autoimmune-prone mice other than MRL/lpr mice.

Various causes have been suggested for systemic lupus erythematosus (SLE): sex, race, genetic factors, infection, drugs, diet, and so on [27]. Especially, Nagata et al. have reported that the autoimmune status of MRL/Mp-lpr/lpr mice is attributable to the survival of autoreactive T cells, which lose the Fas expression [28]. Based on this finding, abnormalities in Fas expression have been reported in patients with autoimmune diseases [29, 30], although there are very few such patients in human SLE. Here, we have shown that the abnormality in DCs could accelerate autoimmunity. Actually, monocytosis in human SLE patients is unusual [31]; however, we would like to propose that the existence of human SLE patients is due to the abnormalities in the DCs induced by overexpressed FL.

It has been reported that the in vivo administration of FL has some effects on malignant tumors, and that these effects are attributable to an increase in the number of DCs, followed by the augmentation of DC functions [32, 33]. However, we would like to warn against FL administration, because of the possibility of autoimmune diseases being induced.

	ACKNOWLEDGMENT

Top Abstract Introduction Materials and Methods Results Discussion References

 
We thank Ms. Murakami-Shinkawa, Ms. Tokuyama, and Ms. Miura for their expert technical assistance, and also Ms. Ando for the preparation of this manuscript. This work was supported by "Gakunai Kenkyu Zyosei" in Kansai Medical University.

This work was supported by a grant from the Japanese Private School Foundation, a grant from "Haiteku Research Center" of Ministry of Education, grants-in-aid for Scientific Research (B) 11470062 and grant-in-aid for Scientific Research on Priority Areas (A) 10181225, 116221.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Hang L, Izui S, Dixon FJ. (NZW x BXSB)F1 Hybrid. A model of acute lupus and coronary vascular disease with myocardial infarction. J Exp Med 1981;154:216–221.[Abstract/Free Full Text]

2. Oyaizu N, Yasumizu R, Inaba M et al. (NZW x BXSB)F1 mouse: a new animal model of idiopathic thrombocytopenic purpura. J Exp Med 1988;167:2017–2022.[Abstract/Free Full Text]

3. Adachi Y, Inaba M, Amoh Y et al. Effect of bone marrow transplantation on antiphospholipid antibody syndrome in murine lupus mice. Immunobiol 1995;192:218–230.[Medline]

4. Mizutani H, Engelman RW, Kurata Y et al. Development and characterization of monoclonal antiplatelet autoantibodies from autoimmune thrombocytopenic purpura-prone (NZW x BXSB)F1 mice. Blood 1993;82:837–844.[Abstract/Free Full Text]

5. Hang LM, Stephens-Larson P, Henry JP et al. The role of hypertension in the vascular disease and myocardial infarctions associated with murine systemic lupus erythematosus. Arthritis Rheum 1983;26:1340–1345.[Medline]

6. Adachi Y, Inaba M, Inaba K et al. Functional analyses of B cells in (NZW x BXSB)F1 mice. Autoimmunity 1993;15:99–105.[Medline]

7. Adachi Y, Inaba M, Inaba K et al. Analyses of thymic abnormalities in autoimmune-prone (NZW x BXSB)F1 mice. Immunobiol 1993;188:340–354.[Medline]

8. Sugihara A, Adachi Y, Inaba M et al. Age-dependent abnormalities of hematopoietic stem cells in (NZW x BXSB)F1 mice. STEM CELLS 1999;17:357–365.[Abstract/Free Full Text]

9. Inaba K, Metlay JP, Crowley MT et al. Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ. J Exp Med 1990;172:631–640.[Abstract/Free Full Text]

10. Steinman RM. The dendritic cell system and its role in immunogenicity. Ann Rev Immunol 1991;9:271–296.[CrossRef][Medline]

11. Inaba K, Inaba M, Romani N et al. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J Exp Med 1992;176:1693–1702.[Abstract/Free Full Text]

12. Maraskovsky E, Brasel K, Teepe M et al. Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J Exp Med 1996;184:1953–1962.[Abstract/Free Full Text]

13. Winzler C, Rovere P, Rescigno M et al. Maturation stages of mouse dendritic cells in growth factor-dependent long term cultures. J Exp Med 1997;185:317–328.[Abstract/Free Full Text]

14. Amoh Y, Yasumizu R, Yamamoto Y et al. The appearance of unusual phenotypic cells (CD4⁺ Mac-1⁺ ClassII⁺) in the liver of (NZW x BXSB)F1 mice is possibly an animal model for autoimmune hepatitis. Immunobiol 1997;197:31–43.[Medline]

15. Mizutani H, Furubayashi T, Kuriu A et al. Analyses of thrombocytopenia in idiopathic thrombocytopenic purpura-prone mice by platelet transfer experiments between (NZW x BXSB)F1 and normal mice. Blood 1990;75:1809–1812.[Abstract/Free Full Text]

16. Metlay JP, Witmer-Pack MD, Agger R et al. The distinct leukocyte of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies. J Exp Med 1990;171:1753–1771.[Abstract/Free Full Text]

17. Steinman RM, Cohn ZA. Identification of a novel type in peripheral lymphoid organs of mice. J Exp Med 1973;137:1142–1162.[Abstract]

18. Sugihara A, Adachi Y, Inaba M et al. Expression of CD45-restricted form B in (NZW x BXSB)F1 and MRL/Mp-lpr/lpr mice. Autoimmunity 1997;24:237–242.

19. Young JW, Szabolcs P, Moore MA. Identification of dendritic cell colony-forming units among normal human CD34⁺ bone marrow progenitors that are expanded by c-kit-ligand and yield pure dendritic cell colonies in the presence of granulocyte/macrophage colony stimulating factor and tumor necrosis factor alpha. J Exp Med 1996;182:1111–1119.

20. Caux C, Vanbervliet B, Massacrier C. Interleukin-3 cooperates with tumor necrosis factor alpha for the development of human dendritic/Langerhans cells from cord blood CD34⁺ hematopoietic progenitor cells. Blood 1996;87:2376–2385.[Abstract/Free Full Text]

21. McClanahan T, McClanahan T, Culpepper J et al. Biochemical and genetic characterization of multiple splice variants of the Flt3 ligand. Blood 1996;88:3371–3382.[Abstract/Free Full Text]

22. Chklovskaia E, Nissen C, Landmann L et al. Cell-surface trafficking and release of flt3 ligand from T lymphocytes is induced by common cytokine receptor -chain signaling and inhibited by cyclosporin A. Blood 2001;97:1027–1034.[Abstract/Free Full Text]

23. Vremec D, Shortman K. Dendritic cell subtypes in mouse lymphoid organs. J Immunol 1997;159:565–573.[Abstract]

24. Jiang W, Swiggard WJ, Heufler C et al. The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing. Nature 1995;375:151–155.[CrossRef][Medline]

25. Metcalf D, Shortman K, Vremec D et al. Effects of excess GM-CSF levels on hematopoiesis and leukemia development in GM-CSF/max 41 double transgenic mice. Leukemia 1996;10:713–719.[Medline]

26. Hang L, Theofilopoulos AN, Balderas RS et al. The effect of thymectomy on lupus-prone mice. J Immunol 1984;132:1809–1813.[Abstract]

27. Crow MR, Christian CL. Etiologic hypotheses for systemic lupus erythematosus. In: Lahita RG, ed. Systemic Lupus Erythematosus. New York: Churchill Livingstone, 1992:51-64.

28. Watanabe-Fukunaga R, Brannan CI, Copeland NG et al. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 1992;356:314–317.[CrossRef][Medline]

29. Drappa J, Vashinaw AK, Sullivan K et al. Fas gene mutations in the Canale-Smith syndrome, an inherited lymphoproliferative disorder associated with autoimmunity. N Engl J Med 1996;335:1643–1649.[Abstract/Free Full Text]

30. Fisher GH, Rosenberg FJ, Straus SE et al. Dominant interfering Fas gene mutation impairs apoptosis in a human autoimmune lymphoproliferative syndrome. Cell 1995;81:935–946.[CrossRef][Medline]

31. Laurence J, Wong JEL, Nachman R. The cellular hematology of systemic lupus erythematosus. In: Lahita RG, ed. Systemic Lupus Erythematosus. New York: Churchill Livingstone, 1992:771-806.

32. Lynch DH, Andreasen A, Maraskovsky E et al. Flt3 ligand induces tumor regression and antitumor immune responses in vivo. Nat Med 1997;3:625–631.[CrossRef][Medline]

33. Borges L, Miller RE, Jones J et al. Synergistic action of fms-like tyrosine kinase 3 ligand and CD40 ligand in the induction of dendritic cells and generation of antitumor immunity in vivo. J Immunol 1999;163:1289–1297.[Abstract/Free Full Text]

This article has been cited by other articles:

				S. Wan, C. Xia, and L. Morel IL-6 Produced by Dendritic Cells from Lupus-Prone Mice Inhibits CD4+CD25+ T Cell Regulatory Functions J. Immunol., January 1, 2007; 178(1): 271 - 279. [Abstract] [Full Text] [PDF]

				D. Ding, H. Mehta, W. J. McCune, and M. J. Kaplan Aberrant Phenotype and Function of Myeloid Dendritic Cells in Systemic Lupus Erythematosus J. Immunol., November 1, 2006; 177(9): 5878 - 5889. [Abstract] [Full Text] [PDF]

				Y. Hu and L. B. Ivashkiv Costimulation of Chemokine Receptor Signaling by Matrix Metalloproteinase-9 Mediates Enhanced Migration of IFN-{alpha} Dendritic Cells J. Immunol., May 15, 2006; 176(10): 6022 - 6033. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Adachi, Y. Articles by Ikehara, S. Search for Related Content PubMed PubMed Citation Articles by Adachi, Y. Articles by Ikehara, S.