Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, T.
Right arrow Articles by Tsunoda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, T.
Right arrow Articles by Tsunoda, Y.
Stem Cells 2002;20:146-154 www.StemCells.com
© 2002 AlphaMed Press

In Vitro Differentiation of Embryonic Stem Cells into Hepatocyte-Like Cells Identified by Cellular Uptake of Indocyanine Green

Takatsugu Yamadaa,b, Masahide Yoshikawaa, Seiji Kandaa, Yoko Katoc, Yoshiyuki Nakajimab, Shigeaki Ishizakaa, Yukio Tsunodac

a Division of Developmental Biology, Department of Parasitology, and
b First Department of Surgery, Nara Medical University, Kashihara, Nara, Japan;
c Laboratory of Animal Reproduction, College of Agriculture, Kinki University, Nakamachi, Nara, Japan

Key Words. Embryonic stem cell • Hepatocyte differentiation • Indocyanine green • Cell transplantation

Correspondence: Takatsugu Yamada, M.D., First Department of Surgery, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521, Japan. Telephone: 81-744-22-3051 (ext. 3419); Fax: 81-744-24-6866; e-mail: highnet{at}nmu-gw.naramed-u.ac.jp\|[emsp ]\|\|[emsp ]\|Received


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Background and Aims. Embryonic stem (ES) cells have a pluripotent ability to differentiate into a variety of cell lineages in vitro. We have recently found the emergence of cell clusters that show the cellular uptake of indocyanine green (ICG) in the culture of differentiated ES cells. ICG is clinically used as a test substance to evaluate liver function because it is eliminated exclusively by hepatocytes. The aim of the present study was to investigate the hepatic characteristics of ICG-stained cells.

Methods. Embryoid bodies (EBs), formed by a 5-day hanging drop culture of ES cells, were allowed to outgrow in the placed culture. Gene expression of hepatocyte markers was analyzed by reverse transcriptase-polymerase chain reaction, and albumin production was examined immunohistochemically. Morphology and cellular components were investigated by electron microscopy. ICG-stained cells were further transplanted into the portal vein of mice.

Results. ICG-stained cells appeared around 14 days of the EB culture and formed distinct three-dimensional structures. They were immunoreactive to albumin and expressed mRNAs such as albumin, alpha-fetoprotein, transthyretin, hepatocyte nuclear factor 3 beta, alpha-1-antitrypsin, tryptophan-2,3-dioxygenase, urea cycle enzyme, gluconeogenic enzyme, and liver-specific organic anion transporter-1. An ultrastructural analysis revealed a well-developed system of organelles such as mitochondria, lysosomes, Golgi apparatus, and rough and smooth endoplasmic reticulum. The transplantation of ICG-positive cells into the portal vein resulted in the incorporation into mice livers, where they were morphologically indistinguishable from neighboring hepatocytes.

Conclusions. ES cell-derived ICG-positive cells possess characteristics of hepatocytes, and ICG-staining is a useful marker to identify differentiated hepatocytes from EBs in vitro.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mouse embryonic stem (ES) cells are clonal cell lines derived from the inner cell mass of developing blastocysts [1,2]. The distinguishing feature of these cells is their capacity to differentiate into a broad spectrum of derivatives of all three embryonic germ layers [3,4]. Recently, human ES cell lines were also isolated [5] and the mutilineage differentiating ability of human ES cell lines was reviewed in this journal [6]. This ability has drawn attention to ES cells as a novel source of cell populations for new therapeutic strategies such as cell transplantation and tissue engineering. When ES cells are allowed to differentiate in a suspension culture, they form spherical multicellular aggregates, termed embryoid bodies (EBs), that have been shown to contain a variety of cell populations [3,4]. Developmental programs associated with cell lineage commitment in EBs show remarkable similarities to those found in normal embryos [3,4], indicating that this model system provides access to particular types of cell populations that develop in a normal fashion. To date, some success has been achieved in inducing mouse ES cells to differentiate into particular types of cells such as hematopoietic cells [7,8], cardiomyocytes [9], smooth muscle cells [10–12], and neurons [12–16], within an EB environment. However, in vitro differentiation of ES cells into hepatocytes has not yet been shown except for a recent report [17].

To obtain hepatocytes from ES cells, it is essential to establish not only an appropriate culture system to induce ES cells to differentiate into hepatocytes, but also a useful method for identifying differentiated hepatocytes. One of the major functions of the liver is elimination of various endogenous and exogenous compounds from the circulation. This clearance process involves basolateral (sinusoidal and lateral) membrane transport systems that mediate the hepatocellular uptake of bile acids, organic anions, and organic cations [18,19]. Indocyanine green (ICG) is an organic anion that is clinically used as a test substance to evaluate liver function since it is nontoxic and eliminated exclusively by hepatocytes [20–23]. In the present study, we examined the cellular uptake of ICG to identify differentiated hepatocytes within developing EBs. Using an EB culture system, we have found that mouse ES cells can give rise to a functional hepatocyte-like cell cluster, which forms a three-dimensional structure and demonstrates cellular uptake of ICG. To clarify the characteristic features of ICG-positive cells, we analyzed the gene expression of hepatocyte markers such as albumin, {alpha}-fetoprotein (AFP), transthyretin (TTR), hepatocyte nuclear factor 3ß (HNF3ß), {alpha}-1-antitrypsin ({alpha}-1-AT), tryptophan-2,3-dioxygenase (TDO), carbamoyl phosphate synthetase I (CPSase I), and phosphoenolpyruvate carboxykinase (PEPCK). In addition, we examined the gene expression of liver-specific organic anion transporter-1 (LST-1), which is expressed exclusively in the liver [24–26]. We also investigated the ultrastructural characteristics of ICG-positive cell clusters by electron microscopy. Finally, we transplanted ICG-positive cells into mice livers through the portal vein, and examined their grafting ability as well as immunoreactivity for albumin. Our results provide evidence of a novel source of hepatocytes for new therapeutic strategies such as cell transplantation and tissue engineering.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ES Cell Culture
Undifferentiated ES cells (G4-2) were maintained on gelatin-coated dishes without feeder cells in Dulbecco's modified Eagle's medium (DMEM; Sigma; St. Louis, MO; http://www.sigmaaldrich.com) supplemented with 10% fetal bovine serum (FBS; GIBCO/BRL; Grand Island, NY; http://www.tmc.tulane.edu/sif/tulgib.htm), 0.1 mM 2-mercaptoethanol (Sigma), 0.1 mM nonessential amino acids (GIBCO/BRL), 1 mM sodium pyruvate (Sigma), and 1,000 U/ml of leukemia inhibitory factor (LIF; GIBCO/BRL). The G4-2 cells (a kind gift from Dr. Hitoshi Niwa, Osaka University) carried the blasticidin S-resistant selection marker gene driven by the Oct-3/4 promoter (active under undifferentiated status) and were maintained in medium containing 10 µg/ml blasticidin S to eliminate differentiated cells [27]. The G4-2 ES cells were derived from EB3 ES cells and carried the enhanced green fluorescent protein (EGFP) gene under the control of the CAG expression unit. The EB3 cells were a subline derived from E14tg2a ES cells [28] and generated by a targeted integration of Oct-3/4-IRES-BSD-pA vector into the Oct-3/4 allele [27]. To induce EB formation, dissociated ES cells were cultured in hanging drops [3,4] with minor modifications. The cell density of one drop was 500 cells per 15 µl of ES cell medium in the absence of LIF. After 5 days in a hanging drop culture, the resulting EBs were plated onto plastic 100-mm gelatin-coated dishes and allowed to attach for the outgrowth culture.

Isolation and Culture of Hepatocytes
Hepatocytes were isolated from male 129/SVJ mice (The Jackson Laboratory; Bar Harbor, ME; http://www.jax.org) by a two-step collagenase perfusion method [29]. Briefly, mouse livers were perfused with calcium- and magnesium-free Hanks' balanced salt solution (HBSS), and then with HBSS containing 0.05% collagenase. Hepatocytes were separated from the resulting cell suspension by differential centrifugation at 50 g for 1 minute, and then by centrifugation through a 45% Percoll gradient at 50 g for 10 minutes. Isolated hepatocytes were plated onto 100-mm collagen-coated cell culture dishes. The medium consisted of DMEM/F12 supplemented with 5% FBS.

ICG Uptake Study
ICG (25 mg; Dai-ichi Pharm. Co., Ltd; Tokyo, Japan) was dissolved in 5 ml of solvent in a sterile vial and then added to 20 ml of DMEM containing 10% FBS. The final concentration of the resulting ICG solution was 1 mg/ml. Preliminary experiments indicated that there was no adverse effect on cell viability at this concentration. The ICG solution was added to the cell culture dish and incubated at 37°C for 15 minutes. After the dish was rinsed three times with phosphate-buffered saline (PBS), the cellular uptake of ICG was examined with a stereomicroscope. After the examination, the dish was refilled with DMEM containing 10% FBS. ICG was completely eliminated from the cells 6 hours later.

Immunocytochemistry
Cells were fixed with 99.5% ethanol at –30°C and stained by an avidin-biotin coupling immunoperoxidase technique using a commercial kit (Vectastain Elite ABCTM; Vector Laboratories; Burlingame, CA; http://www.vectorlabs.com), according to the instructions of the manufacturer. The primary antibody was a rabbit immunoglobulin G (IgG) against mouse albumin (1:100) (Cappel; Aurora, OH). After quenching endogenous peroxidase activity, cells were incubated with the primary antibody at room temperature for 1 hour. After three washes with PBS, cells were further reacted with a biotinylated goat anti-rabbit IgG as the secondary antibody at room temperature for 30 minutes. Immunostaining of albumin was visualized with 3,3'-diamino-benzidine tetrahydrochloride containing 0.01% hydrogen peroxide.

RNA Extraction and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis
Total RNA was extracted from the cells using the acid guanidinium thiocyanate-phenol-chloroform method. One microgram of DNase-treated total RNA was used for the first-strand cDNA. This reaction was performed using Super Script II and random hexanucleotide (GIBCO/BRL), following the protocol of the manufacturer. cDNA samples were subjected to PCR amplification with specific primers under linear conditions, in order to reflect the original amount of the specific transcript. The cycling parameters were as follows: denaturation at 94°C for 1 minute; annealing at 55-60°C for 1 minute (depending on the primer); and elongation at 72°C for 1 minute (40 cycles). The PCR primers and the length of the amplified products were as follows: ß-actin, (TGAACTG GCTGACTGCTGTG and CATCCTTGGCCTCAGCATAG, 174 bp); albumin, (TGAACTGGCTGACTGCTGTG and CATCCTTGGCCTCAGCATAG, 718 bp); AFP, (CCACC CTTCCAGTTTCCAG and GGGCTTTCCTCGTGT AACC, 609 bp); TTR, (AGTCCTGGATGCTGTCCGAG and TTC CTGA GCTGCTAACACGG, 440 bp); HNF3ß, (TATTG GCTGCA GCTAAGCGG and GACTCGGACTCAGGT GAGGT, 508 bp); {alpha}-1-AT, (TGGGGTCTACTGCTTCTGG and TCATGGGCACCTTC ACCGT, 693 bp); TDO, (AGAGCCAGCAAAGGAGGAC and CTGTCTGC TCCT GCTCTGAT, 500 bp); CPSase I, (ATGACGAGGATTTT GACAGC and CTTCACAGAAAGGAGCCTGA, 126 bp); PEPCK, (TCTGCCAAGGTCATCCAGG and GTTTT GGG GATGGGCACTG, 290 bp); and LST-1, (AGCTACACCGAC CAAAGCTG and GTTGGCCTGCGATGCTGTC, 604 bp).

Electron Microscopy
Tissues were fixed with 2.5% glutaraldehyde, 1.25 mM CaCl2, and 3% sucrose in a 0.05 M cacodylate buffer (pH 7.4) at room temperature for 3-4 hours. They were post-fixed with 1% OsO4, and then stained en bloc with uranyl acetate and embedded in epoxy resin. Ultrathin sections were double stained with uranyl acetate and lead citrate, before being examined with an electron microscope (H-7100; Hitachi; Tokyo, Japan; http://www.hitachi.com).

Transplantation Procedures and Observation of EGFP
ICG-positive clusters were isolated from the EB outgrowth cultures on day 21 under a stereomicroscope, and then trypsinized at 37°C for 5 minutes with 0.25% trypsin. The dissociated ICG-positive cells were resuspended in DMEM without FBS. A total of 2 x 103 ICG-positive cells in 0.3 ml of suspension was transplanted into male 129/SVJ mice (n = 10, 13 weeks old) (The Jackson Laboratory) through the portal vein. Four weeks after cell transplantation, the whole liver was removed from the mice, excised, and embedded in OCT compound (Tissue-TEK; Miles; Elkhart, IN), and then frozen in liquid nitrogen. Sections were cut into 10 µm thick slices with the use of a cryostat and placed on 3-aminopropyltriethoxysilane-coated slides. Specimens were examined without fixation under a fluorescent microscope (Olympus; Tokyo, Japan; http://www.olympus.com), with a 460-490 nm band-pass excitation filter and a 510 nm long-pass emission filter to detect the distribution of cells with EGFP fluorescence. All animal procedures were in accordance with our institutional guidelines as well as those of the National Institute of Health.

Immunohistochemistry
The same specimens were fixed with 99.5% ethanol and then incubated overnight with a rabbit IgG against mouse albumin (1:100) (Cappel). This was followed by incubation with a Rhodamine-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch; Baltimore, PA) at room temperature for 30 minutes. Immunoreactivity to albumin was examined by immunofluorescence of Rhodamine using fluorescence microscopy with a 520-550 nm band-pass excitation filter and a 580 nm long-pass emission filter. The same specimens were then stained with hematoxylin and eosin to examine the histology of the ICG-positive cells that had integrated into the native livers.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ICG Uptake within the Adhesive Outgrowth of EBs
We first examined the cellular uptake of ICG in hepatocytes isolated from adult mice livers. Most of them were positive for ICG (Fig. 1AGo), while undifferentiated ES cells were negative (Fig. 1BGo). ES cells were cultured for 5 days in a suspension culture system and allowed to form EBs. The resulting EBs were attached to gelatin-coated dishes and then spread around. Five days after beginning the outgrowth culture of EBs, various types of cells, including cardiac beating muscle cells, emerged from the outgrowths. At this stage, ICG-positive cells were not observed within the EBs (Fig. 1CGo). On approximately day 14 of EB culture, ICG-positive cells were apparent as clusters with a three-dimensional structure, most of which were adjacent to the cardiac beating muscles (Fig. 1DGo).



View larger version (122K):
[in this window]
[in a new window]
 
Figure 1. Cellular uptake of ICG within adhesive EB outgrowths. A) Most of the isolated hepatocytes were positive for ICG. B) Undifferentiated ES cells were negative for ICG. C) On day 5 of EB culture, various types of cells, including cardiac beating muscles (arrows), emerged from the outgrowths. At this stage, ICG-positive cells were not detected within the EBs. D) On day 14 of EB culture, ICG-positive cells were apparent as a cluster with a three-dimensional structure adjacent to the cardiac beating muscles (arrows). Scale bar in (D) represents the following sizes: 100 µm, (A and B); and 200 µm, (C and D).

 
Immunocytochemistry for Albumin
To determine in vitro albumin production by the ICG-positive cells, we examined albumin immunoreactivity within the EB outgrowths. On approximately day 21, ICG-positive cell clusters proliferated to form more prominent three-dimensional structures (Fig. 2A and 2BGo). The ICG-positive clusters were intensely stained for albumin, although the albumin-immunoreactivity was observed in the surrounding cells (Fig. 2CGo).



View larger version (92K):
[in this window]
[in a new window]
 
Figure 2. Cellular uptake of ICG and immunohistochemistry for albumin within EB outgrowths on day 21. ICG-positive cell clusters proliferated to form prominent three-dimensional structures. A) Before ICG-staining. B) After ICG-staining. C) Subsequent to the ICG uptake study, albumin immunoreactivity was examined in the same specimen. ICG-positive clusters were intensely stained for albumin, although the albumin immunoreactivity was also observed in the surrounding cells. Scale bar = 600 µm.

 
Gene Expression in ICG-Positive Cells
To clarify the characteristic features of the ICG-positive cells, we analyzed the gene expression of a variety of hepatocyte markers by RT-PCR analysis (Fig. 3Go). RNA samples were obtained from undifferentiated ES cells, cells isolated from the ICG-negative area (ICG-negative cells), cells isolated from ICG-positive cell clusters (ICG-positive cells), and an adult liver. For the isolation of ICG-negative cells and ICG-positive cells, the outgrowths on day 21 of EB culture were used. Liver-specific serum protein genes including albumin, AFP, and TTR, as well as the endoderm-specific transcription factor gene, HNF3ß mRNA, were expressed in the ICG-negative cells (lane 2), ICG-positive cells (lane 3), and adult liver (lane 4), though the levels of albumin and TTR mRNA in ICG-negative cells were much lower than those in the ICG-positive cells and adult liver. Undifferentiated ES cells expressed none of the hepatocyte markers (lane 1). The gene of {alpha}-1-AT, a glycoprotein synthesized chiefly in hepatocytes [30], was highly expressed in the ICG-positive cells and adult liver, whereas it was not detected in the ICG-negative cells. ICG-positive cells slightly expressed the genes of a hepatic cytosolic hemoprotein tryptophan catabolizer, TDO [31], and CPSase I, which is the first enzyme of the urea cycle pathway in the liver [32]. A key regulatory enzyme of hepatic gluconeogenesis, PEPCK [33], and LST-1 were also expressed in the ICG-positive cells, though their mRNA levels were lower than those in the adult liver. In the ICG-negative cells, the expression of TDO, CPSase I, PEPCK, and LST-1 mRNA was not detected.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 3. Hepatocyte marker mRNA expression in undifferentiated ES cells (lane 1), ICG-negative cells (lane 2), ICG-positive cells (lane 3), and adult liver (lane 4). AFP = alpha-fetoprotein; TTR = transthyretin; HNF3 beta = hepatocyte nuclear factor 3 beta; alpha-1-AT = alpha-1-antitrypsin; TDO = tryptophan-2,3-dioxygenase; CPSase I = carbamoyl phosphate synthetase I; PEPCK = phosphoenolpyruvate carboxykinase; LST-1 = liver-specific organic anion transporter-1. Beta-actin transcripts are shown as an internal reference for amplification of cDNA.

 
Ultrastructural Characteristics of ICG-Positive Cells
The ICG-positive cell clusters consisted of a trabecula-like cell arrangement, however, epithelial cells forming sinusoids and Kupffer cells in Space of Disse were not observed between trabeculae. The absence of both blood vessels and bile ducts was striking, as shown in a semi-thin section stained with toluidine blue (Fig. 4AGo). Binucleate cells were frequently observed in the cluster (inset in Fig. 4AGo). Electron microscopy revealed that ICG-positive cell clusters were similar to hepatocytes from a morphological viewpoint with numerous mitochondria, lysosomes, rough and smooth endoplasmic reticulum, and well-developed Golgi apparatus. Bile canaliculi were common between adjacent cells and sealed with tight junctions (Fig. 4B and 4CGo).



View larger version (77K):
[in this window]
[in a new window]
 
Figure 4. Semi-thin section stained with toluidine blue and electron micrographs of ICG-positive cell clusters. A) A cross-section of the clusters stained with toluidine blue showing cord-like cell arrangement, similar to the trabeculae of the liver lobules. Some of the ICG-positive cells were binucleate (inset). B) An electron micrograph of ICG-positive cell clusters showing well-developed lysosomes, Golgi apparatus, and rough and smooth endoplasmic reticulum. Bile canaliculi were occasionally observed between adjacent cells. C) A bile canaliculus was separated from the remainder of the intercellular space by tight junctions and usually had sparse microvilli. The arrow and arrowhead indicate a bile canaliculus and a tight junction, respectively. Scale bar in the inset of (A) = 10 µm. Scale bar in (C) represents the following sizes: 18 µm, (A); 2.7 µm, (B); and 0.5 µm, (C).

 
ICG-Positive Cell Transplantation
ES cell-derived ICG-positive cells were transplanted into mice livers through the portal vein. In all the mice that received graft cells, transplanted ICG-positive cells were detected by EGFP fluorescence 4 weeks after implantation (Fig. 5A and 5BGo), and no development of teratomas was observed. The neighboring slice was examined for albumin-immunoreactivity after fixation with ethanol. The transplanted ICG-positive cells seemed to retain an albumin-producing ability because their immunoreactivity for albumin was similar to that seen in native hepatocytes (Fig. 5CGo). They looked to be normally incorporated into liver parenchymal structure, morphologically indistinguishable from neighboring hepatocytes (Fig. 5DGo), although the double fluorescence staining for both EGFP and albumin was the only way to evaluate the albumin production of the grafted cells.



View larger version (115K):
[in this window]
[in a new window]
 
Figure 5. ES cell-derived ICG-positive cells were transplanted into mice livers through the portal vein. A) Transplanted ICG-positive cells were detected by EGFP fluorescence 4 weeks after implantation. B) EGFP fluorescence contrasted with the surrounding hepatic parenchyma. C) Indistinguishable albumin immunoreactivity in the cytoplasm between possible transplanted ICG-positive cells (arrows) and native hepatocytes. D) The staining with hematoxylin and eosin revealed the incorporation of possible ICG-positive cells (arrows) into liver parenchymal structure. They were morphologically indistinguishable from neighboring hepatocytes. Arrows in C and D show as identified by EGFP fluorescence in A and B. Scale bar = 60 µm.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Here we showed that mouse ES cells can give rise to a hepatocyte-like cell cluster in vitro, which forms a three-dimensional structure and demonstrates cellular uptake of ICG. The ICG-positive cells were characterized by their gene expression of a variety of hepatocyte markers. Furthermore, they showed distinctive ultrastructural features characteristic of hepatocytes. Our results indicate that ES cell-derived ICG-positive cells possess genetic and morphological properties characteristic of hepatocytes.

The hepatocellular uptake of ICG is mainly mediated by Na+-independent basolateral (sinusoidal and lateral) membrane transport systems in vivo [18,19]. Initially, the organic anion transporting polypeptide (Oatp) was considered to be exclusive to the Na+-independent transporting mechanisms in the liver, however, it has been found to be expressed in the brain and kidney as well [34–38]. Recently, a novel organic anion transporter, LST-1, has been found to be expressed exclusively in the liver, even when the gene expression of Oatp is not detected [24–26], and is considered to be an essential molecule for transporting bile acids and organic anions in hepatocytes. The present study demonstrated that LST-1 mRNA was expressed in ICG-positive cells. Our results are consistent with a suspected role for LST-1 in the hepatocellular uptake of ICG in the liver. We consider that this ICG-staining method is easy and useful to identify highly possible candidates as hepatocytes, although further clarification of the intracellular transfer and excretion of ICG is required to verify the mechanisms of ICG-staining thoroughly.

Molecular analyses revealed that liver-specific serum protein genes such as albumin, AFP, and TTR, as well as the endoderm-specific transcription factor gene, HNF3ß, were expressed in ICG-positive cells. However, the expression of these genes can be found in the yolk sac, a derivative of the extraembryonic endoderm, as well as in the fetal liver [39–41]. Thus, these markers are insufficient to prove in vitro differentiation into hepatocytes, though they can be used to show early endoderm commitment in EBs derived from ES cells [42–44]. In the present study, we indeed observed albumin immunoreactivity and mRNA expression for albumin, AFP, TTR, and HNF3ß in cells other than ICG-positive clusters. In contrast, the gene of {alpha}-1-AT, a glycoprotein synthesized chiefly in hepatocytes [30], was highly expressed in ICG-positive cells. Furthermore, ICG-positive cells expressed the genes related to hepatic metabolism, including TDO (a tryptophan catabolizer) [31], CPSase I (the first enzyme of the urea cycle pathway) [32], and PEPCK (a key regulatory enzyme of hepatic gluconeogenesis) [33], whereas these genes were not expressed in ICG-negative cells. These results indicate that ICG-positive cell differentiation is specified toward hepatocytes and that these cells possess the genetic characteristics of almost terminally differentiated hepatocytes.

Our ultrastructural observations provided more convincing evidence that the ES cell-derived ICG-positive cells are characterized as hepatocytes. ICG-positive cells contained well-developed organelles such as mitochondria, lysosomes, Golgi apparatus, and rough and smooth endoplasmic reticulum. Notably, a bile canaliculus was observed in the intercellular space of adjacent two cells. Furthermore, we found many binuclear cells, which were commonly found in vivo. ICG-positive cells connected to each other by tight junctions that demarcate the limits of a bile canalicular space. Adjacent hepatocytes isolated from the liver usually form a primary unit of bile canalicular function including bile formation and secretion, since the apical canalicular polarity is retained between the two adjacent hepatocytes [45–47]. Although ICG-positive cell clusters lacked some components such as blood vessels and bile ducts, they possessed morphological properties of hepatocytes.

In the present study, we showed that ES cells can differentiate into "hepatocytes" within developing EBs without the addition of growth or differentiation factors, suggesting that EBs themselves provide an appropriate microenvironment that supports hepatogenesis in vitro. It is well known that EBs can generate all three cellular lineages indicative of endoderm, mesoderm, and ectoderm within the first few days of differentiation, and mimic a developing embryo [3,4]. Interestingly, most of the cellular clusters showing the uptake of ICG were adjacent to differentiated cardiac beating muscles. This finding may support the recent work of Zaret and coworkers [48–51], who have reported that hepatic differentiation requires interaction with the adjacent cardiac mesoderm producing multiple fibroblast growth factors in the mouse embryo.

Finally, we found that ES cell-derived ICG-positive cells transplanted through the portal vein were normally incorporated into mice liver parenchymal structure, without forming a teratoma. They were morphologically indistinguishable from neighboring hepatocytes and seemed to retain an albumin-producing ability for at least 4 weeks. These results raise the possibility that ES cells can provide a novel source of hepatocytes for cell transplantation. In light of cell transplantation therapy, the present results make an important contribution to attempts to isolate large numbers of living hepatocytes from EBs, which may circumvent the problem of a lack of donor material.


    ACKNOWLEDGMENT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We thank Dr. Hitoshi Niwa for his critical review of the manuscript, Dr. Hiroshige Nakano for his helpful discussion, and Shigeko Torihashi, Masashi Ando, Sanehito Ogawa, and Yae Hanesaka for their expert technical assistance. This work was supported by a Research Grant-in-Aid from the Ministry of Education, Science, and Culture of Japan.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Evans MJ, Kaufman MH. Establishment in culture of pluripotent cells from mouse embryos. Nature 1981;292:154–156.[CrossRef][Medline]

  2. Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA 1981;78:7634–7638.[Abstract/Free Full Text]

  3. Robertson EJ. Embryo-derived stem cell lines. In: Robertson EJ, ed. Teratocarcinomas and embryonic stem cells: a practical approach, First Edition. Washington, DC: IRL Press, 1987;71-112.

  4. Keller GM. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 1995;7:862–869.[CrossRef][Medline]

  5. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  6. Odorico JS, Kaufman DS, Thomson JA. Multilineage differentiation from human embryonic stem cell lines. STEM CELLS 2001;19:193–204.[Abstract/Free Full Text]

  7. Potocnik AJ, Kohler H, Eichmann K. Hemato-lymphoid in vivo reconstitution potential of subpopulations derived from in vitro differentiated embryonic stem cells. Proc Natl Acad Sci USA 1997;94:10295–10300.[Abstract/Free Full Text]

  8. Ling V, Neben S. In vitro differentiation of embryonic stem cells: immunophenotypic analysis of cultured embryoid bodies. J Cell Physiol 1997;171:104–115.[CrossRef][Medline]

  9. Klug MG, Soonpaa MH, Koh GY et al. Genetically selected cardiomyocytes from differentiating embryonic stem cells form stable intracardiac grafts. J Clin Invest 1996;98:216–224.[Medline]

  10. Ng WA, Doetschman T, Robbins J et al. Muscle isoactin expression during in vitro differentiation of murine embryonic stem cells. Pediatr Res 1997;41:285–292.[Medline]

  11. Drab M, Haller H, Bychkov R et al. From totipotent embryonic stem cells to spontaneously contracting smooth muscle cells: a retinoic acid and db-cAMP in vitro differentiation model. FASEB J 1997;11:905–915.[Abstract]

  12. Yamada T, Yoshikawa M, Takaki M et al. In vitro functional gut-like organ formation from mouse embryonic stem cells. STEM CELLS 2002;20:41–49.[Abstract/Free Full Text]

  13. Bain G, Kitchens D, Yao M et al. Embryonic stem cells express neuronal properties in vitro. Dev Biol 1995;168:342–357.[CrossRef][Medline]

  14. Brustle O, Jones KN, Learish RD et al. Embryonic stem cell-derived glial precursors: a source of myelinating transplants. Science 1999;285:754–756.[Abstract/Free Full Text]

  15. McDonald JW, Liu XZ, Qu Y et al. Transplanted embryonic stem cells survive, differentiate and promote recovery in injured rat spinal cord. Nat Med 1999;5:1410–1412.[CrossRef][Medline]

  16. Lee S-H, Lumelsky N, Studer L et al. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat Biotechnol 2000;18:675–679.[CrossRef][Medline]

  17. Hamazaki T, Iiboshi Y, Oka M, et al. Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett 2001;497:15–19.[CrossRef][Medline]

  18. Meier PJ, Eckhardt U, Schroeder A et al. Substrate specificity of sinusoidal bile acid and organic anion uptake systems in rat and human liver. Hepatology 1997;26:1667–1677.[CrossRef][Medline]

  19. Müller M, Jansen PL. The secretory function of the liver: new aspects of hepatobiliary transport. J Hepatol 1998;28:344–354.[CrossRef][Medline]

  20. Branch RA. Drugs as indicators of hepatic function. Hepatology 1982;2:97–105.[Medline]

  21. Berk PD, Stremmel W. Hepatocellular uptake of organic anions. Prog Liv Dis 1986;8:125–144.

  22. Meijer DKF, Weert B, Vermeer GA. Pharmacokinetics of biliary excretion in man. VI. Indocyanine green. Eur J Clin Pharmacol 1988;35:295–303.[CrossRef][Medline]

  23. Shinohara H, Tanaka A, Kitai T et al. Direct measurement of hepatic indocyanine green clearance with near-infrared spectroscopy: separate evaluation of uptake and removal. Hepatology 1996;23:137–144.[CrossRef][Medline]

  24. Abe T, Kakyo M, Tokui T et al. Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem 1999;274:17159–17163.[Abstract/Free Full Text]

  25. Kakyo M, Unno M, Tokui T et al. Molecular characterization and functional regulation of a novel rat liver-specific organic anion transporter rlst-1. Gastroenterology 1999;117:770–775.[CrossRef][Medline]

  26. Ogura K, Choudhuri S, Klaassen CD. Full-length cDNA cloning and genomic organization of the mouse liver-specific organic anion transporter-1 (lst-1). Biochem Biophys Res Commun 2000;272:563–570.[CrossRef][Medline]

  27. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000;24:372–376.[CrossRef][Medline]

  28. Hooper M, Hardy K, Handyside A et al. HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 1987;326:292–295.[CrossRef][Medline]

  29. Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol 1976;13:29–83.[Medline]

  30. Coakley RJ, Taggart C, O'Neill S et al. Alpha1-antitrypsin deficiency: biological answers to clinical questions. Am J Med Sci 2001;321:33–41.[CrossRef][Medline]

  31. Ren S, Correia MA. Heme: a regulator of rat hepatic tryptophan 2,3-dioxygenase? Arch Biochem Biophys 2000;377:195–203.[CrossRef][Medline]

  32. Schofield JP, Cox TM, Caskey CT et al. Mice deficient in the urea-cycle enzyme, carbamoyl phosphate synthetase I, die during the early neonatal period from hyperammonemia. Hepatology 1999;29:181–185.[CrossRef][Medline]

  33. She P, Shiota M, Shelton KD et al. Phosphoenolpyruvate carboxykinase is necessary for the integration of hepatic energy metabolism. Mol Cell Biol 2000;20:6508–6517.[Abstract/Free Full Text]

  34. Kullak-Ublick GA, Hagenbuch B, Stieger B et al. Functional characterization of the basolateral rat liver organic anion transporting polypeptide. Hepatology 1994;20:411–416.[CrossRef][Medline]

  35. Jacquemin E, Hagenbuch B, Stieger B et al. Expression cloning of a rat liver Na(+)-independent organic anion transporter. Proc Natl Acad Sci USA 1994;91:133–137.[Abstract/Free Full Text]

  36. Noé B, Hagenbuch B, Stieger B et al. Isolation of a multispecific organic anion and cardiac glycoside transporter from rat brain. Proc Natl Acad Sci USA 1997;94:10346–10350.[Abstract/Free Full Text]

  37. Abe T, Kakyo M, Sakagami H et al. Molecular characterization and tissue distribution of a new organic anion transporter subtype (oatp3) that transports thyroid hormones and taurocholate and comparison with oatp2. J Biol Chem 1998;273:22395–22401.[Abstract/Free Full Text]

  38. Kullak-Ublick GA, Hagenbuch B, Stieger B et al. Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology 1995;109:1274–1282.[CrossRef][Medline]

  39. Meehan RR, Barlow DP, Hill RE et al. Pattern of serum protein gene expression in mouse visceral yolk sac and foetal liver. EMBO J 1984;3:1881–1885.[Medline]

  40. Sellem CH, Frain M, Erdos T et al. Differential expression of albumin and alpha-fetoprotein genes in fetal tissues of mouse and rat. Dev Biol 1984;102:51–60.[CrossRef][Medline]

  41. Makover A, Soprano DR, Wyatt ML et al. An in situ-hybridization study of the localization of retinol-binding protein and transthyretin messenger RNAs during fetal development in the rat. Differentiation 1989;40:17–25.[CrossRef][Medline]

  42. Abe K, Niwa H, Iwase K et al. Endoderm-specific gene expression in embryonic stem cells differentiated to embryoid bodies. Exp Cell Res 1996;229:27–34.[CrossRef][Medline]

  43. Levinson-Dushnik M, Benvenisty N. Involvement of hepatocyte nuclear factor 3 in endoderm differentiation of embryonic stem cells. Mol Cell Biol 1997;17:3817–3822.[Abstract]

  44. Divine JK, Flake N, Sheehan K et al. Expression of a novel antigen, EEM-1, in the mouse embryo and embryonic stem cell-derived embryoid bodies. Dev Dyn 2000;218:207–211.[CrossRef][Medline]

  45. Graf J, Gautam A, Boyer JL. Isolated rat hepatocyte couplets: a primary secretory unit for electrophysiologic studies of bile secretory function. Proc Natl Acad Sci USA 1984;81:6516–6520[Abstract/Free Full Text]

  46. Coleman R, Roma MG. Hepatocyte couplets. Biochem Soc Trans 2000;28:136–140.[Medline]

  47. Roma MG, Milkiewicz P, Elias E et al. Control by signaling modulators of the sorting of canalicular transporters in rat hepatocyte couplets: role of the cytoskeleton. Hepatology 2000;32:1342–1356.[CrossRef][Medline]

  48. Zaret K. Molecular genetics of early liver development. Annu Rev Physiol 1996;58:231–251.[CrossRef][Medline]

  49. Zaret K. Early liver differentiation: genetic potentiation and multilevel growth control. Curr Opin Genet Dev 1998;8:526–531.[CrossRef][Medline]

  50. Jung J, Zheng M, Goldfarb M et al. Initiation of mammalian liver development from endoderm by fibroblast growth factors. Science 1999;284:1998–2003.[Abstract/Free Full Text]

  51. Darlington GJ. Molecular mechanisms of liver development and differentiation. Curr Opin Cell Biol 1999;11:678–682.[CrossRef][Medline]

Received on October 15, 2001; accepted for publication on October 23, 2001.




This article has been cited by other articles:


Home page
Stem CellsHome page
I. Drobinskaya, T. Linn, T. Saric, R. G. Bretzel, H. Bohlen, J. Hescheler, and E. Kolossov
Scalable Selection of Hepatocyte- and Hepatocyte Precursor-Like Cells from Culture of Differentiating Transgenically Modified Murine Embryonic Stem Cells
Stem Cells, September 1, 2008; 26(9): 2245 - 2256.
[Abstract] [Full Text] [PDF]


Home page
J Biomater ApplHome page
Dae Seok Na, H. Lee, Sun Uk Kim, Chang Nam Hwang, Sang Ho Lee, Ji Yoon Kang, Jai Kyeong Kim, and James Jungho Pak
Comparative Study of P19 EC Stem Cell Differentiation in between Conventional Hanging Drop and the Zebrafish Chorion as a Bio-derived Material
J Biomater Appl, July 1, 2008; 23(1): 73 - 84.
[Abstract] [PDF]


Home page
Stem CellsHome page
S. Agarwal, K. L. Holton, and R. Lanza
Efficient Differentiation of Functional Hepatocytes from Human Embryonic Stem Cells
Stem Cells, May 1, 2008; 26(5): 1117 - 1127.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Wanderling, B. B. Simen, O. Ostrovsky, N. T. Ahmed, S. M. Vogen, T. Gidalevitz, and Y. Argon
GRP94 Is Essential for Mesoderm Induction and Muscle Development Because It Regulates Insulin-like Growth Factor Secretion
Mol. Biol. Cell, October 1, 2007; 18(10): 3764 - 3775.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. C. Arufe, M. Lu, A. Kubo, G. Keller, T. F. Davies, and R.-Y. Lin
Directed Differentiation of Mouse Embryonic Stem Cells into Thyroid Follicular Cells
Endocrinology, June 1, 2006; 147(6): 3007 - 3015.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. M. Karp, L. S. Ferreira, A. Khademhosseini, A. H. Kwon, J. Yeh, and R. S. Langer
Cultivation of Human Embryonic Stem Cells Without the Embryoid Body Step Enhances Osteogenesis In Vitro
Stem Cells, April 1, 2006; 24(4): 835 - 843.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. Ogawa, Y.-i. Tagawa, A. Kamiyoshi, A. Suzuki, J. Nakayama, Y. Hashikura, and S. Miyagawa
Crucial Roles of Mesodermal Cell Lineages in a Murine Embryonic Stem Cell-Derived In Vitro Liver Organogenesis System
Stem Cells, August 1, 2005; 23(7): 903 - 913.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
D. Choi, H.-J. Lee, S. Jee, S. Jin, S. K. Koo, S. S. Paik, S. C. Jung, S.-Y. Hwang, K. S. Lee, and B. Oh
In Vitro Differentiation of Mouse Embryonic Stem Cells: Enrichment of Endodermal Cells in the Embryoid Body
Stem Cells, June 1, 2005; 23(6): 817 - 827.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Keller
Embryonic stem cell differentiation: emergence of a new era in biology and medicine
Genes & Dev., May 15, 2005; 19(10): 1129 - 1155.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. M. Wobus and K. R. Boheler
Embryonic Stem Cells: Prospects for Developmental Biology and Cell Therapy
Physiol Rev, April 1, 2005; 85(2): 635 - 678.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
K. Asahina, H. Fujimori, K. Shimizu-Saito, Y. Kumashiro, K. Okamura, Y. Tanaka, K. Teramoto, S. Arii, and H. Teraoka
Expression of the liver-specific gene Cyp7a1 reveals hepatic differentiation in embryoid bodies derived from mouse embryonic stem cells
Genes Cells, December 1, 2004; 9(12): 1297 - 1308.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Paglialunga, A. Fico, I. Iaccarino, R. Notaro, L. Luzzatto, G. Martini, and S. Filosa
G6PD is indispensable for erythropoiesis after the embryonic-adult hemoglobin switch
Blood, November 15, 2004; 104(10): 3148 - 3152.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. C. Davila, G. G. Cezar, M. Thiede, S. Strom, T. Miki, and J. Trosko
Use and Application of Stem Cells in Toxicology
Toxicol. Sci., June 1, 2004; 79(2): 214 - 223.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Kubo, K. Shinozaki, J. M. Shannon, V. Kouskoff, M. Kennedy, S. Woo, H. J. Fehling, and G. Keller
Development of definitive endoderm from embryonic stem cells in culture
Development, April 1, 2004; 131(7): 1651 - 1662.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C. Selden, S.-A. Chalmers, C. Jones, R. Standish, A. Quaglia, N. Rolando, A. K. Burroughs, K. Rolles, A. Dhillon, and H. J.F. Hodgson
Epithelial Colonies Cultured from Human Explanted Liver in Subacute Hepatic Failure Exhibit Hepatocyte, Biliary Epithelial, and Stem Cell Phenotypic Markers
Stem Cells, November 1, 2003; 21(6): 624 - 631.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
F. Nishimura, M. Yoshikawa, S. Kanda, M. Nonaka, H. Yokota, A. Shiroi, H. Nakase, H. Hirabayashi, Y. Ouji, J.-I. Birumachi, et al.
Potential Use of Embryonic Stem Cells for the Treatment of Mouse Parkinsonian Models: Improved Behavior by Transplantation of In Vitro Differentiated Dopaminergic Neurons from Embryonic Stem Cells
Stem Cells, March 1, 2003; 21(2): 171 - 180.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
A. Shiroi, M. Yoshikawa, H. Yokota, H. Fukui, S. Ishizaka, K. Tatsumi, and Y. Takahashi
Identification of Insulin-Producing Cells Derived from Embryonic Stem Cells by Zinc-Chelating Dithizone
Stem Cells, July 1, 2002; 20(4): 284 - 292.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, T.
Right arrow Articles by Tsunoda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, T.
Right arrow Articles by Tsunoda, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS