Stem Cells 2003;21:171-180
www.StemCells.com
© 2003 AlphaMed Press
Potential Use of Embryonic Stem Cells for the Treatment of Mouse Parkinsonian Models: Improved Behavior by Transplantation of In Vitro Differentiated Dopaminergic Neurons from Embryonic Stem Cells
Fumihiko Nishimuraa,b,
Masahide Yoshikawaa,
Seiji Kandaa,
Masahiro Nonakab,
Hiroshi Yokotab,
Akira Shiroia,
Hiroyuki Nakaseb,
Hidehiro Hirabayashib,
Yukiteru Oujia,
Jun-Ichi Birumachia,
Shigeaki Ishizakaa,
Toshisuke Sakakib
a Departments of Parasitology and
b Neurosurgery, Nara Medical University, Nara, Japan
Key Words. Parkinsons disease • ES cells • Transplantation • Apomorphine-induced rotational behavior • Tyrosine hydroxylase
Correspondence:
Masahide Yoshikawa, M.D., Division of Developmental Biology, Department of Parasitology, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521, Japan. Telephone: 81-744-22-3051 x2250; Fax: 81-744-24-7122; e-mail: myoshika{at}nmu-gw.naramed-u.ac.jp
 |
ABSTRACT
|
|---|
Background and Aims. The purpose of the present study was to examine the efficacy of transplantation of mouse embryonic-stem-(ES)-cell-derived tyrosine hydroxylase-positive (TH+) cells into Parkinsonian mice using behavioral tests and immunohistochemical evaluation.
Methods. Undifferentiated ES cells carrying the enhanced green fluorescent protein (EGFP) gene were differentiated into a cell population containing TH+ neurons using a five-step in vitro differentiation method. These ES-cell-derived cells were used as allografts in Parkinsonian mice, made by administering injections of 6-hydroxydopamine (6-OHDA). Fifteen hemiparkinsonian mice were divided into three groups. Four weeks after 6-OHDA injection, mice in groups 1, 2, and 3 received phosphate-buffered saline, 1 x 104 graft cells, and 1 x 105 graft cells, respectively, into their dopamine-denervated striata.
Results. Improved rotational behavior was observed in the graft-transplanted groups (groups 2 and 3) 2 weeks after transplantation. Mice in group 2 displayed a continuous maintenance of reduced rotational behavior, while those in group 3 showed ipsilateral rotation toward the lesioned side at 4, 6, and 8 weeks after transplantation. Tumor formation was observed in one mouse in group 3. TH+ cells were found at the grafted sites 8 weeks after transplantation in mice in groups 2 and 3, some of which were immunopositive to GFP, demonstrating the presence of dopaminergic neurons derived from the ES cells.
Conclusion. Transplantation of in vitro differentiated ES cells changed rotational behavior in Parkinsonian mice. Our results suggest the potential availability of ES cells for Parkinsons disease.
 |
INTRODUCTION
|
|---|
Parkinsons disease (PD) is a neurodegenerative disorder characterized by the progressive loss of dopaminergic neurons in the substantia nigra pars compacta and a reduction in striatal dopamine [16]. Patients initially respond to treatment with dopaminergic medications such as levodopa [7], however, their effectiveness gradually diminishes because the conversion to dopamine within the brain is progressively disturbed by a continuous degeneration of the dopaminergic terminals. As a result, after approximately 10 years of dopamine-replacement treatment, most patients with PD suffer from disability that cannot be satisfactorily controlled [8].
An alternative approach for restoration of the damaged dopaminergic system, considered to be an ultimate treatment for PD, is transplantation of cells (or tissues) that synthesize catecholamines [913]. Clinical trials of transplantation using human fetal nigral tissues have shown symptomatic relief [1425], however, technical and ethical difficulties in obtaining sufficient and appropriate graft tissues have limited the application of this therapy [26].
Embryonic stem (ES) cells are clonal cell lines derived from the inner cell mass of developing blastocysts [2730]. The distinguishing features of these cells are their capacities to renew themselves and to differentiate into a broad spectrum of derivatives of all three embryonic germ layers: ectoderm, mesoderm, and endoderm [3133]. The differentiation of mouse ES cells into dopaminergic neurons has already been reported [3436]. Recently, human ES cell lines were isolated, and their ability for multilineage differentiation, including neural lineage, was demonstrated in vivo and in vitro [3746]. This ability to develop into dopaminergic neurons has drawn clinical attention to ES cells as a novel source for new therapeutic strategies in the treatment of PD, such as cell transplantation and tissue regeneration [47].
Before the era of human ES-cell-based therapy for Parkinsons disease can be realized, the potential usefulness of these cells first must be confirmed in mouse PD models. In the present study, we used mouse ES cells carrying the enhanced green fluorescent protein (EGFP) gene under the control of the CAG expression unit and first differentiated them in vitro into a cell population containing enriched dopaminergic cells according to a previously reported five-step method [34, 35]. We then grafted the ES-cell-derived cells into Parkinsonian mice to examine the efficacy of ES-cell-based cell transplantation therapy using behavioral tests and immunohistochemical evaluation.
 |
MATERIALS AND METHODS
|
|---|
Murine ES Cell Line
We utilized a mouse ES cell line, G4-2 cells (129/SvJ mouse ES cells, a kind gift from Dr. Hitoshi Niwa, RIKEN Center for Developmental Biology; Kobe, Japan; http://www.cdb.riken.go.jp/english/index.html) [48, 49]. The G4-2 ES cells were derived from EB3 ES cells and carried the EGFP gene under the control of the CAG expression unit. The EB3 cells were a subline derived from E14tg2a ES cells [5052] and carried the blasticidin-S-resistant selection marker gene driven by the Oct-3/4 promoter (active under undifferentiated status) [49]. Undifferentiated G4-2 ES cells were maintained on gelatin-coated dishes without feeder cells in Dulbeccos modified Eagles medium (Sigma; St. Louis, MO; http://www.sigmaaldrich.com) supplemented with 10% fetal bovine serum (FBS; GIBCO/BRL; Grand Island, NY; http://www.invitrogen.com), 0.1 mM 2-mercaptoethanol (Sigma), 10 mM nonessential amino acids (GIBCO/BRL), 1 mM sodium pyruvate (Sigma), and 1,400 U/ml of leukemia inhibitory factor (LIF; GIBCO/BRL). G4-2 cells were occasionally cultured in medium containing 10 µg/ml of blasticidin S to eliminate differentiated cells [49].
Generation of TH+ Populations from Undifferentiated ES Cells In Vitro
In vitro differentiation of ES cells into TH+ neurons was carried out as previously described with minor modifications (Fig. 1
) [35]. Undifferentiated ES cells (stage 1) were dissociated into single-cell suspensions and then cultured in hanging drops to induce embryoid body (EB) formation at an initial cell density of 500 cells per drop (15 µl) of ES cell medium in the absence of LIF (stage 2) [29, 33]. After 4 days, the resulting EBs were plated onto plastic 100-mm gelatin-coated dishes and allowed to attach for the outgrowth culture. After 24 hours of culture, selection of nestin+ cells was initiated by replacing the ES cell medium with serum-free insulin/transferrin/selenium/fibronectin medium (GIBCO/BRL) (stage 3) [34]. After 6-10 days of selection, cell expansion was initiated in N2 medium (GIBCO/BRL), supplemented with 1 µg/ml of laminin and 10 ng/ml of basic fibroblast growth factor (bFGF) (R&D Systems; Minneapolis, MN; http://www.rndsystems.com) in the presence of the murine N-terminal fragment of sonic hedgehog (Shh) (500 ng/ml) and murine FGF8 isoform b (100 ng/ml) (both from R&D Systems). Shh and FGF8 were used in stage 4 to increase the proportion of dopaminergic neurons because Shh and FGF8 have been shown to promote ventral midbrain fates [53]. Nestin+ cells were then grown for 6 days (stage 4). Differentiation was induced by removing bFGF and culturing for 6-15 days in N2 medium supplemented with laminin (1 µg/ml) and ascorbic acid (200 µM) (stage 5).

View larger version (41K):
[in this window]
[in a new window]
|
Figure 1. General scheme of in vitro ES cell culture. TH+ populations were generated from undifferentiated ES cells by a five-step in vitro differentiation method. ITSFn = insulin/transferrin/selenium/fibronectin.
|
|
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR) Analysis
Total cellular RNA was prepared using the acid guanidinium thiocyanate-phenol-chloroform method. Two micrograms of DNase-treated total RNA were used for the first-strand cDNA. This reaction was performed using Super Script II and random hexanucleotide, following the protocol of the manufacturer (GIBCO/BRL). cDNA samples were subjected to PCR amplification with specific primers under linear conditions in order to reflect the original amount of the specific transcript. The cycling parameters were as follows: denaturation at 94°C for 1 minute, annealing at 55°-64°C (depending on the primer) for 1 minute, and elongation at 72°C for 1 minute (40 cycles). The PCR primers and the length of the amplified products were as follows: ß-actin (CTGAAGTACCCCATTGAACATGGC, CAGAGCAGTAATCTCCTTCTGCAT, 761 bp); nestin (GGTCTCCCTCGAATCTCTC, GATCCAGGCAGCTCCCATT, 1,037 bp); microtubule-associated protein 2 (MAP2) (TCAGACTTCCACCGAGCAG, AGGGGAAAGATCATGGCCC, 774 bp); tyrosine hydroxylase (TH) (GGCTGTGGTATTCGAGGAG, GTGAGGAGGCATGACGGAT, 733 bp), and glial fibrillary acidic protein (GFAP) (TCGAATGACTCCTCCACTCCCT, TGGCCTTCTGACACGGATTTGG, 1,088 bp).
Immunocytochemistry for TH, MAP2, GFAP, and Nestin In Vitro
Cells were fixed in 4% paraformaldehyde, and immunocytochemistry was carried out using standard protocols. Antibodies and dilutions used were mouse anti-TH monoclonal antibodies at 1:1,000 (Sigma), mouse anti-MAP2 monoclonal antibodies at 1:200 (Sigma), rabbit anti-GFAP polyclonal antibodies at 1:200 (Sigma), mouse anti-nestin monoclonal antibodies at 1:500 (Chemicon International, Inc.; Temecula, CA; http://www.chemicon.com), and rhodamine-labeled secondary antibodies at 1:200 (goat anti-mouse IgG affinity purified [Chemicon] or goat anti-rabbit IgG affinity purified [Jackson ImmunoResearch Laboratories Inc.; West Grove, PA; www.jacksonimmuno.com]). All nuclei were stained with DAPI (Dojindo; Kumamoto, Japan).
Animal Preparation
Adult male 129/SvJ mice (10- to 12-weeks old; The Jackson Laboratory; Bar Harbor, ME; http://www.jax.org) were used in this study. Under pentobarbital anesthesia (60 mg/kg i.p.), the mice were placed in a stereotactic frame (Narishige; Tokyo, Japan). The dopamine-innervated striata were unilaterally lesioned by administering injections of 6-hydroxydopamine HCl (6-OHDA) into the left midstriatum (anterior 0.4 mm, lateral 1.8 mm, ventral 3.5 mm), as determined from the bregma and the surface of the skull [54]. Each mouse received 4 µg of 6-OHDA dissolved in 2 µl of physiological saline containing 0.02% ascorbic acid. The solution was infused at a rate of approximately 0.5 µl/minute using a 22-gauge 10-µl microsyringe (MS-N10; Ito Microsyringe; Shizuoka, Japan), with the microsyringe left in position for an additional 4 minutes before retraction. Apomorphine-induced rotational behavior was assessed at 2, 4, 6, 8, 10, and 12 weeks after 6-OHDA injection (Fig. 2
). The mice were placed in individual plastic hemispherical bowls and allowed to habituate for 10 minutes before being injected with a subcutaneous dose of apomorphine (0.6 mg/kg). Rotational behavior was monitored for 30 minutes in a closed room to avoid any environmental disturbance. Fifteen animals that turned contralateral toward the lesioned side at a rate of three or more rotations per minute were selected as Parkinsonian models. All animal procedures were in accordance with our institutional guidelines as well as those of the National Institutes of Health.

View larger version (25K):
[in this window]
[in a new window]
|
Figure 2. Outline of the present study. Fifteen hemiparkinsonian mice were divided into three different treatment groups of five animals each. Four weeks after 6-OHDA injection, group 1 received PBS injected into their dopamine-denervated striata. Group 2 received a suspension of 1 x 104 cells, and group 3 received a suspension of 1 x 105 cells. Graft function was determined by reviewing apomorphine-induced rotation at 2-week intervals for 8 weeks after transplantation. Apomorphine-induced rotational behavior was assessed at 2, 4, 6, 8, 10, and 12 weeks following 6-OHDA injection.
|
|
Experimental Groups
The mice were divided into three groups of five animals each. Four weeks after 6-OHDA injection, mice in group 1 received phosphate-buffered saline (PBS) into their dopamine-denervated striata, mice in group 2 received a suspension of 1 x 104 graft cells, and mice in group 3 received a suspension of 1 x 105 graft cells (Fig. 2
).
Preparation and Transplantation of ES-Cell-Derived TH+ Cells
Cells at stage 5 of in vitro differentiation were trypsinized at 37°C for 5 minutes with 0.25% trypsin, and the dissociated cells were resuspended in PBS. In group 2, a total of 1 x 104 cells in a 2-µl suspension were transplanted into the striatum of each mouse (anterior 0.9 mm, lateral 2.0 mm, ventral 3.0 mm), as determined from the bregma and skull surface. In group 3, a total of 1 x 105 cells in a 2-µl suspension were transplanted into the striatum of each mouse using the same method as above. A waiting period of 4 minutes before the needle was removed allowed the cells to settle. Mouse hosts did not receive any immunosuppression.
Immunohistochemical Analysis of Grafted Brain Cryosections
Eight weeks after transplantation, the grafted mice were anesthetized terminally using an overdose of pentobarbital i.p., after which the brains were removed and post-fixed for 24 hours in 4% paraformaldehyde in PBS at 4°C, and then sectioned. Next, the specimens were equilibrated in 10% sucrose in PBS for 4 hours at 4°C, then in 15% sucrose in PBS for 4 hours at 4°C, and finally in 20% sucrose in PBS overnight at 4°C. Then, they were embedded in OCT compound (Tissue-TEK; Miles; Elkhart, IN) and frozen in liquid nitrogen. Sections were cut into 8-µm thick slices using a cryostat and placed on 3-aminopropyltriethoxysilane-coated slides. After rinsing in PBS, they were incubated overnight at 4°C in anti-TH (1:1,000) and anti-GFP (1:9,000) (Affinity BioReagents, Inc.; Golden, CO) diluted in PBS with 0.1% Triton X-100. The sections were then rinsed in PBS and incubated in media containing fluorescent-labeled secondary antibodies (rhodamine 1:200, fluorescein isothiocyanate [FITC] 1:100; ICN Pharmaceuticals, Inc.; Aurora, OH) in PBS with 0.1% Triton X-100 for 60 minutes at room temperature. After rinsing again in PBS, the sections were mounted and cover-slipped in aqueous permanent mounting medium. Fluorescent staining was evaluated using a laser confocal microscope.
High-Performance Liquid Chromatography (HPLC)
Levels of dopamine and levodopa in culture media were analyzed using reverse-phase HPLC with a 4.6 x 150-mm C-18 column and an analyzer. We used the culture medium of CATH.a cells (a mouse cathecholaminergic cell line established from a brain tumor in a B6D2/F1 mouse) as a positive control for secreted dopamine and levodopa since CATH.a cells are known to produce them [55, 56].
Statistical Analysis
Data were presented as mean ± standard deviation (SD). Statistical analyses were performed using analysis of variance and Fischers protected least significant difference (Stat View 4.0; SAS Institute Inc.; Cary, NC). Students t-tests were used to compare the effect of transplantation with ES-cell-derived TH+ cells in each group at each time point. Differences were considered statistically significant at p < 0.05.
 |
RESULTS
|
|---|
Characterization of Grafts Used for Transplantation
Before transplanting the grafts prepared from undifferentiated ES cells in vitro, we examined whether the employed five-step culture system supported neuronal differentiation and if the cells at stage 5, which were to be used as grafts, truly included dopaminergic neurons. As shown in Figure 3A
, there was no mRNA expression of nestin, MAP2, TH, or GFAP in undifferentiated ES cells. The only protein that was expressed was ß-actin. The mRNA expression of nestin appeared in cultured cells at stage 2, while those of MAP2 and TH were observed in the cells at stage 3. GFAP expression emerged at stage 5, and the presence of TH in the cells at this stage was further confirmed immunohistochemically. The average percentage of TH+ cells in the whole culture was 32.5% ± 4.0% (n > 20 fields containing 1.8 x 103 cells). In some areas of the culture, more than 60% of the cells appearing in the microscopic field were immunopositive for TH, as shown in Figures 1B and 1C
. Additional immunocytochemical evaluations revealed that MAP2+, TH+, GFAP+, and nestin+ cells comprised approximately 80%, 30%, 10%, and 5%, respectively, of the whole cells at stage 5. Furthermore, dopamine and levodopa were detected in the culture supernatants at concentrations of 0.1 ng/ml and 2.9 ng/ml, respectively, by HPLC after a 10-day culture of 2.0 x 106 cells at stage 5 in 10 ml of culture medium in a 100-mm diameter culture dish. They were not detected in the culture supernatant of undifferentiated ES cells. The supernatant of 1 x 105 CATH.a cells contained 1.3 ng/ml of dopamine and 0.4 ng/ml of levodopa after a 2-day culture in a 35-mm diameter dish (3 ml total volume).

View larger version (86K):
[in this window]
[in a new window]
|
Figure 3. Detection of TH expression in cultured cells by RT-PCR and immunocytochemical analysis. A) Expressions of mRNA in cultured cells at each stage by RT-PCR. ß-actin transcripts are shown as an internal reference for amplification of cDNA. B) All nuclei of cultured cells at stage 5 were stained with DAPI (blue). C) Immunocytochemistry for TH in the same cultured cells as seen in B at stage 5 (red). Original magnification x200.
|
|
Effect of Transplantation on Apomorphine-Induced Rotation
Rotational scores are shown in Figure 4
. The control mice (group 1), who received injections of PBS into their dopamine-denervated striata, did not show any improvement. All of the mice in groups 2 and 3, who received grafts, exhibited significantly less rotational behavior than those in group 1 at the first observation point (week 2) after transplantation. The improved rotational behavior was continuously observed in group 2 mice throughout the experimental period; however, those in group 3 showed ipsilateral rotation toward the lesioned side from the fourth week after transplantation, which followed an expected initial 2-week period of improvement in rotational behavior. One mouse in group 3 died on day 42 after transplantation, and a postmortem analysis found a teratoma-like tumor in the graft transplantation area (data not shown).

View larger version (18K):
[in this window]
[in a new window]
|
Figure 4. Apomorphine-induced rotational behavior. Data are presented as mean ± SD. Mice with grafted cells in group 2 and group 3 exhibited significantly less rotational behavior than those in group 1 after transplantation (*p < 0.05). However, mice in group 3 showed ipsilateral rotation toward the lesioned side from 4 weeks after transplantation, which was unexpected. One mouse in group 3 died on day 42 after transplantation.
|
|
Immunohistochemistry Results from Grafted Sites
Histologic samples from the grafted sites at 8 weeks after transplantation in group 2 are shown in Figures 5A, 5B, and 5C
. Some of the cells that were immunopositive for TH were also positive for GFP, demonstrating the presence of dopaminergic neurons derived from the ES cells. No teratoma development was observed in any mice in group 2. In group 3 mice, cells immunopositive for TH were easily found located among the GFP+ cells (Figs. 5D, 5E, and 5F
). Although one mouse in group 3 developed a teratoma-like tumor in the brain, tumor formation was not observed in any of the remaining four mice that survived until the end of the observation time.

View larger version (81K):
[in this window]
[in a new window]
|
Figure 5. Immunohistochemistry at the grafted sites 8 weeks after transplantation. Histological examples of the grafted sites at 8 weeks after transplantation of a low concentration in group 2 (A-C) and of a high concentration in group 3 (D-F). Brain sections were observed under a laser confocal microscope for GFP and TH expression. (A, D) Brain tissue stained for TH (red). (B, E) Brain tissue stained for GFP (green). (C, F) Brain tissue double stained with anti-TH and anti-GFP (yellow). Scale bars in A-C are 50 µm. Scale bars in D-F are 100 µm.
|
|
 |
DISCUSSION
|
|---|
ES cells are continuously growing stem cell lines of embryonic origin. Their distinguishing features are a capacity to be maintained in culture indefinitely in an undifferentiated state and an ability to develop into multilineage cells [3133]. As a result, ES cells are thought to be an optimal cell source for cell-replacement therapy, with PD considered to be one of the most suitable diseases for cell transplantation. Human ES cells recently have been isolated, and as many as 78 cell lines are now registered at the National Institutes of Health (http://escr.nih.gov). It is expected that the use of ES cells will overcome some of the problems encountered in PD treatment, such as the low availability of human fetal tissues.
In the present study, we used cells from a mouse ES-cell-derived population as allografts for unilaterally dopamine-denervated mice. Although in vitro differentiation of ES cells generally gives rise to a variety of cell types, Okabe et al. and Lee et al. reported a five-step differentiation method in vitro that yields an efficient generation of dopamine neurons from undifferentiated mouse ES cells [34, 35]. We adopted this protocol for preparing the graft cells used in the present study, as the presence of dopamine neurons in the grafts and their subsequent production of dopamine are critical factors for the improvement of rotational behavior in PD model mice. We first examined whether the cells to be grafted expressed TH and produced dopamine. We detected mRNA expression and TH protein production in the cells at stage 5 (Fig. 3
). Secreted levodopa and dopamine were also detected by HPLC in the supernatant of cultured stage 5 cells. Therefore, we speculated that differentiated cells from an undifferentiated ES cell population could be used as grafts for the treatment of PD model mice. Although TH+ cells only amounted to 32.5% of those at stage 5, we used whole fractions of the cells from that stage as grafts.
As expected, a significant reduction in rotational behavior was observed 2 weeks after transplantation in all mice who received grafts. Further, those in group 2 showed steadily reduced rotational behavior at every observation point after transplantation. However, mice in group 3 demonstrated ipsilateral rotation toward the lesioned side, which was unexpected, following a transient improvement in contralateral rotation. In addition, one mouse in group 3 died, probably due to a teratoma that had developed in its brain. Although the precise mechanism of this ipsilateral rotation phenomenon is unknown, we considered two possibilities. First, an excess number of grafted cells may have led to a destruction of dopamine receptors due to a mass effect of the grafts themselves or developing tumors. Second, an excess number of cells used as grafts may have caused the dopamine receptors to downregulate because of overactivity [57]. We did not perform any experiments to examine dopamine receptors in the present study; however, it was previously demonstrated that these receptors became upregulated in the lesioned area of dopamine-innervated striatum that unilaterally received injections of 6-OHDA [5861]. We describe our speculation regarding the change in the nigrostriatal pathway in Figure 6
. As a result of the receptor upregulation (Fig. 6A
, lower), apomorphine, a dopamine agonist, may stimulate a greater number of dopamine receptors in the lesioned side than in the intact side, leading to a contralateral rotation toward the lesioned side, which was also seen in group 1 mice (Fig. 6B
, left). A more moderate number of grafted cells may cause the activated dopamine receptors to normalize, with a decrease in apomorphine-induced rotation as the result, as seen in group 2 (Fig. 6B
, middle). In contrast, a large number of grafted cells may cause a decrease in dopamine receptor activity as a reaction to their overproduction of dopamine, leading to relative hyperactivity after exposure to apomorphine in the intact side (Fig. 6B
, right). Similarly, in human trials of fetal cell transplantation, overactivity or overgrowth of transplanted cells is speculated to be the cause of the development of dystonia and dyskinesia (excess movement), which have appeared later in some patients [23]. Although it is difficult to determine the optimal number of dopamine neurons to be transplanted, we considered that the number of cells used in group 3 in the present study (1 x 105 cells per mouse) was excessive for the PD model mice.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 6. Hypothetical mechanism describing the change in the nigrostriatal pathway. A normal nigrostriatal pathway (A upper) and a unilaterally degenerated nigrostriatal pathway (A lower). (B left) Dopamine receptors are increased (upregulated) in the 6-OHDA treated striatum. Apomorphine, a dopamine agonist, stimulates a greater number of dopamine receptors in the lesioned side than in the intact side, which leads to contralateral rotation toward the lesioned side, as seen in group 1. (B middle) A moderate number of grafted cells causes the increased dopamine receptors to normalize and decreases the apomorphine-induced rotation, as seen in group 2. (B right) Overactivity of the transplanted cells results in a remarkable decrease in dopamine receptors (downregulation) and causes an imbalance of apomorphine-induced relative hyperactivity in the intact side.
|
|
To achieve a successful outcome with ES-cell-based therapy, one of the critical concerns is prevention of the formation of ES-cell-derived tumors. In the present study, one mouse in group 3, which received a large number of ES-cell-derived cells, developed a teratoma in the brain, whereas no tumors were found in any mice in group 2, which received a smaller number of ES-cell-derived cells (1 x 104 cells per mouse). These findings imply that the in-vitro-prepared grafts contained a small population of undifferentiated immature cells, even after incubation in a dopamine neuron-oriented culture for more than 21 days. Therefore, the quality and quantity of grafted cells must be strictly controlled on the basis of differentiated mature cells to avoid neoplastic growth in vivo. We retrospectively investigated whether 1 x 105 cells at stage 5 included undifferentiated cells by attempting to detect Oct-3/4 mRNA by RT-PCR. Contrary to the observation of teratoma formation in vivo, Oct-3/4 mRNA was not seen in repeated experiments except for one (data not shown), suggesting that the fraction of undifferentiated cells was an almost undetectable trace, yet was capable of eliciting tumorgenicity.
We also speculated that undifferentiated immature cells must have been included in the population of TH cells that accounted for nearly 70% of the grafted cells in our study. Thus, we consider that the use of an enriched preparation of TH+ neurons can minimize the risk of teratoma formation. Recently, it was reported that the transplantation of a small number of partially differentiated mouse ES cells from embryoid bodies into rat striatum areas resulted in the generation of dopamine neurons [62]. Those authors hypothesized that undifferentiated or partially differentiated ES cells decreased their cell-to-cell contact, while influence from the host striatum increased when cells were implanted in low numbers, thus allowing neuronal differentiation. We agree that undifferentiated ES cells may develop into a terminally differentiated cell type in implanted sites in the body; however, the high risk of ES-cell-derived tumor development cannot be avoided as long as native or insufficiently differentiated lineage-unrestricted ES cells are used as grafts.
Therefore, methods of in vitro differentiation for enriching dopamine neurons from ES cells should be established. Kawasaki et al. reported the in vitro induction of undifferentiated ES cells into neural cells, including midbrain TH+ dopamine neurons, using stromal cells, and referred to the process as a stromal-cell-derived inducing activity (SDIA) method [36, 63]. The percentages of induced neural colonies by this SDIA method were reported to be 92% from mouse ES cells and 45% from primate ES cells. In addition, Kim et al. also reported success in the efficient induction of TH+ neurons by applying a five-step culture method to genetically modified ES cells [64]. According to that report, nearly 80% of the cells at stage 5 could be differentiated into TH+ neurons when Shh and FGF8 were present at stage 4. Furthermore, they transplanted their stage 5 cells into a rodent model of Parkinsons disease, and their results demonstrated functional integration of ES-cell-derived dopamine neurons into host tissue and behavioral improvement without tumor formation in the brain.
In the present study, the implanted grafts contained a mixed cellular population composed of cells other than TH+ neurons, such as nestin+, GFAP-expressing, and possibly undifferentiated ES cells. Although this heterogeneity brought a risk of tumor development, the grafts induced behavioral changes in apomorphine-induced rotation in all of the transplanted mice.
 |
CONCLUSION
|
|---|
We induced mouse ES cells to differentiate in vitro into a population that contained dopamine neurons using a stepwise method. Transplantation of the ES-cell-derived cells affected apomorphine-induced rotational behavior. Mice who received a smaller number of cells as grafts showed a partial recovery (decrease in contralateral rotation) without tumor formation. In contrast, those who received a larger amount showed unexpected ipsilateral rotation, and tumor formation was observed in one of the five mice in that group. Additional studies are required to assess the efficacy and safety of ES-cell-based cell transplantation therapy for Parkinsons disease; however, portions of our results suggest the potential use of ES cells.
 |
ACKNOWLEDGMENT
|
|---|
The authors thank Dr. Hitoshi Niwa for providing the 129/SvJ mouse ES cells and Dr. Manabu Maeda for his assistance with the histological analysis.
 |
REFERENCES
|
|---|
- Hornykiewicz O. Dopamine (3-hydroxytyramine) and brain function. Pharmacol Rev 1966;18:925964.[Abstract/Free Full Text]
- Bernheimer H, Birkmayer W, Hornykiewicz O et al. Brain dopamine and the syndromes of Parkinson and Huntington: clinical, morphological and neurochemical correlations. J Neurol Sci 1973;20:415455.[CrossRef][Medline]
- Nagatsu T, Yamaguchi T, Rahman MK et al. Catecholamine-related enzymes and the biopterin cofactor in Parkinsons disease and related extrapyramidal diseases. Adv Neurol 1984;40:467473.[Medline]
- Agid Y, Javoy-Agid F, Ruberg M. Biochemistry of neurotransmitter in Parkinsons disease. In: Marsden CD, Fahn S, eds. Movement Disorder, Volume 2. London: Butterworths, 1987:166-230.
- Kish SJ, Shannak K, Hornykiewicz O. Uneven pattern of dopamine loss in the striatum of patients with idiopathic Parkinsons disease: pathophysiologic and clinical implications. N Engl J Med 1988;318:876880.[Abstract]
- Damier P, Hirsch EC, Agid Y et al. The substantia nigra of the human brain. II. Patterns of loss of dopamine-containing neurons in Parkinsons disease. Brain 1999;122:14371448.[Abstract/Free Full Text]
- Cotzias CG, Van Woert MH, Schiffer LM. Aromatic amino acids and modification of parkinsonism. N Engl J Med 1967;276:374379.
- Olanow CW, Tatton WG. Etiology and pathogenesis of Parkinsons disease. Annu Rev Neurosci 1999;22:123144.[CrossRef][Medline]
- Backlund EO, Granberg PO, Hamberger B et al. Transplantation of adrenal medullary tissue to striatum in parkinsonism. First clinical trials. J Neurosurg 1985;62:169173.[Medline]
- Madrazo I, León V, Torres C et al. Transplantation of fetal substantia nigra and adrenal medulla to the caudate nucleus in two patients with Parkinsons disease. N Engl J Med 1988;318:51.[Medline]
- Lindvall O. Transplantation into the human brain: present status and future possibilities. J Neurol Neurosurg Psychiatry 1989;(suppl):3954.
- Date I, Imaoka T, Miyoshi Y et al. Chromaffin cell survival and host dopaminergic fiber recovery in a patient with Parkinsons disease treated by cografts of adrenal medulla and pretransected peripheral nerve. Case report. J Neurosurg 1996;84:685689.[Medline]
- Deacon T, Schumacher J, Dinsmore J et al. Histological evidence of fetal pig neural cell survival after transplantation into a patient with Parkinsons disease. Nat Med 1997;3:350353.[CrossRef][Medline]
- Mahowald MB, Areen J, Hoffer BJ et al. Transplantation of neural tissue from fetuses. Science 1987;235:13071308.[CrossRef][Medline]
- Spencer DD, Robbins RJ, Naftolin F et al. Unilateral transplantation of human fetal mesencephalic tissue into the caudate nucleus of patients with Parkinsons disease. N Engl J Med 1992;327:15411548.[Abstract]
- Freed CR, Breeze RE, Rosenberg NL et al. Survival of implanted fetal dopamine cells and neurologic improvement 12 to 46 months after transplantation for Parkinsons disease. N Engl J Med 1992;327:15491555.[Abstract]
- Kordower JH, Freeman TB, Snow BJ et al. Neuropathological evidence of graft survival and striatal reinnervation after the transplantation of fetal mesencephalic tissue in a patient with Parkinsons disease. N Engl J Med 1995;332:11181124.[Abstract/Free Full Text]
- Olanow CW, Kordower JH, Freeman TB. Fetal nigral transplantation as a therapy for Parkinsons disease. Trends Neurosci 1996;19:102109.[CrossRef][Medline]
- Kordower JH, Freeman TB, Chen EY et al. Fetal nigral grafts survive and mediate clinical benefit in a patient with Parkinsons disease. Mov Disord 1998;13:383393.[CrossRef][Medline]
- Hauser RA, Freeman TB, Snow BJ et al. Long-term evaluation of bilateral fetal nigral transplantation in Parkinson disease. Arch Neurol 1999;56:179187.[Abstract/Free Full Text]
- Lindvall O. Cerebral implantation in movement disorders: state of the art. Mov Disord 1999;14:201205.[CrossRef][Medline]
- Piccini P, Brooks DJ, Björklund A et al. Dopamine release from nigral transplants visualized in vivo in a Parkinsons patient. Nat Neurosci 1999;2:11371140.[CrossRef][Medline]
- Freed CR, Greene PE, Breeze RE et al. Transplantation of embryonic dopamine neurons for severe Parkinsons disease. N Engl J Med 2001;344:710719.[Abstract/Free Full Text]
- Clarkson ED. Fetal tissue transplantation for patients with Parkinsons disease: a database of published clinical results. Drugs Aging 2001;18:773785.[CrossRef][Medline]
- Mendez I, Dagher A, Hong M et al. Simultaneous intrastriatal and intranigral fetal dopaminergic grafts in patients with Parkinson disease: a pilot study. Report of three cases. J Neurosurg 2002;96:589596.[Medline]
- Greely HT, Hamm T, Johnson R et al. The ethical use of human fetal tissue in medicine. N Engl J Med 1989;320:10931096.[Medline]
- Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:154156.[CrossRef][Medline]
- Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci USA 1981;78:76347638.[Abstract/Free Full Text]
- Robertson EJ. Embryo-derived stem cell lines. In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, First Edition. Washington: IRL Press, 1987:71-112.
- Brook FA, Gardner RL. The origin and efficient derivation of embryonic stem cells in the mouse. Proc Natl Acad Sci USA 1997;94:57095712.[Abstract/Free Full Text]
- Niwa H. Molecular mechanism to maintain stem cell renewal of ES cells. Cell Struct Funct 2001;26:137148.[CrossRef][Medline]
- Doetschman TC, Eistetter H, Katz M et al. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands, and myocardium. J Embryol Exp Morphol 1985;87:2745.[Medline]
- Keller GM. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 1995;7:862869.[CrossRef][Medline]
- Okabe S, Forsberg-Nilsson K, Spiro AC et al. Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech Dev 1996;59:89102.[CrossRef][Medline]
- Lee S-H, Lumelsky N, Studer L et al. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat Biotechnol 2000;18:675679.[CrossRef][Medline]
- Kawasaki H, Mizuseki K, Nishikawa S et al. Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 2000;28:3140.[CrossRef][Medline]
- Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:11451147.[Abstract/Free Full Text]
- Thomson JA, Odorico JS. Human embryonic stem cell and embryonic germ cell lines. Trends Biotechnol 2000;18:5357.[CrossRef][Medline]
- Amit M, Carpenter MK, Inokuma MS et al. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 2000;227:271278.[CrossRef][Medline]
- Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000;18:399404.[CrossRef][Medline]
- Itskovitz-Eldor J, Schuldiner M, Karsenti D et al. Differentiation of human embryonic stem cells into embryoid bodies comprising the three embryonic germ layers. Mol Med 2000;6:8895.[Medline]
- Schuldiner M, Yanuka O, Itskovitz-Eldor J et al. Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc Natl Acad Sci USA 2000;97:1130711312.[Abstract/Free Full Text]
- Odorico JS, Kaufman DS, Thomson JA. Multilineage differentiation from human embryonic stem cell lines. STEM CELLS 2001;19:193204.[Abstract/Free Full Text]
- Reubinoff BE, Itsykson P, Turetsky T et al. Neural progenitors from human embryonic stem cells. Nat Biotechnol 2001;19:11341140.[CrossRef][Medline]
- Schuldiner M, Eiges R, Eden A et al. Induced neuronal differentiation of human embryonic stem cells. Brain Res 2001;913:201205.[CrossRef][Medline]
- Zhang S-C, Wernig M, Duncan ID et al. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat Biotechnol 2001;19:11291133.[CrossRef][Medline]
- Svendsen CN, Smith AG. New prospects for human stem-cell therapy in the nervous system. Trends Neurosci 1999;22:357364.[CrossRef][Medline]
- Yamada T, Yoshikawa M, Kanda S et al. In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green. STEM CELLS 2002;20:146154.[Abstract/Free Full Text]
- Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000;24:372376.[CrossRef][Medline]
- Hooper M, Hardy K, Handyside A et al. HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 1987;326:292295.[CrossRef][Medline]
- Yamada T, Yoshikawa M, Takaki M et al. In vitro functional gut-like organ formation from mouse embryonic stem cells. STEM CELLS 2002;20:4149.[Abstract/Free Full Text]
- Shiroi A, Yoshikawa M, Yokota H et al. Identification of insulin-producing cells derived from embryonic stem cells by zinc-chelating dithizone. STEM CELLS 2002;20:284292.[Abstract/Free Full Text]
- Ye W, Shimamura K, Rubenstein JL et al. FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 1998;93:755766.[CrossRef][Medline]
- Bensadoun J-C, Déglon N, Tseng JL et al. Lentiviral vectors as a gene delivery system in the mouse midbrain: cellular and behavioral improvements in a 6-OHDA model of Parkinsons disease using GDNF. Exp Neurol 2000;164:1524.[CrossRef][Medline]
- Suri C, Fung BP, Tischler AS et al. Catecholaminergic cell lines from the brain and adrenal glands of tyrosine hydroxylase-SV40 T antigen transgenic mice. Neurosci 1993;13:12801291.[Abstract]
- Takeuchi H, Yoshikawa M, Kanda S et al. Implantation of xenografts into the parkinsonian rat brain after portal venous administration of xenogeneic donor spleen cells. J Neurosurg 2001;94:775781.[Medline]
- Stromberg I, Kehr J, Andbjer B et al. Fetal ventral mesencephalic grafts functionally reduce the dopamine D2 receptor supersensitivity in partially dopamine reinnervated host striatum. Exp Neurol 2000;164:154165.[CrossRef][Medline]
- Araki T, Tanji H, Kato H et al. Temporal changes of dopaminergic and glutamatergic receptors in 6-hydroxydopamine-treated rat brain. Eur Neuropsychopharmacol 2000;10:365375.[Medline]
- Araki T, Tanji H, Fujihara K et al. Sequential changes of cholinergic and dopaminergic receptors in brains after 6-hydroxydopamine lesions of the medial forebrain bundle in rats. J Neural Transm 2000;107:873884.
- White FJ. Neurobiology. Dopamine receptors get a boost. Nature 2001;411:3538.[Medline]
- Hurley MJ, Mash DC, Jenner P. Dopamine D1 receptor expression in human basal ganglia and changes in Parkinsons disease. Brain Res Mol Brain Res 2001;87:271279.[Medline]
- Björklund LM, Sánchez-Pernaute R, Chung S et al. Embryonic stem cells develop into functional dopaminergic neurons after transplantation in a Parkinson rat model. Proc Natl Acad Sci USA 2002;99:23442349.[Abstract/Free Full Text]
- Kawasaki H, Suemori H, Mizuseki K et al. Generation of dopaminergic neurons and pigmented epithelia from primate ES cells by stromal cell-derived inducing activity. Proc Natl Acad Sci USA 2002;99:15801585.[Abstract/Free Full Text]
- Kim JH, Auerbach JM, Rodríguez-Gómez JA et al. Dopamine neurons derived from embryonic stem cells function in an animal model of Parkinsons disease. Nature 2002;418:5056.[CrossRef][Medline]
Received on May 13, 2002;
accepted for publication on September 25, 2002.
This article has been cited by other articles:

|
 |

|
 |
 
W. Murrell, A. Wetzig, M. Donnellan, F. Feron, T. Burne, A. Meedeniya, J. Kesby, J. Bianco, C. Perry, P. Silburn, et al.
Olfactory Mucosa Is a Potential Source for Autologous Stem Cell Therapy for Parkinson's Disease
Stem Cells,
August 1, 2008;
26(8):
2183 - 2192.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Thomas, S. Friedman, and R.-Y. Lin
Thyroid stem cells: lessons from normal development and thyroid cancer
Endocr. Relat. Cancer,
March 1, 2008;
15(1):
51 - 58.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Cesnulevicius, M. Timmer, M. Wesemann, T. Thomas, T. Barkhausen, and C. Grothe
Nucleofection Is the Most Efficient Nonviral Transfection Method for Neuronal Stem Cells Derived from Ventral Mesencephali with No Changes in Cell Composition or Dopaminergic Fate
Stem Cells,
December 1, 2006;
24(12):
2776 - 2791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Lamba, M. O. Karl, C. B. Ware, and T. A. Reh
Efficient generation of retinal progenitor cells from human embryonic stem cells
PNAS,
August 22, 2006;
103(34):
12769 - 12774.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Arufe, M. Lu, A. Kubo, G. Keller, T. F. Davies, and R.-Y. Lin
Directed Differentiation of Mouse Embryonic Stem Cells into Thyroid Follicular Cells
Endocrinology,
June 1, 2006;
147(6):
3007 - 3015.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Fukuda, J. Takahashi, K. Watanabe, H. Hayashi, A. Morizane, M. Koyanagi, Y. Sasai, and N. Hashimoto
Fluorescence-Activated Cell Sorting-Based Purification of Embryonic Stem Cell-Derived Neural Precursors Averts Tumor Formation after Transplantation
Stem Cells,
March 1, 2006;
24(3):
763 - 771.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Weiss, S. Medicetty, A. R. Bledsoe, R. S. Rachakatla, M. Choi, S. Merchav, Y. Luo, M. S. Rao, G. Velagaleti, and D. Troyer
Human Umbilical Cord Matrix Stem Cells: Preliminary Characterization and Effect of Transplantation in a Rodent Model of Parkinson's Disease
Stem Cells,
March 1, 2006;
24(3):
781 - 792.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Martinat, J.-J. Bacci, T. Leete, J. Kim, W. B. Vanti, A. H. Newman, J. H. Cha, U. Gether, H. Wang, and A. Abeliovich
Cooperative transcription activation by Nurr1 and Pitx3 induces embryonic stem cell maturation to the midbrain dopamine neuron phenotype
PNAS,
February 21, 2006;
103(8):
2874 - 2879.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-S. Fu, Y.-C. Cheng, M.-Y. A. Lin, H. Cheng, P.-M. Chu, S.-C. Chou, Y.-H. Shih, M.-H. Ko, and M.-S. Sung
Conversion of Human Umbilical Cord Mesenchymal Stem Cells in Wharton's Jelly to Dopaminergic Neurons In Vitro: Potential Therapeutic Application for Parkinsonism
Stem Cells,
January 1, 2006;
24(1):
115 - 124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. -L. Kuan and R. A. Barker
New Therapeutic Approaches to Parkinson's Disease Including Neural Transplants
Neurorehabil Neural Repair,
September 1, 2005;
19(3):
155 - 181.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
K. J. Cho, K. A. Trzaska, S. J. Greco, J. McArdle, F. S. Wang, J.-H. Ye, and P. Rameshwar
Neurons Derived From Human Mesenchymal Stem Cells Show Synaptic Transmission and Can Be Induced to Produce the Neurotransmitter Substance P by Interleukin-1{alpha}
Stem Cells,
March 1, 2005;
23(3):
383 - 391.
[Abstract]
[Full Text]
[PDF]
|
 |
|