Stem Cells 2002;20:284-292
www.StemCells.com
© 2002 AlphaMed Press
Identification of Insulin-Producing Cells Derived from Embryonic Stem Cells by Zinc-Chelating Dithizone
Akira Shiroia,b,
Masahide Yoshikawaa,
Hiroshi Yokotaa,
Hiroshi Fukuib,
Shigeaki Ishizakaa,
Kouko Tatsumic,
Yoshiko Takahashid
a Division of Developmental Biology, Department of Parasitology,
b Third Department of Internal Medicine, and
c Second Department of Anatomy, Nara Medical University, Kashihara, Nara, Japan;
d Graduate School of Biological Sciences, Nara Institute of Science and Technology, Ikoma, Nara, Japan
Key Words. Embryonic stem cell • Dithizone • Pancreatic differentiation • Insulin-secreting cells • Cell transplantation
Correspondence:
Masahide Yoshikawa, M.D., Division of Developmental Biology, Department of Parasitology, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521, Japan. Telephone: 81-744-22-3051, ext 2250; Fax: 81-744-24-7122; e-mail: myoshika{at}nmu-gw.naramed-u.ac.jp
 |
ABSTRACT
|
|---|
Background and Aims. Embryonic stem (ES) cells have a pluripotent ability to differentiate into a variety of cell lineages in vitro. We have recently identified the emergence of cellular clusters within differentiated ES cell cultures by staining with dithizone (DTZ). DTZ is a zinc-chelating agent known to selectively stain pancreatic beta cells because of their high zinc content. The aim of the present study was to investigate the characteristics of DTZ-stained cellular clusters originating from ES cells.
Methods. Embryoid bodies (EBs), formed by a 5-day hanging drop culture of ES cells, were allowed to form outgrowths in the culture. The outgrowths were incubated in DTZ solution (final concentration, 100 µg/ml ) for 15 minutes before being examined microscopically. The gene expression of endocrine pancreatic markers was also analyzed by reverse transcriptase-polymerase chain reaction. In addition, insulin production was examined immunohistochemically, and its secretion was examined using enzyme-linked immunosorbent assay.
Results. DTZ-stained cellular clusters appeared after approximately 16 days in the EB culture and became more apparent by day 23. They were found to be immunoreactive to insulin and expressed pancreatic-duodenal homeobox 1 (PDX1), proinsulin 1, proinsulin 2, glucagon, pancreatic polypeptide, glucose transporter-2 (GLUT2), and islet-specific glucose-6-phosphatase catalytic subunit-related protein (IGRP) mRNA. They were also able to secrete detectable amounts of insulin.
Conclusions. ES cell-derived DTZ-positive cellular clusters possess characteristics of the endocrine pancreas, including insulin secretion. Further, DTZ staining is a useful method for the identification of differentiated pancreatic islets developed from EBs in vitro.
 |
INTRODUCTION
|
|---|
Embryonic stem (ES) cells are continuously growing stem cell lines of embryonic origin that were first isolated from the inner cell mass of developing mouse blastocysts [1, 2]. The distinguishing features of ES cells are their capacity to be maintained in culture indefinitely in an undifferentiated state, as well as an ability to develop into a broad spectrum of derivatives of all three embryonic germ layersectoderm, mesoderm, and endoderm [3, 4]. More recently, human ES cell lines derived from human blastocysts have been isolated [5] and shown to have an extensive proliferative potential as well as a capability of multilineage differentiation in both in vitro and in vivo experiments [6]. This ability to develop into a wide range of cell types has drawn clinical attention to ES cells as a novel source of cell populations for new therapeutic strategies, such as cell transplantation and tissue regeneration.
Cell therapy for diabetes mellitus is based mainly on islet transplantation [79], but large numbers of purified islets from cadaveric donors are required for success. One alternative is the use of pluripotent ES cells, since they are not only renewable but they also constitute a limitless source of various cells. When allowed to differentiate in a suspension culture, ES cells form spherical multicellular aggregates known as embryoid bodies (EBs) [3, 4] and, as differentiation continues, a wide range of cell types develops within the EB environment. To date, some success has already been achieved in inducing mouse ES cells to differentiate into particular types of cells, such as cardiac muscle cells [10], smooth muscle cells [1113], neurons [1417], hematopoietic cells [18, 19], hepatocytes [20, 21], and insulin-producing cells [22, 23]. More recently, the differentiation of human ES cells into neurons [24], cardiomyocytes [25], and insulin-secreting cells [26] using an EB culture has been reported. However, in vitro differentiated ES cells are generally composed of a variety of cell types, and even in culture conditions oriented toward a directed differentiation into a certain cell lineage, it is difficult to obtain a pure single cell type in vitro. Therefore, development of a method for the identification and selection of specific cell types from a population of mixed cells that have differentiated from ES cells is indispensable for cell transplantation therapy.
Dithizone (DTZ), a zinc-chelating agent, is known to selectively stain pancreatic ß cells crimson red [2731], as they contain a large amount of zinc. Using this characteristic of DTZ, we identified insulin-producing cells in EB outgrowths derived from mouse ES cells as well as cellular clusters. We then analyzed the characteristic features of these DTZ-stained clusters by immunohistochemistry for insulin production and by reverse transcriptase-polymerase chain reaction (RT-PCR) for gene expression of the pancreatic ß-cell markers, including proinsulin 1, proinsulin 2, pancreatic transcription factor pancreatic-duodenal homeobox 1 (PDX1) [32, 33], glucose transporter-2 (GLUT2) [34, 35], and islet-specific glucose-6-phosphatase catalytic subunit-related protein (IGRP) [36, 37]. We also examined insulin secretion using an enzyme-linked immunoassay (ELISA). Our results may provide evidence that can be applied to useful and practical therapeutic strategies for cell transplantation against diabetes mellitus using ES cells.
 |
MATERIALS AND METHODS
|
|---|
ES Cell Culture
Undifferentiated ES cells (EB3) were maintained in gelatin-coated dishes without feeder cells in Dulbecco's modified Eagle's medium (DMEM; Sigma; St. Louis, MO; http://www.sigmaaldrich.com) supplemented with 10% fetal bovine serum ([FBS] GIBCO/BRL; Grand Island, NY; http://www.invitrogen.com), 0.1 mM 2-mercaptoethanol (Sigma), 0.1 mM nonessential amino acids (GIBCO/BRL), 1 mM sodium pyruvate (Sigma), 4.5 mg/ml D-glucose, and 1,000 U/ml of leukemia inhibitory factor ([LIF] GIBCO/BRL). The EB3 cells (a kind gift from Dr. Hitoshi Niwa, RIKEN Center for Developmental Biology, Kobe, Japan) were a subline derived from E14tg2a ES cells [38] and carried the blasticidin S-resistant selection marker gene driven by the Oct-3/4 promoter (active when in the undifferentiated state) [39]. They were maintained in medium containing 10 µg/ml blasticidin S to eliminate differentiated cells. To induce EB formation, dissociated ES cells were cultured in hanging drops (4). The cell density of one drop was 500 cells per 20 µl of ES cell medium in the absence of LIF. After 5 days in a hanging drop culture, the resulting EBs were plated in plastic 100-mm gelatin-coated dishes (20 EBs per dish) and then allowed to attach and form outgrowth cultures. Half of the culture medium was replenished with new medium every 2 days. Figure 1
shows an outline of the methods utilized in this study.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 1. Outline of the methods used in this study. Embryonic stem (ES) cells dissociated by trypsinization were cultured in hanging drops to induce embryoid body (EB) formation. The cell density of one drop was 500 cells per 20 µl of ES cell medium in the absence of leukemia inhibitory factor (LIF). After 5 days in a hanging drop culture, the resulting EBs were plated in plastic, 100-mm, gelatin-coated dishes (20 EBs per dish) and then allowed to attach and form outgrowth cultures. Half of the culture medium was replenished with new medium every 2 days. Dithizone (DTZ) staining was performed on days 21 and 28. Analyses of pancreatic islet-related gene expression and insulin immunoreactivity were performed on day 28. RT-PCR = reverse transcriptase-polymerase chain reaction.
|
|
Islet Isolation
Mouse pancreatic islets were isolated as described previously [40]. Briefly, female 16-week-old 129/SVJ mice were killed by cervical dislocation. The pancreata were removed, without ductal injection or distention, cut into small pieces, and washed three times with cold Hanks' balanced salt solution (HBSS) in order to remove released trypsin. The resulting pieces were suspended in 5 ml of HBSS, transferred to a 10-ml glass tube containing 2,500 U of collagenase, and digested with shaking at 37°C for 10 minutes. The digested sample was then washed three times with cold HBSS. Islet purification was performed by centrifugation at 800 g for 15 minutes at 4°C on discontinuous Ficoll (1.080 mg/ml) and HBSS gradients. Islets were aspirated from the Ficoll/HBSS interface and washed with cold HBSS. Islet viability was confirmed by trypan blue exclusion.
DTZ Staining
A DTZ (Merck; Whitehouse Station, NJ; http://www.merck.com) stock solution was prepared with 50 mg of DTZ in 5 ml of dimethyl sulfoxide (DMSO) and stored briefly at -15°C. In vitro DTZ staining was performed by adding 10 µl of the stock solution to 1 ml of culture medium. The staining solution was filtered through a 0.2 µm nylon filter and then used as the DTZ working solution. The culture dishes were incubated at 37°C for 15 minutes in the DTZ solution. After the dishes were rinsed three times with HBSS, clusters stained crimson red were examined with a stereomicroscope. After examination, the dishes were refilled with DMEM containing 10% FBS. The stain completely disappeared from the cells after 5 hours. In some experiments, the number of DTZ-stained cells in the cultures was determined by counting those crimson red cells after trypsinization following DTZ stain.
Immunocytochemistry
Cells in culture dishes were fixed with 4% paraformaldehyde in phosphate-buffered solution. The primary antibody, guinea pig anti-insulin polyclonal antibody (Histofine 412411; Nichirei; Tokyo, Japan; http://www.nichirei.co.jp/english/index.html), was used without dilution. For detection of the primary antibody, a fluorescent-labeled secondary antibody, goat anti-guinea pig IgG conjugated with fluorescein-5-isothiocyanate (Cappel 57000; ICN Pharmaceuticals, Inc.; Aurora, OH; http://www.icnpharm.com), was utilized according to the manufacturer's instructions.
RNA Extraction and RT-PCR Analysis
Total RNA was extracted from the cells using TRIzol® (GIBCO/BRL). DNase-treated total RNA was used for the first-strand cDNA. This reaction was performed using SuperScriptTM II and random hexanucleotide (GIBCO/BRL), following the protocol of the manufacturer. cDNA samples were subjected to PCR amplification with specific primers under linear conditions in order to reflect the original amount of the specific transcript. The cycling parameters were as follows: denaturation at 94°C for 1 minute, annealing at 52-60°C for 1 minute (depending on the primer), and elongation at 72°C for 1 minute (35 cycles). The PCR primers and the length of the amplified products were as follows: ß-actin (TGAACTGGCTGACT GCTGTG and CATCCTTGGCCTCAGCATAG, 174 bp); hepatocyte nuclear factor 3 beta (HNF3ß) (AGAAG CAACTGGCACTGAAGGA and GTAGTGCATGACCT GTTCGTAG, 464 bp); PDX1 (GGCCACACAGCTCTA CAAGG and TTCCACTTCATGCGACGGTT, 582 bp); proinsulin 1 (GTTGGTGCACTTCCTACCCCTG and GTAGAGGGAGCAGATGCTGGTG, 300 bp) [41]; proinsulin 2 (GTGGATGCGCTTCCTGCCCCTG and GTAGAGGGAGCAGATGCTGGTG, 300 bp) [41]; glucagon (CACTCACAGGGCACATTCACC and ACCA GCCACGCAATGAATTCCTT, 221 bp); pancreatic polypeptide (PP) (CTGCCTCTCCCTGTTTCTC and GGCTGAAGACAAGAGAGGC, 337 bp); somatostatin (GACCTGCGAACTAGACTGAC and TTTGGGGGA GAGGGATCAG, 294 bp); GLUT2 (GGATAAAT TCGCCTGGATGA and TTCCTTTGGTTTCTGGAA CT, 299 bp); and IGRP (TTTTACCTGCTTCTCCGACT GTT and TAGAGAATTTTGAAAGAATTGACTCC, 859 bp).
Insulin Detection Assay
Cultured cells were incubated with the DTZ solution at day 28. DTZ-stained clusters were enclosed in 2.0-mm diameter cloning cylinders and isolated from the surrounding cells. On day 29, cells inside the cylinders were washed three times with serum-free medium containing 5.5 mM glucose and incubated in 0.1 ml of serum-free medium containing either 5.5 mM or 25 mM glucose for 2 hours. Subsequently, conditioned medium samples were collected, and insulin levels were measured using an enzyme immunoassay (Mouse Insulin ELISA TMB Kit AKRIN-011T; Shibayagi Co., Ltd.; Gunma, Japan) that detects mouse insulin in a range between 156 pg/ml and 10,000 pg/ml with no cross reactivity to C peptide.
 |
RESULTS
|
|---|
ES Cell Differentiation and DTZ Staining
We first determined whether the isolated pancreatic islets were stained with DTZ and found that most were crimson red (Fig. 2A
), while undifferentiated ES cells were not stained (Fig. 2B
). ES cells were cultured for 5 days in a hanging drop culture system and allowed to form aggregates (EBs). The resulting EBs were transferred to gelatin-coated dishes and spread around. Five days after beginning the EB outgrowth cultures, various types of cells, including cardiac beating muscle cells, emerged. At this stage, DTZ-positive cells were not observed within the EB cultures. After approximately 21 days (about 16 days after beginning the EB outgrowth cultures), DTZ-positive cells became visible, though the staining intensity was still faint (Fig. 2C
). Cells that were distinctly stained crimson red by DTZ became apparent on approximately day 28 (about 23 days after beginning the EB outgrowth cultures) (Fig. 2D
). Moreover, at that time, some had assembled as masses while the others remained as solitary small clusters. When counted after trypsinization of the EB outgrowths on day 28, the number of DTZ-stained cells was less than 0.1% of the total cells in the culture plate.

View larger version (127K):
[in this window]
[in a new window]
|
Figure 2. Embryonic stem (ES) cell differentiation and dithizone (DTZ) staining. A) Most of the isolated pancreatic islets can be seen stained with DTZ. B) Undifferentiated ES cells are not stained. C) Day 21: DTZ-stained cells are visible, but the intensity is faint. D) Day 28: cells distinctly stained crimson red by DTZ are apparent, with some assembled as masses. Scale bars represent 100 µm in length.
|
|
Immunocytochemistry for Insulin
To determine in vitro insulin production by DTZ-positive cells, we examined insulin immunoreactivity within the EB outgrowths on day 28. A representative microscopic field is shown in Figure 3A
. This field was found to be totally filled with ES-derived cells and contained various sizes of DTZ-positive clusters, almost all of which were positive for insulin (Fig. 3B
). Immunoreactivity was also observed diffusely in some areas apart from the DTZ-positive clusters. In Figure 3C
, a pancreatic islet in a thin-sliced specimen from a pancreas isolated from a female 129/SVJ mouse can be clearly observed as a positive area of insulin immunoreactivity.

View larger version (75K):
[in this window]
[in a new window]
|
Figure 3. Immunocytochemistry for insulin. Insulin immunoreactivity within the EB outgrowths on day 28 (A and B). Almost all of the DTZ-stained clusters were positive for insulin. Diffuse immunoreactivity was also observed in some areas apart from the DTZ-positive clusters. A pancreatic islet in a thin-sliced pancreatic specimen showing positive insulin immunoreactivity (C). Scale bar = 100 µm.
|
|
Gene Expression in DTZ-Positive Cells
To clarify the characteristic features of the DTZ-stained cellular clusters, we analyzed the gene expression of a variety of endocrine pancreatic markers using RT-PCR analysis. RNA samples were obtained from the EB outgrowths on day 28 using cloning cylinders (2.0 mm in diameter). Under phase-contrast observations using an inverted laboratory microscope, they were attached to the culture dish so as to enclose the DTZ-stained cells or clusters (Fig. 4A
, those approximately located within the circles). The cells inside each cylinder were directly lysed by mixing with 200 µl of TRIzol®. All three samples from the DTZ-stained areas expressed HNF3ß and PDX1 mRNA of endoderm and endoderm- and pancreas-specific transcription factor genes, respectively, as well as proinsulin 1, proinsulin 2, glucagon, PP, GLUT2, and IGRP (Fig. 4B
, lanes 3-5). This expression pattern was exactly the same as that of the isolated pancreatic islets (lane 2). GLUT2 and IGRP are highly pancreatic ß-cell- or islet-specific genes. GLUT2 plays an important role in glucose-stimulated insulin secretion, and IGRP is a newly cloned islet-specific gene encoding the catalytic subunit of glucose-6-phosphatase. Undifferentiated ES cells did not express any of these pancreatic markers (lane 1).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 4. Gene expression in dithizone (DTZ)-stained cells. A) RNA samples were obtained from the embryoid body outgrowths on day 28 using cloning cylinders (2.0 mm in diameter) under phase-contrast observations by an inverted laboratory microscope. Cylinders were placed approximately in the circles to prepare RNA samples from DTZ-stained cell areas, and in the broken circles to prepare RNA samples from DTZ-unstained cell areas. B) Pancreatic islet-related marker mRNA expression in undifferentiated embryonic stem cells (lane 1), isolated pancreatic islands (lane 2), samples from DTZ-stained areas (lanes 3, 4, and 5), and samples from DTZ-unstained areas (lanes 6, 7, and 8). Circles in upper, middle, and lower portions of A correspond to lanes 3, 4, and 5, respectively. Broken circles in the upper, middle, and lower portions of A correspond to lanes 6, 7, and 8, respectively. Abbreviations: HNF3 ß = hepatocyte nuclear factor 3 beta; PDX1 = pancreatic transcription factor pancreatic-duodenal homeobox 1; GLUT2 = glucose transporter-2; IGRP = islet-specific glucose-6-phosphatase catalytic subunit-related protein.
|
|
RNA samples were also prepared from those areas where DTZ-stained cells were not found, by observation through a low magnification (x 40) microscope (Fig. 4A
, broken circles). The pattern of islet-related gene expression in these DTZ-unstained cells was not as uniform as that seen in the DTZ-stained cell areas (Fig. 4B
, lanes 6-8). Further, no expression of GLUT2 or IGRP was observed in any of these three samples, not even in one that presented the expression of several islet-related genes, such as PDX1, proinsulin 1, proinsulin 2, and glucagon.
Insulin Secretion
DTZ-stained clusters were enclosed in 2.0-mm diameter cloning cylinders at 10 different areas on day 28. On day 29, these 10 sampling areas were randomly divided into two groups, each composed of five areas. In one group, cells inside the cylinders were incubated in 0.1 ml of serum-free medium containing 25 mM glucose for 2 hours. In the other group, those inside the cylinders were incubated in the medium containing 5.5 mM glucose.
Insulin concentrations (mean ± standard deviation) in culture media of those DTZ-stained clusters incubated with 5.5 mM and 25 mM glucose were 1,125 ± 212 pg/ml and 985 ± 250 pg/ml, respectively. On the other hand, insulin concentrations in media containing undifferentiated ES cells were under the detection limit with both glucose conditions.
 |
DISCUSSION
|
|---|
The pluripotency of ES cells to develop into a wide range of cell types has drawn attention to them as a potential novel source of cell populations to be used in new therapeutic strategies, such as cell transplantation and tissue engineering. In particular, diseases that result from the destruction of a limited number of cell types, such as Parkinson's disease, caused by destruction of dopaminergic neurons within a particular region of the brain, or diabetes mellitus, in which pancreatic insulin-secreting cells are selectively destroyed, could be treated by the transplantation of differentiated derivatives of ES cells. Important steps toward successful development of an ES cell-based therapy include the establishment of a protocol that would allow for ES cells to differentiate into a particular cell type of interest and a means by which such a lineage of cells could be separated from the mixed population and enriched. The present results have demonstrated that mouse ES cells can give rise to insulin-secreting cells in vitro, and that DTZ staining is a valuable method to specifically identify insulin-producing cells from mixed preparations of differentiated ES derivatives.
DTZ is a zinc-binding substance, and pancreatic islets from such animal species as mouse, dog, pig, and human are known to be stained crimson red by its treatment, because of their higher zinc contents compared with other tissues [2729]. Therefore, DTZ staining is recognized as a valuable part of a possible approach to harvest human pancreatic islets from cadaveric donors as well as those with nonbeating hearts [30, 31]. Zinc is required in pancreatic ß cells for packaging insulin, an integral part of insulin crystals for 2-Zn-insulin hexamer, as well as free ionized zinc in the extragranular space that acts as a reservoir for granular zinc [42, 43]. We took advantage of these zinc pools to identify cells harboring insulin-production ability that were in the mouse EB culture outgrowths and found emerging cellular clusters that were stained crimson red by DTZ in mixed populations of ES derivatives. These DTZ-stained clusters were immunoreactive for and secreted insulin. Using RT-PCR analyses, we observed that they expressed various genes related to pancreatic islets including PDX1, proinsulin 1, proinsulin 2, glucagon, and PP, suggesting that they contained pancreatic endocrine cells such as insulin-producing ß cells, glucagon-producing
cells, and PP-producing cells. Furthermore, they expressed GLUT2 and IGRP. GLUT2 is an essential gene that plays an important role in pancreatic ß-cell functions, including glucose-stimulated insulin secretion [34, 35], while IGRP is a newly cloned islet-specific gene encoding the catalytic subunit of glucose-6-phosphatase, a multicomponent system located in the endoplasmic reticulum that comprises a catalytic subunit and transporters for glucose-6-phosphate, inorganic phosphate, and glucose [36, 37]. Based on the variety of gene expression seen, including GLUT2 and IGRP, we believe that it was unlikely that the DTZ-stained clusters were of extraembryonic origin and unrelated to pancreatic islets. Although mRNA for somatostatin was not detected by RT-PCR in the DTZ-stained clusters, it is unclear, because of the failed detection in isolated pancreatic islets, whether these clusters actually did not contain somatostatin-producing
cells.
The fundamental role of pancreatic ß cells is the secretion of insulin in response to glucose. In the present study, we successfully demonstrated the secretion of insulin from ES derivatives using ELISA. We considered that it was probably the DTZ-stained cells that secreted insulin into the culture supernatants because they were immunoreactive to insulin. However, an increase in insulin secretion was not observed in response to high concentrations of glucose. The lack of glucose dose dependency in insulin secretion may have been due to the high concentration of glucose present in DMEM, 4.5 mg/ml (25 mM), in which the ES cells were maintained and allowed to differentiate until the insulin detection assay.
In the present study, we demonstrated that DTZ-stained clusters contained the cellular components that secreted insulin. However, the DTZ-positive cellular fraction accounted for only a small percentage of the chaotically differentiated ES cells. To examine the potential of those ES cell-derived DTZ-positive cells to function in vivo or to normalize glycemia in streptozocin-induced diabetic mice, the isolation and enrichment of such presumed insulin-producing cells from the mixed population of differentiated ES cells is required. For this purpose, cell sorting by a flow cytometer may be useful. DTZ produces fluorescence when dissolved in DMSO, but its fluorescence fades too quickly for reliable sorting [44]. Recently, a new specific zinc-fluorescent probe, Newport Green, has been reported to be easy, rapid, specific, and nontoxic to insulin-producing cells [45]. Instead of DTZ, the use of Newport Green may be helpful for the purification and collection of insulin-producing cells from in vitro differentiated ES derivatives by cell sorting.
Recently, in vitro differentiation of mouse and human ES cells into insulin-producing cells has been demonstrated [22, 23, 26]. However, specific differentiation of ES cells into a certain definite cell type, such as insulin-producing cells, has not yet been accomplished, though there is a recent report documenting a step-by-step protocol for the high-yield generation of pancreatic islets from mouse ES cells [23]. Therefore, a reliable procedure for identifying the cellular population of interest from ES derivatives in culture is required for successful cell transplantation therapy strategies that use ES cells. In the present study, we demonstrated that DTZ-stained clusters contained the cellular components that secreted insulin. This method is a reliable means of labeling living cells in the visible spectrum, and the use of a zinc-sensitive fluorescent probe for cell sorting may be promising for both clinical and research purposes.
 |
ACKNOWLEDGMENT
|
|---|
This work was supported by research grants-in-aid from the Ministry of Education, Science, and Culture of Japan.
 |
REFERENCES
|
|---|
- Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature
1981;292:154156.[CrossRef][Medline]
- Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA
1981;78:76347638.[Abstract/Free Full Text]
- Robertson EJ. Embryo-derived stem cell lines. In: Robertson EJ, ed. Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, First Edition. Washington, DC: IRL Press, 1987:71-112.
- Keller GM. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol
1995;7:862869.[CrossRef][Medline]
- Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science
1998;282:11451147.[Abstract/Free Full Text]
- Odorico JS, Kaufman DS, Thomson JA. Multilineage differentiation from human embryonic stem cell lines. STEM CELLS
2001;19:193204.[Abstract/Free Full Text]
- Brendel M, Hering B, Schulz A et al. International Islet Transplant Registry Report. Giessen, Germany: University of Giessen, 1999:1-20.
- Linetsky E, Bottino R, Lehmann R et al. Improved human islet isolation using a new enzyme blend, liberase. Diabetes
1997;46:11201123.[Abstract]
- Shapiro AM, Lakey JR, Ryan EA et al. Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med
2000;343:230238.[Abstract/Free Full Text]
- Klug MG, Soonpaa MH, Koh GY et al. Genetically selected cardiomyocytes from differentiating embryonic stem cells form stable intracardiac grafts. J Clin Invest
1996;98:216224.[Medline]
- Ng WA, Doetschman T, Robbins J et al. Muscle isoactin expression during in vitro differentiation of murine embryonic stem cells. Pediatr Res
1997;41:285292.[Medline]
- Drab M, Haller H, Bychkov R et al. From totipotent embryonic stem cells to spontaneously contracting smooth muscle cells: a retinoic acid and db-cAMP in vitro differentiation model. FASEB J
1997;11:905915.[Abstract]
- Yamada T, Yoshikawa M, Takaki M et al. In vitro functional gut-like organ formation from mouse embryonic stem cells. STEM CELLS
2002;20:4149.[Abstract/Free Full Text]
- Bain G, Kitchens D, Yao M et al. Embryonic stem cells express neuronal properties in vitro. Dev Biol
1995;168:342357.[CrossRef][Medline]
- Brustle O, Jones KN, Learish RD et al. Embryonic stem cell-derived glial precursors: a source of myelinating transplants. Science
1999;285:754756.[Abstract/Free Full Text]
- McDonald JW, Liu XZ, Qu Y et al. Transplanted embryonic stem cells survive, differentiate and promote recovery in injured rat spinal cord. Nat Med
1999;5:14101412.[CrossRef][Medline]
- Lee S-H, Lumelsky N, Studer L et al. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat Biotechnol
2000;18:675679.[CrossRef][Medline]
- Potocnik AJ, Kohler H, Eichmann K. Hemato-lymphoid in vivo reconstitution potential of subpopulations derived from in vitro differentiated embryonic stem cells. Proc Natl Acad Sci USA
1997;94:1029510300.[Abstract/Free Full Text]
- Ling V, Neben S. In vitro differentiation of embryonic stem cells: immunophenotypic analysis of cultured embryoid bodies. J Cell Physiol
1997;171:104115.[CrossRef][Medline]
- Hamazaki T, Iiboshi Y, Oka M et al. Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett
2001;497:1519.[CrossRef][Medline]
- Yamada T, Yoshikawa M, Kanda S et al. In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green. STEM CELLS
2002;20:146154.[Abstract/Free Full Text]
- Soria B, Roche E, Berna G et al. Insulin-secreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes
2000;49:157162.[Abstract]
- Lumelsky N, Blondel O, Laeng P et al. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science
2001;292:13891394.[Abstract/Free Full Text]
- Schuldiner M, Eiges R, Eden A et al. Induced neuronal differentiation of human embryonic stem cells. Brain Res
2001;913:201205.[CrossRef][Medline]
- Kehat I, Kenyagin-Karsenti D, Snir M et al. Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest
2001;108:407414.[CrossRef][Medline]
- Assady S, Maor G, Amit M et al. Insulin production by human embryonic stem cells. Diabetes
2001;50:16911697.[Abstract/Free Full Text]
- Latif ZA, Noel J, Alejandro R. A simple method of staining fresh and cultured islets. Transplantation
1988;45:827830.[Medline]
- Clark SA, Borland KM, Sherman SD et al. Staining and in vitro toxicity of dithizone with canine, porcine, and bovine islets. Cell Transplant
1994;3:299306.[Medline]
- Shewade YM, Umrani M, Bhonde RR. Large-scale isolation of islets by tissue culture of adult mouse pancreas. Transplant Proc
1999;31:17211723.[CrossRef][Medline]
- Fiedor P, Walaszewski J, Oluwole SF et al. A novel approach to in vivo visualization of human pancreatic islets. Transplant Proc
1996;28:3514.[Medline]
- Miyamoto M, Inoue K, Gu Y et al. Improved large-scale isolation of breeder porcine islets: possibility of harvesting from nonheart-beating donor. Cell Transplant
1998;7:397402.[CrossRef][Medline]
- Madsen OD, Jensen J, Petersen HV et al. Transcription factors contributing to the pancreatic beta-cell phenotype. Horm Metab Res
1997;29:265270.[Medline]
- McKinnon CM, Docherty K. Pancreatic duodenal homeobox-1, PDX-1, a major regulator of beta cell identity and function. Diabetologia
2001;44:12031214.[CrossRef][Medline]
- Guillam MT, Dupraz P, Thorens B. Glucose uptake, utilization, and signaling in GLUT2-null islets. Diabetes
2000;49:14851491.[Abstract]
- Thorens B, Guillam MT, Beermann F et al. Transgenic reexpression of GLUT1 or GLUT2 in pancreatic beta cells rescues GLUT2-null mice from early death and restores normal glucose-stimulated insulin secretion. J Biol Chem
2000;275:2375123758.[Abstract/Free Full Text]
- Arden SD, Zahn T, Steegers S et al. Molecular cloning of a pancreatic islet-specific glucose-6-phosphatase catalytic subunit-related protein. Diabetes
1999;48:531542.[Abstract]
- Ebert DH, Bischof LJ, Streeper RS et al. Structure and promoter activity of an islet-specific glucose-6-phosphatase catalytic subunit-related gene. Diabetes
1999;48:543551.[Abstract]
- Hooper M, Hardy K, Handyside A et al. HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature
1987;326:292295.[CrossRef][Medline]
- Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet
2000;24:372376.[CrossRef][Medline]
- Gotoh M, Maki T, Kiyoizumi T et al. An improved method for isolation of mouse pancreatic islets. Transplantation
1985;40:437438.[Medline]
- Liu ZZ, Kumar A, Ota K et al. Developmental regulation and the role of insulin and insulin receptor in metanephrogenesis. Proc Natl Acad Sci USA
1997;94:67586763.[Abstract/Free Full Text]
- Dodson G, Steiner D. The role of assembly in insulin's biosynthesis. Curr Opin Struct Biol
1998;8:189194.[CrossRef][Medline]
- Chausmer AB. Zinc, insulin and diabetes. J Am Coll Nutr
1998;17:109115.[Abstract/Free Full Text]
- Jiao L, Gray DW, Gohde W et al. In vitro staining of islets of Langerhans for fluorescence-activated cell sorting. Transplantation
1991;52:450452.[Medline]
- Lukowiak B, Vandewalle B, Riachy R et al. Identification and purification of functional human beta-cells by a new specific zinc-fluorescent probe. J Histochem Cytochem
2001;49:519528.[Abstract/Free Full Text]
Received on December 13, 2001;
accepted for publication on March 17, 2002.
This article has been cited by other articles:

|
 |

|
 |
 
I. Drobinskaya, T. Linn, T. Saric, R. G. Bretzel, H. Bohlen, J. Hescheler, and E. Kolossov
Scalable Selection of Hepatocyte- and Hepatocyte Precursor-Like Cells from Culture of Differentiating Transgenically Modified Murine Embryonic Stem Cells
Stem Cells,
September 1, 2008;
26(9):
2245 - 2256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Mfopou, V. De Groote, X. Xu, H. Heimberg, and L. Bouwens
Sonic Hedgehog and Other Soluble Factors from Differentiating Embryoid Bodies Inhibit Pancreas Development
Stem Cells,
May 1, 2007;
25(5):
1156 - 1165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Okuno, K. Minami, A. Okumachi, K. Miyawaki, N. Yokoi, S. Toyokuni, and S. Seino
Generation of insulin-secreting cells from pancreatic acinar cells of animal models of type 1 diabetes
Am J Physiol Endocrinol Metab,
January 1, 2007;
292(1):
E158 - E165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Herrera, S. Bruno, S. Buttiglieri, C. Tetta, S. Gatti, M. C. Deregibus, B. Bussolati, and G. Camussi
Isolation and Characterization of a Stem Cell Population from Adult Human Liver
Stem Cells,
December 1, 2006;
24(12):
2840 - 2850.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tayaramma, B. Ma, M. Rohde, and H. Mayer
Chromatin-Remodeling Factors Allow Differentiation of Bone Marrow Cells into Insulin-Producing Cells
Stem Cells,
December 1, 2006;
24(12):
2858 - 2867.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Narang and R. I. Mahato
Biological and biomaterial approaches for improved islet transplantation.
Pharmacol. Rev.,
June 1, 2006;
58(2):
194 - 243.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Minami, M. Okuno, K. Miyawaki, A. Okumachi, K. Ishizaki, K. Oyama, M. Kawaguchi, N. Ishizuka, T. Iwanaga, and S. Seino
Lineage tracing and characterization of insulin-secreting cells generated from adult pancreatic acinar cells
PNAS,
October 18, 2005;
102(42):
15116 - 15121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. K.C. Brolen, N. Heins, J. Edsbagge, and H. Semb
Signals From the Embryonic Mouse Pancreas Induce Differentiation of Human Embryonic Stem Cells Into Insulin-Producing {beta}-Cell-Like Cells
Diabetes,
October 1, 2005;
54(10):
2867 - 2874.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Shi, L. Hou, F. Tang, W. Jiang, P. Wang, M. Ding, and H. Deng
Inducing Embryonic Stem Cells to Differentiate into Pancreatic {beta} Cells by a Novel Three-Step Approach with Activin A and All-Trans Retinoic Acid
Stem Cells,
May 1, 2005;
23(5):
656 - 662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Wobus and K. R. Boheler
Embryonic Stem Cells: Prospects for Developmental Biology and Cell Therapy
Physiol Rev,
April 1, 2005;
85(2):
635 - 678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. J Burns, S. J Persaud, and P. M Jones
Stem cell therapy for diabetes: do we need to make beta cells?
J. Endocrinol.,
December 1, 2004;
183(3):
437 - 443.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. T. Ku, N. Zhang, A. Kubo, R. O'Connor, M. Mao, G. Keller, and J. S. Bromberg
Committing Embryonic Stem Cells to Early Endocrine Pancreas In Vitro
Stem Cells,
December 1, 2004;
22(7):
1205 - 1217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hansson, A. Tonning, U. Frandsen, A. Petri, J. Rajagopal, M. C.O. Englund, R. S. Heller, J. Hakansson, J. Fleckner, H. N. Skold, et al.
Artifactual Insulin Release From Differentiated Embryonic Stem Cells
Diabetes,
October 1, 2004;
53(10):
2603 - 2609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. T. Clark, M. S. Bodnar, M. Fox, R. T. Rodriquez, M. J. Abeyta, M. T. Firpo, and R. A. R. Pera
Spontaneous differentiation of germ cells from human embryonic stem cells in vitro
Hum. Mol. Genet.,
April 1, 2004;
13(7):
727 - 739.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Nishimura, M. Yoshikawa, S. Kanda, M. Nonaka, H. Yokota, A. Shiroi, H. Nakase, H. Hirabayashi, Y. Ouji, J.-I. Birumachi, et al.
Potential Use of Embryonic Stem Cells for the Treatment of Mouse Parkinsonian Models: Improved Behavior by Transplantation of In Vitro Differentiated Dopaminergic Neurons from Embryonic Stem Cells
Stem Cells,
March 1, 2003;
21(2):
171 - 180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Rajagopal, W. J. Anderson, S. Kume, O. I. Martinez, and D. A. Melton
Insulin Staining of ES Cell Progeny from Insulin Uptake
Science,
January 17, 2003;
299(5605):
363 - 363.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hori, I. C. Rulifson, B. C. Tsai, J. J. Heit, J. D. Cahoy, and S. K. Kim
Growth inhibitors promote differentiation of insulin-producing tissue from embryonic stem cells
PNAS,
December 10, 2002;
99(25):
16105 - 16110.
[Abstract]
[Full Text]
[PDF]
|
 |
|