| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Gene Expression and Development, Roslin Institute, Roslin, Midlothian, Scotland, United Kingdom
Key Words. Endoderm • ES cells • Oct-4 • Pluripotency • Trophoblast
Tom Burdon, Ph.D., Roslin Institute, Roslin, Midlothian, EH25 9PS Scotland, United Kingdom. Telephone: 00-44-131-527-4270; Fax: 00-44-131-440-0434; e-mail: tom.burdon{at}bbsrc.ac.uk; website: www.ri.bbsrc.ac.
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-fetoprotein, and a gene trap associated with primitive liver/yolk sac differentiation. In human ES cells, Oct-4 knockdown also induced morphological differentiation coincident with the upregulation of Gata6. The induction of Cdx2 and other trophoblast-associated genes, however, was dependent on the culture conditions. These results establish the general requirement for Oct-4 in maintaining pluripotency in ES cells. Moreover, the upregulation of endoderm-associated markers in both mouse and human ES cells points to overlap between development of trophoblast and endoderm differentiation.
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Maintenance of ES cell pluripotency requires the constant suppression of differentiation by both extrinsic and intrinsic factors [5]. The POU-domain transcription factor Oct-4 is highly expressed in ES cells [3, 4, 7] and has been shown to be essential for maintaining pluripotency in mES cells [8]. In an elegant series of experiments, in which Oct-4 expression was controlled by a tetracycline-regulated transgene, Niwa and colleagues showed that self-renewal was exquisitely dependent on the level of Oct-4 [8]. Whereas a twofold increase in Oct-4 promoted differentiation into embryonic and extraembryonic cell types typically produced upon withdrawal of the cytokine leukemia inhibitory factor (LIF), a reduction in the level of Oct-4 induced dedifferentiation into trophoblast, an extraembryonic lineage that mES cells do not normally generate [9]. This observation led to the proposal that at least one of the functions of Oct-4 is to operate as a gatekeeper to prevent respecification and dedifferentiation into extraembryonic ectoderm [8].
Establishment and maintenance of pluripotency in stem cells is a central issue in stem cell biology. In order to compare the role of Oct-4 in mouse and human ES cells, we employed RNA interference (RNAi) to knock down the transcription factor in both types of ES cells [10]. A particularly attractive feature of RNAi is that we could directly compare the effects of Oct-4 downregulation in multiple lines of both mouse and human ES cells. Although RNAi cannot completely eliminate Oct-4 function, we reasoned that, if a threshold level of Oct-4 is required for self-renewal, a relatively modest knockdown would allow us to compare Oct-4 functions in ES cells from both species.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell Culture Human ES (hES) cells (H1 and H9) and mES cells (HM1, I114, D027, E14Tg2A, and ZHBTc4) were maintained as described previously [11, 12]. hES cells were passaged using phosphate-buffered saline (PBS)/0.5 mM EDTA, and ~1 x 105 cells were seeded onto matrigel-coated 6-well plates 24 hours prior to transfection. mES cells (1–5 x 104) were trypsinized and plated on gelatin-coated 6-well plates 24 hours before transfection. For immunofluorescence studies, ~2.0 x 104 hES and mES cells were seeded onto matrigel- or gelatin-coated chamber slides (Lab Tek 138121; Christchurch, New Zealand; http://www.vortexer.com) 24 hours and 48 hours, respectively, prior to transfection. Cell morphology was recorded using a Nikon microphot SA microscope and camera (TE2000U).
Small Interfering RNAs and Transfection
Small interfering (si)RNAs were obtained from Dharmacon Research, Inc. (Lafayette, CO; http://www.dharmacon.com). The annealed duplexes were prepared as recommended by the manufacturer. The sense strands of the synthetic oligonucleotide duplexes were: enhanced green fluorescent protein (EGFP): AAGAACGGCAUCAA GGUGAAC; mOct-4: AAGGAUGUGGUUCGAGUAUGG; and hOct-4: AAGGAUGUGGUCCGAGUGUGG.
ES cells were transfected with 80 nM (2 µg) of the siRNA duplex with Lipofectamine 2000 at a ratio of 1:2. Transfection complexes were prepared in Optimem (Invitrogen; Carlsbad, CA; http://www.invitrogen.com), and cells were transfected for 6 hours (hES) or 8–16 hours (mES) in ES growth medium or modified N2B27 medium [13]. After recovery in fresh cell culture medium, cells were transfected again at 24 hours. In luciferase reporter experiments, 1–2 x 105 hES and mES cells were seeded 24 hours prior to siRNA/plasmid cotransfections. Cells were incubated overnight with Lipofectamine 2000 complexes containing 0.5 µg fibroblast growth factor (FGF)4 enhancer-luciferase reporter plasmid (FGF4enh5') [14], 0.05 µg elongation factor (EF)1-Renilla control plasmid [15], and siRNA duplexes to a final concentration of 80 nM. Cell lysates were prepared 24 hours posttransfection, and luciferase activity was assayed using Dual-Luciferase reporter reagents (Promega; Madison, WI; http://www.promega.com) and read with a Berthold LB96V luminometer (Bad Wildbad, Germany; http://www.bertholdtech.com). Assays were performed in triplicate, and luciferase activities were normalized relative to a cotransfected EF1-Renilla control plasmid [15].
Immunoblotting
Embryonic stem cells were lysed and sonicated in SDS sample buffer. Lysates were electrophoresed on 10% SDS-PAGE gels and immunoblotted as described previously [12]. The primary antibodies against SHP-2 (sc-280) and Oct-4 (sc-5279) were supplied by Santa Cruz Biotechnology (Heidelberg, Germany; http://www.scbt.com) and used at a dilution of 1:1,000. Secondary horseradish peroxidase-conjugated antibodies (Amersham; Buckinghamshire, England; http://www.apbiotech.com) were used at a dilution of 1:5,000, and antigen complexes were detected using the ECL reagent (Amersham).
Immunostaining and Fluorescence Microscopy
Cells were fixed with 4% paraformaldehyde/PBS for 10 minutes, washed twice in PBS, and permeabilized for 2 minutes with 100% ethanol. The samples were then washed three times with PBS and blocked in PBS containing 10% goat serum for 1 hour. The primary antibodies were supplied by Santa Cruz Biotechnology, and concentrations used were Oct-4 (sc-5279) 1:200 and Gata6 (sc-9055) 1:100. Antibody/ antigen complexes were detected using antimouse fluorescein isothiocyanate-conjugated (715-093-150) or antirabbit Texas Red-conjugated (711-295-152) antibodies from Jackson ImmunoResearch (West Grove, PA; http://www.jacksonimmuno.com) at a dilution of 1:400 and visualized using a Nikon microphot SA microscope, camera, and Digital Pixel software. Three fields of view (total >100 cells) were counted to obtain quantitative data on Oct-4 knockdown and Gata6 induction.
X-Gal Staining and ONPG Assay
ß-galactosidase activity was monitored in situ by X-gal staining or quantitated biochemically using the o-nitrophenyl-D galactoside (ONPG) assay [12]. ß-galactosidase activity (optical density at 414 nM) was normalized with respect to protein concentration as determined using the BCA assay (Perbio 23223; Helsingborg, Sweden; http://www.perbio.com). Duplicate assays were performed on triplicate samples for each treatment. The absorbances of ONPG assays from D027 and I114 cells were read after 10-minute incubations at 37°C or overnight incubations at room temperature, respectively. Specific absorbance above background was obtained by subtracting readings obtained using parallel cultures from control (HM1) cells that lack a ß-galactosidase reporter.
Reverse Transcription-Polymerase Chain Reaction
RNA was prepared using the RNA-Bee reagent (AMS Biotechnology; Abingdon, UK; http://www.immunok.com) following the manufacturer’s instructions. Two micrograms of total RNA were reversed transcribed using 0.2 µg oligo-dT and 20 units of Moloney murine leukemia virus reverse transcriptase (Roche 1 062 603; Basel, Switzerland; http://www.roche.com) in a 20-µl reaction. Either one-tenth (hES) or one- twentieth (mES) of the reverse transcription reaction was used as a template for the polymerase chain reaction (PCR) reactions using Amplitaq Gold polymerase (Perkin Elmer; Boston, MA; http://instruments.perkinelmer.com). PCR products were fractionated on 1.5% Tris/Borate/EDTA (TBE) agarose gels and visualized under UV light using ethidium bromide. For a full list of primers and conditions used see Table 1
and Table 2.
|
|
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Immunohistochemistry confirmed this selective knockdown of Oct-4 at the cellular level (Fig. 1B and 1C). Oct-4 protein was detected in >90% of the nuclei of mES and hES cells transfected with EGFP or the cross-species Oct-4 siRNA, compared with 30%-35% of mES and hES cells treated with the species-specific siRNA (Fig. 1D). Concomitant with the decrease in Oct-4 protein, we also observed a decrease in Oct-4-dependent transcription, as measured by activation of the Oct-4-regulated FGF4enh5' luciferase reporter gene [14]. Whereas cotransfection of the reporter with cross-species Oct-4 siRNAs produced negligible reduction in luciferase activity, the species-specific Oct-4 siRNAs dramatically reduced Oct-4-dependent transcription by 50%-65% within 24 hours (Fig. 1E). The rapid knockdown and loss of Oct-4-dependent transcription demonstrated that our siRNAs could be used effectively to study Oct-4 function in both mES and hES cells.
|
). These cells continued to proliferate rapidly, and by 62 hours they had spread out to form a monolayer comprising cells that were morphologically similar to a subset formed during LIF withdrawal or background differentiation (Fig. 2A, compare inset panels). At the molecular level, Oct-4 knockdown in E14-IA3 cells correlated with the upregulation of a trophoblast stem cell marker, Cdx2 [17], in line with previously reported results [8]. In addition, however, we also observed increased expression of the endoderm-associated genes Gata6 and -fetoprotein (AFP). Negligible induction of FGF5, (a primitive ectoderm marker), Brachyury (mesoderm), or Pax6 (embryonic ectoderm, data not shown) was observed on Oct-4 knockdown. Expression of placental lactogen (PL-1), a marker of differentiated trophoblast, was below the level of detection in E14-IA3 cells. FGF5 and Brachyury (T) were upregulated when cells were cultured in the absence of LIF, confirming that E14-IA3 cells differentiated appropriately in our culture conditions (Fig. 2B). Oct-4 knockdown in the HM1 cell line induced a pattern of morphological and molecular differentiation similar to that observed with E14-IA3 cells (Fig. 2C). Differentiated HM1 cells exhibited coordinate induction of Cdx2, Gata6, and AFP expression, but also no detectable upregulation of PL-1 transcription (Fig. 2D). Induction of Gata6 and AFP expression as well as the trophoblast-associated gene Cdx2 is, therefore, a consistent feature of Oct-4 knockdown in wild-type mES cells.
|
). X-gal staining of transfected cultures revealed that ß-galactosidase-positive cells were first evident 3 days after transfection, and their number increased until day 5, when they represented a small, but significant, minority of cells within the culture (Fig. 3B). To exclude the possibility that the I114 lacZ-positive cells might be generated indirectly from untransfected stem cells induced by paracrine signaling from differentiating neighbors, we cocultured I114 cells with Oct-4 siRNA-transfected HM1 cells. ß-galactosidase activity was not induced in these cocultures, demonstrating that induction of the Gtar gene-trap reporter by Oct-4 knockdown in I114 cells was cell autonomous (data not shown).
|
). This paralleled the changes in ES cell morphology induced by treating ZHBTc4 cells with doxycycline and was similar to the pattern described previously for inactivation of the Oct-4 transgene [8]. In contrast, ZHBTc4 cells transfected with EGFP siRNA remained morphologically undifferentiated and were indistinguishable from control cells. RT-PCR analysis confirmed that expression of Oct-4 was significantly reduced by Oct-4 siRNA transfection and completely eliminated by doxycycline treatment. Despite the different methods used to downregulate Oct-4, expression of the trophoblast stem cell-associated transcription factor Cdx2 was induced similarly by both treatments. In contrast to the other mES cells tested, we also detected induction of the trophoblast differentiation marker PL-1 (Fig. 4B). Upregulation of Gata6 and AFP in both doxycycline-treated and Oct-4 siRNA-transfected cells, however, confirmed that increased expression of these endoderm-associated genes in mES cells was induced by downregulation of Oct-4.
|
). In contrast, cells transfected with either EGFP or mouse-specific Oct-4 siRNA formed dense overgrowing colonies typical of undifferentiated hES cell cultures. Analysis of gene expression by RT-PCR confirmed the selective downregulation of Oct-4 in hOct-4 siRNA-transfected cells (Fig. 5B). A slight but reproducible decrease in expression of telomerase catalytic subunit with reverse transcriptase activity (Tert) was observed upon Oct-4 knockdown, consistent with the differentiation of stem cells. Interestingly, there was a marked increase in the level of Gata6 and Gata4 transcripts upon Oct-4 knockdown. The increase in Gata6 expression was confirmed at the cellular level by immunofluorescence (Fig. 5C). In contrast to Oct-4 knockdown in mES cell transfections, however, increased expression of AFP expression was not detected. Moreover, with the exception of Gata3, little induction was observed for either early (Gata2, Cdx2) or late (chorionic gonadatropin [CG], CGß, PL-1) markers of trophoblast differentiation. Since Gata6 precedes AFP expression in some endoderm cell types, we considered the possibilities that these Oct-4-depleted hES cultures might contain immature endodermal precursors or that the particular culture conditions might restrict the differentiation of ES cell derivatives. We, therefore, accelerated the maturation of differentiated cells by transfecting cells cultured in a modified N2B27 medium [13] that lacks serum supplements, fibroblast-conditioned medium, or FGF2. In this medium, the majority of hES cells transfected with hOct-4 siRNA had clearly differentiated by 96 hours, in comparison with the mOct-4 siRNA control cultures (Fig. 5D). The morphology of these differentiated cells was strikingly similar to the epithelial-like cells produced by Oct-4 knockdown in mouse ES cells. Moreover, RT-PCR analysis showed a dramatic induction of AFP as well as Gata6, paralleling the pattern of endoderm marker gene expression observed in mouse ES cells. Interestingly, increased expression of CG and Cdx2 was also detected in these cultures, consistent with the induction of trophoblast differentiation.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RNAi-mediated depletion of Oct-4 in mES cells induced expression of the trophoblast stem cell marker Cdx2 [17] and the appearance of flattened epithelial-like cells, some of which exhibited morphology typical of differentiated trophoblast giant cells. This paralleled the response triggered by conditional inactivation of the Oct-4 transgene in the ZHBTc4 cell line and confirmed that induction of trophoblast differentiation is a general feature of downregulation of Oct-4 in mES cells. Moreover, this establishes that RNAi-mediated knockdown is an effective tool for investigating Oct-4 function in ES cells, a finding supported by the recent demonstration that an Oct-4-specific short hairpin RNA can induce trophoblast marker expression in mES cells [21].
Oct-4 knockdown in hES cells also produced epithelial-like differentiation, but, compared with mES cells, the cultures exhibited a restricted induction of the trophoblast markers. Under growth conditions that support long-term self-renewal of hES cells, expression of Cdx2 was not induced. Furthermore, although Cdx2 and hCG were detected when Oct-4 depletion was performed in conditions suboptimal for self-renewal, the trophoblast differentiation marker PL-1 was not induced despite its basal expression in control hES cell cultures. This surprising result suggests that PL-1 expression may depend on stem-cell-derived signals and, in differentiated human cells, it might require an extended period of culture. The difference between the immediate responses of mouse and human ES cells could simply have arisen from the specific growth media used to culture the two cell types and stimulation via distinct extracellular factors. Alternatively, it could reflect intrinsic differences between mouse and human ES cells in their responses to downregulation of Oct-4.
However, a novel and consistent feature of Oct-4 knockdown in both human and mouse ES cells was the upregulation of genes typically associated with endoderm differentiation. In mES cells, Gata6, AFP, and the liver/yolk sac-specific Gtar gene trap were induced following Oct-4 knockdown. Increased Gata6 expression was also observed in doxycycline-treated ZHBTc4 cells, confirming that this was due to suppression of Oct-4. Indeed, induction of Gata6 and other endoderm-associated markers, such as BMP2, were recently reported in a more comprehensive analysis of endoderm markers in Oct-4-depleted ZHBTc4 cells [22]. In hES cells, Oct-4 depletion led to induction of Gata6 at both the mRNA and protein levels. This occurred under conditions when Cdx2 was not detected, indicating that Gata6 expression is likely to be an immediate response to downregulation of Oct-4 in hES cells.
The significance of the induction of endoderm-associated genes upon Oct-4 depletion is unclear at present. It could point to the differentiation of both trophoblast and endoderm cell types upon Oct-4 knockdown. This would be consistent with a degree of heterogeneity in the morphology of cells present in the cultures, heterogenous staining for Gata6 in hES cells, and expression of the Gtar gene-trap marker in only a subset of the differentiated mES cells. However, these differences could also arise from asynchronous differentiation along one basic pathway. Gata6 expression is not generally considered to be associated with trophoblast differentiation, but transient activation of a Gata6-dependent ß-galactosidase transgene has been reported within trophoblast cells in mouse blastocysts [23]. Expression of endogenous Gata6 transcripts, however, could not be confirmed by in situ hybridization, indicating that either the level of expression was very low or the ß-galactosidase activity might be carried over from Gata6 promoter activity within a progenitor cell. Indeed, immediately after implantation, activity of the Gata6/ß-galactosidase transgene became restricted to a discrete subset of cells within the inner mass cells adjacent to the trophoblast and primitive endoderm [23]. Induction of Gata6 in both mouse and human ES cells upon Oct-4 knockdown may therefore point to a common origin between trophoblast and an endodermal lineage. In fact, Cdx2 expression within the chorioallantoic placenta and hindgut endoderm links these structurally related tissues [17]. A broader function for Oct-4 in regulating differentiation is suggested by persistence of Oct-4 within the primitive ectoderm until gastrulation [7] and a possible role in neurogenesis [24]. Moreover, the identification of Oct-4-related molecules in vertebrates other than mammals [25, 26] is consistent with a role in regulating pluripotency of embryonic cells more generally, with the induction of Gata6 in both mouse and human ES cells, perhaps reflecting this conserved role.
|
ACKNOWLEDGMENT |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-Renilla plasmid, Hitoshi Niwa for FGF4enh5' plasmid, Austin Smith for ZHBTc4 cells, Lesley Forrester for I114 cells, and Lesley Gerrard for HM1 and H9 sublines. We also thank Michael Clinton, Joseph Mee, and Joshua Brickman for critical comments during development of the manuscript. This work is dedicated to the memory of Dr. Michael Burdon. |
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  G. Cauffman, M. De Rycke, K. Sermon, I. Liebaers, and H. Van de Velde Markers that define stemness in ESC are unable to identify the totipotent cells in human preimplantation embryos Hum. Reprod., January 1, 2009; 24(1): 63 - 70. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. M. Toriello, E. S. Douglas, N. Thaitrong, S. C. Hsiao, M. B. Francis, C. R. Bertozzi, and R. A. Mathies Integrated microfluidic bioprocessor for single-cell gene expression analysis PNAS, December 23, 2008; 105(51): 20173 - 20178. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. F. Gjerstorff, L. Harkness, M. Kassem, U. Frandsen, O. Nielsen, M. Lutterodt, K. Mollgard, and H. J. Ditzel Distinct GAGE and MAGE-A expression during early human development indicate specific roles in lineage differentiation Hum. Reprod., October 1, 2008; 23(10): 2194 - 2201. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Sun, X. Long, Y. Yin, Y. Jiang, X. Chen, W. Liu, W. Zhang, H. Du, S. Li, Y. Zheng, et al. Similar biological characteristics of human embryonic stem cell lines with normal and abnormal karyotypes Hum. Reprod., October 1, 2008; 23(10): 2185 - 2193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Hay, J. Fletcher, C. Payne, J. D. Terrace, R. C. J. Gallagher, J. Snoeys, J. R. Black, D. Wojtacha, K. Samuel, Z. Hannoun, et al. Highly efficient differentiation of hESCs to functional hepatic endoderm requires ActivinA and Wnt3a signaling PNAS, August 26, 2008; 105(34): 12301 - 12306. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Fong, K. A. Hohenstein, and P. J. Donovan Regulation of Self-Renewal and Pluripotency by Sox2 in Human Embryonic Stem Cells Stem Cells, August 1, 2008; 26(8): 1931 - 1938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Monk, M. Hitchins, and S. Hawes Differential expression of the embryo/cancer gene ECSA(DPPA2), the cancer/testis gene BORIS and the pluripotency structural gene OCT4, in human preimplantation development Mol. Hum. Reprod., June 1, 2008; 14(6): 347 - 355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Hohenstein, A. D. Pyle, J. Y. Chern, L. F. Lock, and P. J. Donovan Nucleofection Mediates High-Efficiency Stable Gene Knockdown and Transgene Expression in Human Embryonic Stem Cells Stem Cells, June 1, 2008; 26(6): 1436 - 1443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. He, D. Pant, A. Schiffmacher, A. Meece, and C. L. Keefer Lymphoid Enhancer Factor 1-Mediated Wnt Signaling Promotes the Initiation of Trophoblast Lineage Differentiation in Mouse Embryonic Stem Cells Stem Cells, April 1, 2008; 26(4): 842 - 849. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Hay, D. Zhao, J. Fletcher, Z. A. Hewitt, D. McLean, A. Urruticoechea-Uriguen, J. R. Black, C. Elcombe, J. A. Ross, R. Wolf, et al. Efficient Differentiation of Hepatocytes from Human Embryonic Stem Cells Exhibiting Markers Recapitulating Liver Development In Vivo Stem Cells, April 1, 2008; 26(4): 894 - 902. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. F. Cole, S. E. Johnstone, J. J. Newman, M. H. Kagey, and R. A. Young Tcf3 is an integral component of the core regulatory circuitry of embryonic stem cells Genes & Dev., March 15, 2008; 22(6): 746 - 755. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Blomberg, K. Hashizume, and C. Viebahn Blastocyst elongation, trophoblastic differentiation, and embryonic pattern formation Reproduction, February 1, 2008; 135(2): 181 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. M.-S. Tay, W.-L. Tam, Y.-S. Ang, P. M. Gaughwin, H. Yang, W. Wang, R. Liu, J. George, H.-H. Ng, R. J. Perera, et al. MicroRNA-134 Modulates the Differentiation of Mouse Embryonic Stem Cells, Where It Causes Post-Transcriptional Attenuation of Nanog and LRH1 Stem Cells, January 1, 2008; 26(1): 17 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. J. Groves and J. H. Sinclair Knockdown of hDaxx in normally non-permissive undifferentiated cells does not permit human cytomegalovirus immediate-early gene expression J. Gen. Virol., November 1, 2007; 88(11): 2935 - 2940. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. T. Rodriguez, J. M. Velkey, C. Lutzko, R. Seerke, D. B. Kohn, K. S. O'Shea, and M. T. Firpo Manipulation of OCT4 Levels in Human Embryonic Stem Cells Results in Induction of Differential Cell Types Experimental Biology and Medicine, November 1, 2007; 232(10): 1368 - 1380. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Lavial, H. Acloque, F. Bertocchini, D. J. MacLeod, S. Boast, E. Bachelard, G. Montillet, S. Thenot, H. M. Sang, C. D. Stern, et al. The Oct4 homologue PouV and Nanog regulate pluripotency in chicken embryonic stem cells Development, October 1, 2007; 134(19): 3549 - 3563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Schenke-Layland, E. Angelis, K. E. Rhodes, S. Heydarkhan-Hagvall, H. K. Mikkola, and W. R. MacLellan Collagen IV Induces Trophoectoderm Differentiation of Mouse Embryonic Stem Cells Stem Cells, June 1, 2007; 25(6): 1529 - 1538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Pasini, A. P. Bracken, J. B. Hansen, M. Capillo, and K. Helin The Polycomb Group Protein Suz12 Is Required for Embryonic Stem Cell Differentiation Mol. Cell. Biol., May 15, 2007; 27(10): 3769 - 3779. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Gassanov, M. Jankowski, B. Danalache, D. Wang, R. Grygorczyk, U. C. Hoppe, and J. Gutkowska Arginine Vasopressin-mediated Cardiac Differentiation: INSIGHTS INTO THE ROLE OF ITS RECEPTORS AND NITRIC OXIDE SIGNALING J. Biol. Chem., April 13, 2007; 282(15): 11255 - 11265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Qin, T. Yu, T. Qing, Y. Liu, Y. Zhao, J. Cai, J. Li, Z. Song, X. Qu, P. Zhou, et al. Regulation of Apoptosis and Differentiation by p53 in Human Embryonic Stem Cells J. Biol. Chem., February 23, 2007; 282(8): 5842 - 5852. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Babaie, R. Herwig, B. Greber, T. C. Brink, W. Wruck, D. Groth, H. Lehrach, T. Burdon, and J. Adjaye Analysis of Oct4-Dependent Transcriptional Networks Regulating Self-Renewal and Pluripotency in Human Embryonic Stem Cells Stem Cells, February 1, 2007; 25(2): 500 - 510. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Cauffman, I. Liebaers, A. Van Steirteghem, and H. Van de Velde POU5F1 Isoforms Show Different Expression Patterns in Human Embryonic Stem Cells and Preimplantation Embryos Stem Cells, December 1, 2006; 24(12): 2685 - 2691. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hasegawa, T. Fujioka, Y. Nakamura, N. Nakatsuji, and H. Suemori A Method for the Selection of Human Embryonic Stem Cell Sublines with High Replating Efficiency After Single-Cell Dissociation Stem Cells, December 1, 2006; 24(12): 2649 - 2660. [Abstract] |
