Stem Cells http://www.epitomics.com
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukuchi, Y.
Right arrow Articles by Tsuji, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukuchi, Y.
Right arrow Articles by Tsuji, K.

Stem Cells 2004;22:649-658 www.StemCells.com
© 2004 AlphaMed Press


RAPID COMMUNICATION

Human Placenta-Derived Cells Have Mesenchymal Stem/Progenitor Cell Potential

Yumi Fukuchi, Hideaki Nakajima, Daisuke Sugiyama, Imiko Hirose, Toshio Kitamura, Kohichiro Tsuji

Division of Cellular Therapy, The Advanced Clinical Research Center, Institute of Medical Science, The University of Tokyo, Japan

Key Words. Human placenta • Placenta-derived cells • Mesenchymal stem/progenitor cells • Cell culture

Correspondence:Yumi Fukuchi, Ph.D., Division of Cellular Therapy, The Advanced Clinical Research Center, Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. Telephone: 81-3-5449-5759; Fax: 81-3-5449-5453; e-mail: yfukuchi{at}ims.u-tokyo.ac.jp


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mesenchymal stem/progenitor cells (MSCs) are widely distributed in a variety of tissues in the adult human body (e.g., bone marrow [BM], kidney, lung, and liver). These cells are also present in the fetal environment (e.g., blood, liver, BM, and kidney). However, MSCs are a rare population in these tissues. Here we tried to identify cells with MSC-like potency in human placenta. We isolated adherent cells from trypsin-digested term placentas and established two clones by limiting dilution. We examined these cells for morphology, surface markers, gene expression patterns, and differentiation potential and found that they expressed several stem cell markers, hematopoietic/ endothelial cell–related genes, and organ-specific genes, as determined by reverse transcription–polymerase chain reaction and fluorescence-activated cell sorter analysis. They also showed osteogenic and adipogenic differentiation potentials under appropriate conditions. We suggest that placenta-derived cells have multilineage differentiation potential similar to MSCs in terms of morphology, cell-surface antigen expression, and gene expression patterns. The placenta may prove to be a useful source of MSCs.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Multipotential mesenchymal stem/progenitor cells (MSCs) can be induced to differentiate into bone, adipose, cartilage, muscle, and endothelium if these cells are cultured under specific permissive conditions [1, 2]. In rodents, a specific type of MSC (termed multipotent adult progenitor cell) can be isolated from bone marrow (BM) and contributes to most somatic cell types when injected into early blastocysts at the single-cell level [3]. Because MSCs have unique immunologic characteristics that suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo [4], persistence in a xenogeneic environment is favored [1]. With such multiple differentiation capacities and unique immunoregulatory features plus self-renew potential [5], MSCs show promise as a possible therapeutic agent. Data from preclinical transplantation studies suggested that MSC infusions not only prevent the occurrence of graft failure but also have immunomodulatory effects [6].

MSCs are a rare population (approximately 0.001%–0.01%) of adult human BM [7]. Moreover, numbers of BM MSCs significantly decrease with age [8]. MSCs are also relatively few in adult peripheral blood [9] and in term cord blood [10]. A recent study showed that the population of MSC-like cells exists within the umbilical vein endothelial/ subendothelial layer [11]. Furthermore, MSCs are present in fetal organs, such as liver, BM, and kidney, and circulate in the blood of preterm fetuses [10, 12, 13]. However, fetal samples can be difficult to procure, and term cord blood compared with preterm is a poor source of MSCs [1012]. Such being the case, searching for appropriate sources, avoiding ethical issues, and establishing suitable culture systems are a challenge.

In this study, we evaluated the possibility that MSCs or cells with MSC-like potency are present in the human term placenta, and we obtained evidence that cells with the phenotype of MSCs exist in this tissue.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation and Culture of Placenta-Derived Cells
Term placentas (n = 57; clinically normal pregnancies, caesarean section) were collected after obtaining written informed consent from donors to the Tokyo Cord Blood Bank.

The internal area (approximately 1 cm3) of central placenta lobules was minced, hemolyzed, trypsinized (37°C for 5 minutes), and finally prepared in both single-cell suspensions and small digested residues. These samples were cultured with {alpha}-minimum essential medium (MEM; Sigma-Aldrich Co., St. Louis, http://www.sigmaaldrich.com) and supplemented with 15% fetal bovine serum (FBS; HyClone Laboratories, Logan, UT, http://www.hyclone.com), 100 U/ml penicillin, and 100 µg/ml streptomycin (Invitrogen, Paisley, U.K., http://www.invitrogen.com). Cultures were maintained at 37°C in a humidified atmosphere with 5% CO2. Three to 5 days after initiating incubation, the small digested residues were removed and the culture was continued. Approximately 3 to 4 weeks later, there were some colonies that contained 50 or more fibroblast-like cells that were more than 50% confluent; they were then trypsinized using 0.05% trypsin (Invitrogen) and replated at a 1:4 dilution. Under the same conditions, placenta-derived cells were continued to culture.

Fluorescence In Situ Hybridization Analysis
Human X/Y chromosomes of placenta-derived cells (male, n = 3; female, n = 3; passages two and three) were cultured on silica-coating slides and examined using CEP X/Y DNA probe kits (Vysis, Inc., Downers Grove, IL, http://www.vysis.com) according to the manufacturer’s instructions. The slides were scanned under a fluorescence microscope using a rhodamine/fluorescein isothiocyanate (FITC) filter for X/Y chromosomes and a UV filter for 4',6-diamidine-2'-phenylindole dihydrochloride–stained cell nuclei.

Fluorescence-Activated Cell Sorter Analysis
Frozen and thawed placenta-derived cells (n = 3, passages 9–12) were trypsinized and incubated with medium containing 15% FBS-2 mM EDTA (pH 8.0) for 3 hours. Next the cells were stained with anti-human specific antibodies CD45-phycoerythrin (PE), CD31-PE, CD54-PE, CD29-FITC or CD29-PE, CD44-FITC or CD44-PE (BD Pharmingen, San Diego, http://www.bdbiosciences.com),AC133/1-PE (Miltenyi Biotec GmbH, Germany, http://www.miltenyibiotec.com), or PE- or FITC-conjugated isotype control (BD Biosciences, San Jose, CA, http://www.bd.com). After staining, cells were analyzed using fluorescence-activated cell sorter (FACS) Calibur flow cytometry (Becton, Dickinson, MountainView, CA).

RNA Extraction and Reverse Transcription–Polymerase Chain Reaction
Total RNA from 105–106 placenta-derived cells (n = 15, passages 2–18, including frozen and thawed samples) was isolated using ISOGEN (Nippon Gene, Tokyo). RNA extracts were treated with deoxyribonuclease I (Amplification Grade, Invitrogen) for digesting contaminated genomic DNA.

Reverse transcription (RT) reactions were carried out on 1 µg of total RNA using the ThermoScriptTM RT–polymerase chain reaction (PCR) system (Invitrogen), and 40 cycles of PCR were run using the Platinum PCR SuperMix (Invitrogen) according to the manufacturer’s instructions. Evaluation of all PCRs was estimated using appropriate human tissue RNA (Clontech Laboratories, Inc., Palo Alto, CA, http://www.clontech.com), human BM-derived MSCs (Bio Whittaker, Inc., Walkersville, MD), and human cell lines [14, 15]. cDNA synthesis and genomic DNA contamination were examined using HOXB4 primers, which give products of 268 bp and 1.1 kb when amplifying cDNA and genomic DNA, respectively. Human-specific primers used were as follows: Oct-4 (866 bp), CCGCCGTATGAGTTCT GTGG/AGAGTGGTGACAGAGACAGG; Rex-1 (449 bp), ATGGCTATGTGTGCTATGAGC/CCTCAACTTCTAGT GCATCC; HOXB4 (268 bp), CTACCCCTGGATGCG CAAAG/CGAGCGGATCTTGGTGTTGG; CBFß (300 bp), TCGTGCCCGACCAGAGAAGC/TCAGAATCATGGGA GCCTTC; ß2-microglobulin (341 bp), GAGTGCTGTCTCCATGTTTG/TAACCACAACCATGCCTTAC; GATA-2 and Tie-2 [16]; TAL-1 [17]; CD34, AC133, flk-1, myogenin, nestin, and {alpha}-1-fetoprotein [18]; flt-1 [19]; Nkx2.5 and GATA-4 [20]; renin and albumin [21]; GFAP [22]; and amylase and insulin [23].

Differentiation Studies
Passage 2 through 11 placenta-derived cells, including frozen and thawed samples (n = 8), were cultured either in an osteogenic (0.1 µM dexamethasone, 10 mM ß-glycerol phosphate, 50 µM ascorbate) or adipogenic (1 µM dexamethasone, 5 µg/ml insulin, 0.5 mM isobutylmethylxanthine, 60 µM indomethacin) medium (all chemicals from Sigma) [10] on two-well Permanox slides (Nalge Nunc International, Naperville, IL). After 2 weeks, osteogenic differentiation was evaluated after 1% Alizarin Red S (Sigma) staining, and adipogenic differentiation was assessed using Oil Red O (Sigma) staining [2].

Subcloning and Characterization of Placenta-Derived Clones
The MSCV-IRES-GFP retroviral plasmid was transfected in PLAT-A packaging cells. Retroviral supernatants were collected and infected in No. 40 placenta-derived cells (passage five). The green fluorescent protein (GFP)–positive cells (passage seven) were sorted by FACS Vantage flow cytometry (Becton, Dickinson) and then subcultured at 5 or 10 cells per well (passage nine). After subcloning, we selected single retroviral-inserted subclones by Southern blot analysis using a GFP cDNA probe. Two clones were obtained, and then we carried out a FACS and RT-PCR analysis and differentiation studies for characterization of these clones.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of Placenta-Derived Cells
Searching for alternative sources of MSCs, we attempted to prepare human term placentas and isolated fibroblast-like cells from every placenta isolation (n = 57; Fig. 1Go). In a single-cell suspension culture of the isolated placenta, cells firstly formed colony-forming unit fibroblast (CFU-F)–like colonies (Figs. 1A, bGo). On the other hand, in the culture of small trypsin-digested residues of placenta, cells began to migrate and proliferate (data not shown). After the first passage, cells from both samples expanded in the same monolayer manner (Fig. 1A, a–cGo). Cord blood (CB) is a rich source of hematopoietic stem cells and MSCs, and the term placenta contains much CB, primarily adherent cells derived from freshly isolated CB mononuclear cells (n = 77). However, CBs were obtained (after receiving the informed consent from Kiyosenomori Hospital, Tokyo) but did not survive in {alpha}-MEM containing 15% FBS. To determine whether these cells were from maternal or fetal parts of the placenta, we did a fluorescence in situ hybridization analysis using X-and Y-probes. These cells were positive for X- and Y-signals, indicating that they were from a fetal part of the placenta (Fig. 1BGo). The placenta-derived cells were classified into two groups according to growth characteristics; one could proliferate more than 20 passages (Fig. 1CGo, Nos. 40 and 29), and the other went into replicative senescence between 10 and 20 passages (Fig. 1CGo, Nos. 41 and 44). The former type had a small and homogeneous morphology, but the latter type was of a bigger shape than the former. We also examined the surface marker profile of the above three representative placenta-derived cell lines using FACS, and these three lines had a similar phenotype, as follows: CD45lowCD31AC133CD54+CD29+CD44+ (Fig. 1DGo), which closely resembles the phenotypes of BM-derived and CB-derived MSCs [2, 7, 10, 24].





View larger version (126K):
[in this window]
[in a new window]
 
Figure 1. Isolation and characterization of placenta-derived cells. (A): Morphology of placenta-derived cells. Cells from a single-cell suspension easily expanded through the formation of colony-forming unit fibroblast–like colonies. a: 10 days after isolation (x100 magnification); b: 3 weeks after isolation (x40 magnification); c: 6 weeks after isolation (passage 3; x40 magnification). (B): Fluorescence in situ hybridization analysis for human X/Y chromosomes. Cells from male placenta have Y-positive (green) and X-positive (orange) signals. (C): Growth curve of placenta-derived cells. Frozen and thawed cells (n = 4, started at passage six or seven) were seeded at 0.5 x 105 cells per well and cultured until 90% confluence was reached. These cells were resuspended, enumerated, and reseeded at the same density for 10 days. (D): Immunophenotype of placenta-derived cells. Cells were stained with phycoerythrin-conjugated or fluorescein isothiocyanate–conjugated antibodies against CD45, CD31,AC133, CD54, CD29, CD44, or immunoglobulin isotype control antibodies. Cells were analyzed using fluorescence-activated cell sorter Calibur. Individual placenta-derived cells were given serial numbers of placenta isolation. Representative samples were used for these figures.

 
Gene Expression Patterns of Placenta-Derived Cells
For a closer study of placenta-derived cells, we did a RT-PCR analysis for various genes, including stem cell markers, hematopoietic/endothelial cell–related genes, and organ-specific genes. The placenta-derived cells expressed many of the genes derived from mesoderm, ectoderm, and endoderm (Fig. 2Go). Additionally, expression patterns of stem cell markers and hematopoietic/endothelial cell–related genes in placenta-derived cells were similar to those of human BM (hBM)–derived MSCs (Fig. 2Go, lane 2).



View larger version (70K):
[in this window]
[in a new window]
 
Figure 2. Gene expression patterns of placenta-derived cells. Placenta-derived cells were characterized using reverse transcription–polymerase chain reaction. Samples are as follows: lane 1, noncultured placenta (trypsin-digested residue); lane 2, human bone marrow–derived mesenchymal stem/progenitor cells; lanes 3–7, placenta (Nos. 29, 41, 42, 44, and 40)-derived cells; lane 8, reagent control; lane 9, positive control (i.e., Oct-4, Rex-1, HOXB4, and ß2-microglobulin were used for EoL-3. GATA-2, CBFß, TAL-1, CD34,AC133, flk-1, and flt-1 were used for TF-1. NKx2.5 and GATA-4 were used for human heart RNA. Renin and myogenin were used for human kidney RNA and skeletal muscle RNA, respectively. Nestin and GFAP were used for human brain RNA. {alpha}-1-fetoprotein and albumin were used for human liver RNA. Amylase and insulin were used for human pancreas RNA). In this figure, we took up the data from the five representative placenta-derived cells, and each of placenta-derived cells was shown by serial numbers of placenta isolation.

 
Differentiation Potential of Placenta-Derived Cells
To estimate the potential to differentiate into osteoblasts and adipocytes, the placenta-derived cells were cultured in osteogenic or adipogenic medium. At the end of the induction periods, most of the cells were Alizarin Red S–positive (Figs. 3B, 3CGo) or Oil Red O–positive (Figs. 3E, 3FGo), indicating differentiation to osteoblasts or adipocytes, respectively. In contrast, cells cultured with regular medium were not significantly stained (Figs. 3A, 3DGo). Such data indicate that the placenta-derived cells had bidirectional differentiation potency.



View larger version (73K):
[in this window]
[in a new window]
 
Figure 3. Differentiation potential of placenta-derived cells. After a 2-week culture in osteogenic (B, C) or adipogenic (E, F) medium or regular medium (A, D), each of the placenta-derived cells was evaluated for osteogenic or adipogenic differentiation using specific staining and hematoxylin counterstaining. Magnification:A, B, D, E, x 40; C, F, x 100. A representative sample was used for this figure.

 
Subcloning of Placenta-Derived Cells
The placenta-derived cells used in the above experiments are obviously heterogeneous and may be a mixture of progenitors that can differentiate into specific lineages. To exclude this possibility, we attempted to subclone No. 40 placenta–derived cells showing the human MSC (hMSC)–like gene expression pattern using RT-PCR (Fig. 2Go, lanes 2 and 7). We established two clones, B2 and F4 (Fig. 4AGo, lanes 1 and 9), which retained almost all of the phenotypes of their parental cells; surface marker expression (CD45lowCD31AC133CD54+CD29+CD44+), gene expression patterns, and differentiation potential (Figs. 4B–4DGo versus Figs. 1Go–3Go). Moreover, these phenotypes were similar to those of other placenta-derived cell lines. Such data suggest that although the placenta-derived cells are considered to be polyclonal, most of the clones are similar in gene-expression profiles and retain the differentiation capacity to osteoblasts and adipocytes.






View larger version (161K):
[in this window]
[in a new window]
 
Figure 4. Establishment and characterization of two clones from No. 40 placenta-derived cells. (A): Establishment of placenta-derived clones. No. 40 placenta-derived cells were transduced with MSCV-IRES-GFP retrovirus, and green fluorescent protein (GFP)-positive population was sorted by fluorescence-activated cell sorting, then replated onto a 96-well dish at 5 or 10 cells per well and expanded. DNAs from these GFP-positive No. 40 placenta-derived subclones were digested overnight with BamHI (cut only once in the MSCV-IRES-GFP plasmid), and fragments were separated by electrophoresis and probed with a 32P-labeled GFP cDNA probe. Samples are as follows for lanes 1-6, 8, and 9: subclones B2, B4, D2, D3, E4, G3, F1, and F4, respectively. These subclones were obtained from sub-cloning of five cells per ell. Lanes 7 and 10, subclones E4 and G4. These were obtained from subcloning of 10 cells per well. Subclones B2 (lane 1) and F4 (lane 9) had a single retroviral insert. (B): Immunophenotype of clones. Clones F4 and B2 were stained with phycoerythrin-conjugated antibodies against CD45, CD31,AC133, CD54, CD29, and CD44 or immunoglobulin isotype control antibodies then analyzed by fluorescence-activated cell sorter Calibur. (C): Gene expression patterns of clones. Clones F4 and B2 were characterized by reverse transcription–polymerase chain reaction analysis. Samples are as follows: lane 1, clone F4; lane 2, clone B2; lane 3, positive control (same positive controls were used in Fig. 2Go). (D): Differentiation potential of clones. Clones F4 and B2 were cultured in osteogenic (b, c, e, f), adipogenic (h, i, k, l), or regular medium (a, d, g, j) for 2 weeks. After the culture periods, each of the clones was evaluated for osteogenic or adipogenic differentiation using specific staining and hematoxylin counterstaining. Magnification: a, b, d, e, g, h, j, k, x 40; c, f, i, l, x 100.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we successfully isolated placenta-derived cells from human term placentas (n = 57) and then characterized morphology, cell-surface antigens, gene expression patterns, and differentiation capacity of these cells. Results of RT-PCR analysis of 15 individual placenta-derived cells showed that the expression patterns of seven genes (HOXB4, CD34, AC133, flk-1, Tie-2, GATA-4, and myogenin) varied but expressions of 14 other genes were quite similar (Fig. 2Go shows evidence of six placenta-derived cells; nine are not shown). These expression patterns resemble those of hBM-derived MSCs, except for renin and flt-1 (Fig. 2Go, lane 2). Comparison of the two types of placenta-derived cells with distinct growth characteristics (one that propagates more than 20 passages [Fig. 1CGo, Nos. 40 and 29] and the other with growth limitation [Nos. 41, 42, and 44]) showed that the expressions of HOXB4, CD34, Tie-2, and GATA-4 were different among these groups. The former more resembled the hBM-derived MSCs for gene expression patterns (Fig. 2Go). Collectively, these results indicate that the placenta-derived cells have MSC-like gene expression patterns. In addition, they showed a differentiation capacity toward both osteo-blasts and adipocytes (Fig. 3Go), suggesting that these cells have MSC-like differentiation potential.

Because the original culture of 57 placenta-derived cell lines should be a mixture of a variety of cell types, we attempted to subclone these cells to do a detailed analysis. Two established clones retained almost all of the phenotypes of parental No. 40 placenta-derived cells, including morphology, cell-surface populations, gene expression patterns, and differentiation capacity. However, these clones also had some differences in mRNA expression, such as CD34 and {alpha}-1-fetoprotein. These genes were upregulated compared with the parent mixture cells (Figs. 2Go, 4CGo). In some reports, small proportions of hMSCs expressed low levels of CD34 [6, 25]. Further experiments are required to determine the meaning of expressions of these genes.

Rex-1 is known to be important for maintaining undifferentiated embryonic stem cells [26, 27]. However, the role of this gene in MSCs is not clear. The result of RT-PCR analysis showed that Rex-1 is expressed in both BM-derived MSCs and placenta-derived cells (Fig. 2Go) but not in the two clones (Fig. 4CGo). Analysis of parental placenta-derived cells at various time points during passages (passages 3, 5, 9, and 18 for original cells; passages 13 and 26 for GFP-labeled mixture cells) using RT-PCR showed that only Rex-1 expression switched from positive (before passage 5, Fig. 2Go) to negative (after passage 9; data not shown). Additional analysis is required to know the role of Rex-1 in placenta-derived cells.

Interestingly, cell-surface markers analyzed using FACS revealed that the placenta-derived mixture cells and clones had the CD45lowCD31AC133CD54+CD29+CD44+ phenotype (Figs. 1DGo, 4BGo), and the expression of CD45 and AC133 antigens differed from MSCs derived from other sources [2, 7, 10, 24]. As for the expression of AC133, the results were negative with FACS yet positive with RT-PCR analysis. This contradictory finding may be due to a damaged AC133 epitope by trypsin treatment of the cells. As for the expression of CD45, some reports showed that unprocessed or fresh MSCs were CD45med,low, whereas cultured MSCs and more mature cells were CD45 [24, 28]. However, as our results showed, the expression of CD45 was low during passages. The CD45low phenotype might be one of the specific characteristics of the placenta-derived cells.

This study showed that the placenta-derived MSC-like cells could be easily isolated and expanded without morphological and characteristic changes in medium supplemented only with FBS. Therefore, the placenta may prove to be an attractive and rich source of MSCs. Further studies are required to better understand the precise nature of placenta-derived cells and to explore their potential clinical applications.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We thank Drs. T. A. Takahashi and N. Watanabe (Division of Cell Processing, Institute of Medical Science, The University of Tokyo, Japan) for significant advice on these placenta-derived cells; Dr. Y. Koshino and Ms. M. Ito (Division of Cellular Therapy, Institute of Medical Science, The University of Tokyo, Japan) for advice and technical support; and Drs. H. Funabiki and S. Akutsu (Kiyosenomori Hospital, Japan) for assistance with cord blood collections.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Liechty KW, MacKenzie TC, Shaaban AF et al. Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nat Med 2000;6:1282–1286.[CrossRef][Medline]

  2. Reyes M, Lund T, Lenvik T et al. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 2001;98:2615–2625.[Abstract/Free Full Text]

  3. Jiang Y, Jahagirdar BN, Reinhardt RL et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;20:1–9.

  4. Bartholomew A, Sturgen C, Siatskas M et al. Mesenchymal stem cells suppress lymphocyte proliferation in vitro and prolong skin graft survival in vivo. Exp Hematol 2002;30:42–48.[CrossRef][Medline]

  5. Gerson SL. Mesenchymal stem cells: no longer second class marrow citizens. Nat Med 1999;5:262–264.[CrossRef][Medline]

  6. Deans RJ, Moseley AB. Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 2000;28:875–884.[CrossRef][Medline]

  7. Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.[Abstract/Free Full Text]

  8. Rao MS, Mattson MP. Stem cells and aging: expanding the possibilities. Mech Aging Dev 2001;122:713–734.

  9. Zvaifler NJ, Marinova-Mutafchieva L,Adams G et al. Mesenchymal precursor cells in the blood of normal individuals. Arthritis Res 2000;2:477–488.[CrossRef][Medline]

  10. Erices A, Conget P, Minguell JJ. Mesenchymal progenitor cells in human umbilical cord blood. Br J Haematol 2000;109:235–242.[CrossRef][Medline]

  11. Romanov YA, Svintsitskaya VA, Smirnov VN. Searching for alternative sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord. STEM CELLS 2003;21:105–110.[Abstract/Free Full Text]

  12. Campagnoli C, Roberts IAG, Kumar S et al. Identification of mesenchymal stem/progenitor cells in human first-trimester fetal blood, liver, and bone marrow. Blood 2001;98:2396–2402.[Abstract/Free Full Text]

  13. Almeida-Porada G, Shabrawy D, Porada C et al. Differentiative potential of human metanephric mesenchymal cells. Exp Hematol 2002;30:1454–1462.[CrossRef][Medline]

  14. Kitamura T, Tange T, Terasawa T et al. Establishment and characterization of a unique human cell line that proliferates dependently on GM-CSF, IL-3, or erythropoietin. J Cell Physiol 1989;140:323–334.[CrossRef][Medline]

  15. Hosoda M, Makino S, Kawabe T et al. Differential regulation of the low affinity Fc receptor for IgE (Fc epsilon R2/CD23) and the IL-2 receptor (Tac/p55) on eosinophilic leukemia cell line (EoL-1 and EoL-3). J Immunol 1989; 143:147–152.[Abstract]

  16. Levenberg S, Golub JS, Amit M et al. Endothelial cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 2002;99:4391–4396.[Abstract/Free Full Text]

  17. Kaufman DS, Hanson ET, Lewis RL et al. Hematopoietic colony-forming cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 2001;98:10716–10721.[Abstract/Free Full Text]

  18. Shamblott MJ, Axelman J, Littlefield JW et al. Human embryonic germ cell derivatives express a broad range of developmentally distinct markers and proliferate extensively in vitro. Proc Natl Acad Sci U S A 2001;98:113–118.[Abstract/Free Full Text]

  19. Bellamy WT, Richter L, Frutiger Y et al. Expression of vascular endothelial growth factor and its receptors in hema-topoietic malignancies. Cancer Res 1999;59:728–733.[Abstract/Free Full Text]

  20. Kehat I, Kenyagin-Karsenti D, Snir M et al. Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest 2001;108:407–414.[CrossRef][Medline]

  21. Schuldiner M,Yanuka O, Itskovitz-Eldor J et al. Effects of eight growth factors on the differentiation of cells derived from human embryonic stem cells. Proc Natl Acad Sci U S A 2000;97:11307–11312.[Abstract/Free Full Text]

  22. Vescovi AL, Parati EA, Gritti A et al. Isolation and cloning of multipotential stem cells from the embryonic human CNS and establishment of transplantable human neural stem cell lines by epigenetic stimulation. Exp Neurol 1999;156:71–83.[CrossRef][Medline]

  23. Zulewski H, Abraham EJ, Gerlach MJ et al. Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 2001;50:521–533.[Abstract/Free Full Text]

  24. Reyes M, Dudek A, Jahagirdar B et al. Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 2002;109:337–346.[CrossRef][Medline]

  25. Deschaseaux F, Gindraux F, Saadi R et al. Direct selection of human bone marrow mesenchymal stem cells using an anti-CD49a antibody reveals their CD45med,low phenotype. Br J Haematol 2003;122:506–517.[CrossRef][Medline]

  26. Ben-Shushan E, Thompson JR, Gudas LJ et al. Rex-1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox-1, binding to an adjacent site. Mol Cell Biol 1998;18:1866–1878.[Abstract/Free Full Text]

  27. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation or self-renewal of ES cells. Nat Genet 2000;24:372–376.[CrossRef][Medline]

  28. Clark E, Wognum AW, Marciniak R et al. Mesenchymal cell precursors from human bone marrow have a phenotype that is direct from cultured mesenchymal cells and are exclusively present in a small subset of CD45lo SH2+ cells. Blood 2001;98:85a.

Received June 6, 2003; accepted for publication March 23, 2004.



This article has been cited by other articles:


Home page
Hum ReprodHome page
J. H. Moon, J. R. Lee, B. C. Jee, C. S. Suh, S. H. Kim, H. J. Lim, and H. K. Kim
Successful vitrification of human amnion-derived mesenchymal stem cells
Hum. Reprod., June 9, 2008; (2008) den202v1.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
K.E. Schwab, P. Hutchinson, and C.E. Gargett
Identification of surface markers for prospective isolation of human endometrial stromal colony-forming cells
Hum. Reprod., April 1, 2008; 23(4): 934 - 943.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. Magatti, S. De Munari, E. Vertua, L. Gibelli, G. S. Wengler, and O. Parolini
Human Amnion Mesenchyme Harbors Cells with Allogeneic T-Cell Suppression and Stimulation Capabilities
Stem Cells, January 1, 2008; 26(1): 182 - 192.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. A. Haniffa, X.-N. Wang, U. Holtick, M. Rae, J. D. Isaacs, A. M. Dickinson, C. M. U. Hilkens, and M. P. Collin
Adult Human Fibroblasts Are Potent Immunoregulatory Cells and Functionally Equivalent to Mesenchymal Stem Cells
J. Immunol., August 1, 2007; 179(3): 1595 - 1604.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Sudo, M. Kanno, K. Miharada, S. Ogawa, T. Hiroyama, K. Saijo, and Y. Nakamura
Mesenchymal Progenitors Able to Differentiate into Osteogenic, Chondrogenic, and/or Adipogenic Cells In Vitro Are Present in Most Primary Fibroblast-Like Cell Populations
Stem Cells, July 1, 2007; 25(7): 1610 - 1617.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
L. Duplomb, M. Dagouassat, P. Jourdon, and D. Heymann
Concise Review: Embryonic Stem Cells: A New Tool to Study Osteoblast and Osteoclast Differentiation
Stem Cells, March 1, 2007; 25(3): 544 - 552.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M.-l. Yen, C.-C. Chien, I.-m. Chiu, H.-I Huang, Y.-C. Chen, H.-I Hu, and B. L. Yen
Multilineage Differentiation and Characterization of the Human Fetal Osteoblastic 1.19 Cell Line: A Possible In Vitro Model of Human Mesenchymal Progenitors
Stem Cells, January 1, 2007; 25(1): 125 - 131.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C.-J. Chang, M.-L. Yen, Y.-C. Chen, C.-C. Chien, H.-I. Huang, C.-H. Bai, and B. L. Yen
Placenta-Derived Multipotent Cells Exhibit Immunosuppressive Properties That Are Enhanced in the Presence of Interferon-{gamma}
Stem Cells, November 1, 2006; 24(11): 2466 - 2477.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
E. N. Olivier, A. C. Rybicki, and E. E. Bouhassira
Differentiation of Human Embryonic Stem Cells into Bipotent Mesenchymal Stem Cells
Stem Cells, August 1, 2006; 24(8): 1914 - 1922.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. L. Weiss, S. Medicetty, A. R. Bledsoe, R. S. Rachakatla, M. Choi, S. Merchav, Y. Luo, M. S. Rao, G. Velagaleti, and D. Troyer
Human Umbilical Cord Matrix Stem Cells: Preliminary Characterization and Effect of Transplantation in a Rodent Model of Parkinson's Disease
Stem Cells, March 1, 2006; 24(3): 781 - 792.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
S. Sartore, M. Lenzi, A. Angelini, A. Chiavegato, L. Gasparotto, P. D. Coppi, R. Bianco, and G. Gerosa
Amniotic mesenchymal cells autotransplanted in a porcine model of cardiac ischemia do not differentiate to cardiogenic phenotypes
Eur. J. Cardiothorac. Surg., November 1, 2005; 28(5): 677 - 684.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
T. Miki, T. Lehmann, H. Cai, D. B. Stolz, and S. C. Strom
Stem Cell Characteristics of Amniotic Epithelial Cells
Stem Cells, October 1, 2005; 23(10): 1549 - 1559.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukuchi, Y.
Right arrow Articles by Tsuji, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukuchi, Y.
Right arrow Articles by Tsuji, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS
http://www.epitomics.com