Stem Cells http://www.stemcellsportal.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sumi, T.
Right arrow Articles by Suemori, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sumi, T.
Right arrow Articles by Suemori, H.

Stem Cells 2004;22:861-872 www.StemCells.com
© 2004 AlphaMed Press

STAT3 Is Dispensable for Maintenance of Self-Renewal in Nonhuman Primate Embryonic Stem Cells

Tomoyuki Sumia, Yasuko Fujimotoa,b, Norio Nakatsujia,c, Hirofumi Suemoria

a Laboratory of Embryonic Stem Cell Research, Stem Cell Research Center, Institute for Frontier Medical Sciences,
b Department of Otolaryngology, Head and Neck Surgery, Graduate School of Medicine, and
c Department of Development and Differentiation, Institute for Frontier Medical Sciences, Kyoto University, Kyoto, Japan

Key Words. LIF • STAT3 • Phosphorylation • Embryonic stem cells • Primate • Self-renewal • Pluripotency

Correspondence: Hirofumi Suemori, Ph.D., Laboratory of Embryonic Stem Cell Research, Stem Cell Research Center, Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. Telephone: 81-75-751-3821; Fax: 81-75-751-3890; e-mail: hsuemori{at}frontier.kyoto-u.ac.jp


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The leukemia inhibitory factor (LIF)/glycoprotein 130 (gp130)/signal transducer and activator of transcription 3 (STAT3) pathway plays an essential role in the maintenance of self-renewal and pluripotency in mouse embryonic stem (ES) cells. However, in primate ES cells, including those from humans and monkeys, LIF alone is not sufficient to maintain self-renewal. The precise role of the LIF/gp130/STAT3 pathway for self-renewal in primate ES cells is still unclear. In this study, we found that stimulation of cynomolgus monkey ES cells with LIF or interleukin (IL)-6/soluble IL-6 receptor leads to STAT3 phosphorylation, an effect seen previously in murine ES cells. Concomitant with this notion, nuclear translocalization and transcriptional activation of STAT3 were observed in a LIF-dependent manner. Moreover, the analysis of a dominant interfering mutant, STAT3F, showed that even though the phosphorylation, nuclear translocalization, and transcriptional activation of endogenous STAT3 after LIF stimulation were completely abrogated by over-expressing STAT3F in monkey ES cells, they continued to proliferate in an undifferentiated state, retaining their pluripotency. These results demonstrate that the LIF/gp130/STAT3 pathway functions in cynomolgus monkey ES cells but is not essential for the maintenance of self-renewal. They also suggest that cynomolgus monkey ES cells, unlike murine ES cells, are maintained in an undifferentiated state through LIF/gp130/STAT3–independent signaling.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Embryonic stem (ES) cells are pluripotent cells that can maintain unlimited and undifferentiated proliferation in vitro [1, 2]. ES cell lines were first established from the inner cell mass of mouse blastocysts and have been shown to retain the ability to differentiate into most specialized cells of the three embryonic germ layers in vitro and in vivo. Because of this developmental potential, ES cells have been used to study cell differentiation during embryogenesis. Moreover, ES cells injected into blastocysts can contribute to all tissues, including the germ cells in the resulting chimeric mice. Thus, murine ES cells have been used to introduce genetic modifications in the production of gene-disrupted mice. Human ES cell lines were established in 1998 and have been shown to have differentiation potency similar to those from mice [3]. Their potential for multilineage differentiation could enable their use in generating an unlimited supply of various cell types and tissues for replacement therapy in human degenerative diseases [4]. Despite the importance of ES cells in regenerative medicine, the molecular mechanisms involved in self-renewal and pluripotency are not completely understood. Furthermore, it is more difficult to maintain human ES cells stably in an undifferentiated state than murine ES cells, making them difficult to exploit for therapeutic use.

In mouse ES cells, several lines of evidence indicate that the leukemia inhibitory factor (LIF)– and interleukin-6 (IL-6)–related cytokines that signal through a common glycoprotein 130 (gp130) receptor play essential roles in maintaining self-renewal [5, 6]. LIF directs ES cell self-renewal through binding a complex comprised of the LIF receptor and gp130, allowing recruitment of JAK kinases that permit the activation of the signal transducer and activator of transcription 3 (STAT3) and mitogen-activated protein kinase (MAPK) pathways. The gp130-mediated activation of STAT3 alone, and not MAPK, is sufficient to sustain self-renewal and retard differentiation of murine ES cells [7, 8]. In contrast, human ES cells lose pluripotency and rapidly differentiate under feeder layer–free culture conditions, even in the presence of LIF [3], suggesting that the LIF signaling pathway may not be fully functional in human ES cells. We have recently established cynomolgus monkey ES cell lines from blastocysts that can be propagated indefinitely in an undifferentiated state [9]. It is intriguing that cynomolgus monkey ES cells show remarkably similar characteristics to human ES cells. Like human ES cells and those from other nonhuman primates [10, 11], undifferentiated propagation of cynomolgus ES cells is dependent on the presence of a feeder layer, and LIF alone cannot support self-renewal. Thus, although important mechanisms controlling self-renewal in murine ES cells would be anticipated to be evolutionarily conserved in their primate homologues, these two cell types seem to differ in their requirement of LIF for self-renewal. Clarification of this distinction, however, requires closer examination of the downstream signals of LIF.

In the present study, we investigated the contribution of the LIF/gp130/STAT3 pathway to the maintenance of self-renewal in cynomolgus monkey ES cells. Our findings indicate that these cells possess an active, intact LIF/gp130/STAT3 signaling pathway but that activation of STAT3 is not involved in maintenance of self-renewal. Furthermore, we suggest that self-renewal of nonhuman primate ES cells could be sustained via an LIF/gp130/STAT3–independent signaling pathway.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction of Expression Plasmids
To create a pCAG/PGKneo construct, a neomycin-resistance cassette (neo) downstream of a PGK-1 promoter derived from pKJ2 was inserted into a pCAGGS vector [12, 13]. To generate a plasmid encoding STAT3{alpha}, full-length mouse STAT3{alpha}cDNA was cloned by reverse transcription polymerase chain reaction (RT-PCR) using the following primers: forward, 5'-AGCAGGATGGCTCAGTGGAAC-3'; and reverse, 5'-GTTTCAGCTCCTCACATGGGG-3'. The PCR product was ligated into a pGEM-T vector (Promega, Madison, WI). To generate an expression plasmid encoding myc-tagged STAT3{alpha}in a pCAGGS vector, a cDNA fragment was amplified by PCR using the following primers: forward, 5'-CGGAATTCACCATGGAGCAGAAGCTTATCAGCGAGGAGGACCTGGGATCCATGGCTCAGT GGAACCAGCT-3' (the underlined segment corresponds to the sense sequence encoding the c-myc epitope); and reverse, 5'-CGGAATTCGTTTCAGCTCCTCACATGGG-3'. The cDNA obtained after PCR encodes an N-terminal c-myc epitope peptide (EQKLISEEDL) followed by full-length mouse STAT3{alpha}. The PCR product was digested with EcoRI and was ligated to an EcoRI-digested pCAG/PGKneo vector. A cDNA encoding a dominant-negative mutant of STAT3{alpha} (Y705F) was constructed in which a substitution of Tyr705 with a Phe was introduced using the GeneEditorTM in vitro Site-Directed Mutagenesis System (Promega). The sequence of these expression plasmids was confirmed by nucleotide sequence analysis.

Culture of ES Cells and Formation of Embryoid Bodies
The cynomolgus monkey ES cell lines CMK6 and CMK9 were cultured as previously described [9, 14]. Briefly, they were plated as colonies and cultured on feeder layers of either mouse embryonic fibroblasts (MEFs) or SL10 cells that had been mitotically inactivated with mitomycin C. Cells were cultured in ES medium consisting of Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Sigma, St. Louis), 20% knockout serum replacement (Invitrogen, Carlsbad, CA), 0.1 mM 2-mercaptoethanol (Sigma), minimal essential medium (MEM) nonessential amino acids (Sigma), 2 mM L-glutamine (Sigma), and 1 mM sodium pyruvate (Sigma). Basic fibroblast growth factor (bFGF) 10 ng/ml (Upstate Biotechnology, Lake Placid, NY) was added to the CMK9-cell culture medium.

The mouse R1 ES cell line was cultured on MEFs in DMEM supplemented with 15% fetal bovine serum, 0.1 mM 2-mercaptoethanol, MEM nonessential amino acids, and 1,000 U/ml mouse LIF (CHEMICON International, Temecula, CA).

For embryoid body (EB) formation, ES cells were treated with collagenase IV (1 mg/ml) and detached from feeder cells by gentle pipetting to avoid dissociation of colonies. The cells were cultured in suspension in petri dishes. EBs were grown in ES medium for 10 days and then were collected for preparation of total RNA.

Preparation of Extracellular Matrix-Coated and Matrigel-Coated Dishes
Extracellular matrix (ECM)–coated dishes were prepared according to previously described protocols, with minor modifications [15]. Mitomycin C–treated MEFs were seeded at 2 x 104 cells/cm2 on 35-mm tissue culture dishes and maintained in ES medium for 2 days. The medium was replaced with phosphate-buffered saline (PBS) containing 20 mM EDTA, and the dishes were incubated overnight at 4ºC. PBS/EDTA was carefully removed, and the cells were rinsed with PBS without disturbing the ECM secreted by the MEFs on the surface of the tissue culture dishes. To prepare Matrigel-coated dishes, tissue culture dishes were incubated at room temperature for 1 hour with Matrigel (Becton, Dickinson, Bedford, MA) that had been diluted 1:20 with cold ES medium.

For feeder-free culture of ES cells, ES cells were dissociated into small clumps and incubated in gelatin-coated dishes at 37ºC for 1 hour to separate ES cells from feeder cells. Floating clumps of ES cells were collected, cultured on matrix-coated dishes for 3 days, and subjected to analyses as described below.

Transfection
Electroporation of cynomolgus monkey ES cells was performed as previously described [16]. In brief, subconfluent ES cells were gently dissociated into small clumps and resuspended in PBS, and 107 cells were transfected with 50 µg of linearized plasmid DNA by electroporation with a Gene Pulser (Bio-Rad, Hercules, CA). Cells were cultured on the feeder layers in ES medium. To establish stable ES clones, the transfected cells were selected in the presence of 100 µg/ml of G418 (Sigma). After 10 days of selection, resistant colonies were recovered and plated on new feeder layers.

For transient transfection, cynomolgus monkey ES cells cultured on feeder cells were transfected with Opti-MEM (Invitrogen) containing 5 µg plasmid DNA in complex with LipofectamineTM 2000 (Invitrogen). After a 2-hour incubation, the medium was replaced with ES medium, and the cells were cultured for an additional 22 hours. The transfected cells were treated with or without LIF and then lysed.

R1 cells were trypsinized and resuspended in PBS, and 107 cells were electroporated with 25 µg of linearized plasmid DNA at 250 V and 500 µF in a 0.4-cm cuvette using a Gene Pulser (Bio-Rad). Cells were cultured on MEF feeder layers and selected in the presence of 200 µg/ml G418 for 7 days. Resistant colonies were fixed and stained for alkaline phosphatase activity using Vector Blue substrate or Vector Red substrate (Vector Laboratories, Burlingame, CA). The number of colonies was scored by microscopic examination.

Immunoprecipitation and Immunoblot Analysis
Cynomolgus monkey ES cells were transiently transfected with an expression plasmid as described above and then cultured for 24 hours. The cells were treated with 1,000 U/ml human LIF or a combination of 200 ng/ml human IL-6 (PeproTech Inc., Rocky Hill, NJ) and 250 ng/ml soluble IL-6 receptor (sIL-6R) (Calbiochem, San Diego) for 15 minutes, and then they were lysed in 250 ml lysis buffer (50 mM Tris-HCl [pH 7.5], 0.3 M NaCl, 25 mM ß-glycerophosphate, 10 mM NaF, 1 mM Na3VO4, 1% Triton X-100, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 2 µg/ml leupeptin, and aprotinin) and incubated on ice for 30 minutes. After centrifugation, the supernatant was incubated for 12 hours at 4ºC with anti-c-myc (Roche, Indianapolis) antibody and 5 µl protein G-sepharose (Amersham Biosciences Corp., Piscat-away, NJ). Protein G-sepharose beads were washed three times with lysis buffer and dissolved in SDS-PAGE sample buffer. The immunoprecipitates and cell lysates were each separated by SDS-PAGE, electroblotted onto a polyvinylidene difluoride membrane (Bio-Rad), and probed with primary antibodies. Anti-STAT3, anti-phospho-STAT3 (Tyr705 and Ser727), and anti-Oct-3/4 antibodies were purchased from Cell Signaling Technology (Beverly, MA) and Santa Cruz Biotechnology (Santa Cruz, CA), respectively. After incubation with a horseradish peroxidase (HRP)-conjugated secondary antibody (DakoCytomation, Glostrup, Denmark), proteins reacting with these antibodies were detected using Western Blotting Luminol Reagent (Santa Cruz Biotechnology) and analyzed by autoradiography.

Immunocytochemical and Immunofluorescence Analysis
To analyze stem cell markers, ES cells were fixed with 3.7% formaldehyde in PBS for 20 minutes. After one wash with PBS, alkaline phosphatase activity was detected with Vector Blue substrate (Vector Laboratories). The fixed cells were also stained with anti-Oct-3/4 or anti-SSEA-4 antibodies (CHEMICON International). After incubation with an HRP-conjugated secondary antibody, Oct-3/4 and SSEA-4 localization was visualized using diaminobenzidine as a substrate. The staining patterns were analyzed by light microscopy.

For immunofluorescence staining, fixed cells were treated with 100% methanol for 5 minutes at –20°C or 0.2% Triton X-100 in PBS for 5 minutes at room temperature. After incubation with PBS containing 2% bovine serum albumin and 3% normal goat serum for 15 minutes at room temperature, cells were washed twice with PBS. Cells were incubated with primary antibodies in PBS containing 2% bovine serum albumin and 3% normal goat serum for 1 hour at room temperature, followed by incubation with secondary antibodies under the same conditions. Alexa FluorTM 488-conjugated anti-rabbit immunoglobulin G (IgG) and Alexa FluorTM 546-conjugated anti-mouse IgG were purchased from Molecular Probes (Eugene, OR). Cells were washed three times with PBS, mounted on glass slides, and then analyzed using a LSM510 confocal laser-scanning microscope (Carl Zeiss, Oberkochen, Germany).

RT-PCR
Total RNA was extracted using an RNeasy kit (QIAGEN, Valencia, CA) from ES cells or 10-day-old EBs according to the manufacturer’s protocol. cDNA was synthesized from 5 µg of total RNA using Superscript II reverse transcriptase (Invitrogen). PCR reactions were optimized to allow semi-quantitative comparisons within the log phase of amplification. Gene-specific primers were designed based on published sequences as follows: SOCS-3 (656 bp), 5'-ATGGTCACC CACAGCAAG-3' and 5'-TCCAGGAACTCCCGAATG-3'; Nanog (789 bp), 5'-CAAATGTCTTCTACTGAGATG-3' and 5'-TTACATATCTTCAGGTTGCAC-3'; albumin (229 bp), 5'-GCATCCTGATTACTCTGACATG-3' and 5'-CTTGGT GTAACGAACTAATTGC-3'; {alpha}-fetoprotein (232 bp), 5'-GGGAGCGGCTGACATTATTA-3' and 5'-CACCCTGAGC TTGACACAGA-3'; {alpha}-myosin heavy chain (413 bp), 5'-GTCATTGCTGAAACCGAGAATG-3' and 5'-GCAAAG TACTGGATGACACGCT-3'; Musashi1 (498 bp), 5'-CGAGCTCGACTCCAAAACAATTGACC-3' and 5'-TCT ACACGGAATTCGGGGAACTGGTA-3'; neurofilament 68KD (379 bp), 5'-GTTCAAGAGCCGCTTCAC-3' and 5'-CACGCTGGTGAAACTGAG-3'; Oct-3/4 (219 bp), 5'-GAG AACAATGAGAACCTTCAGGAGA-3' and 5'-TTCTG GCGCCGGTTACAGAACCA-3'; and GAPDH (470 bp), 5'-GGATTTGGCCGTATTGG-3' and 5'-TCATGGATGAC CTTGGC-3'.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LIF-Induced Tyrosine Phosphorylation of STAT3 in Monkey ES Cells
Although LIF treatment alone can maintain murine ES cells in an undifferentiated state, it cannot do so in primate ES cells, such as those from human and monkey. STAT3 activation induced by LIF is essential for self-renewal of murine ES cells, but the downstream signaling pathway in primate ES cells has not been well examined. It is generally thought that the molecular mechanisms underlying cell growth and differentiation are conserved among mammals; consequently, it is thought that the inability of primate ES cells to respond to LIF results from some downstream obstruction of the LIF/STAT3 signaling pathway. Therefore, we examined whether STAT3 is activated by phosphorylation at specific residues in response to LIF. To examine this, we constructed an expression plasmid for myc-tagged STAT3, which could be distinguished from endogenous STAT3, and transiently transfected it into CMK6 and CMK9 cynomolgus monkey ES cell lines using a lipofection reagent. Exogenous myc-tagged STAT3 was detected in cocultures of either CMK6 or CMK9 cells together with MEF or SL10 feeder cells, but not in cells transfected with empty vector (Mock) or in feeder cells alone (Figs. 1A, 1BGo, left), indicating that the plasmid for myc-tagged STAT3 was mainly introduced into ES cells. To evaluate whether cynomolgus monkey ES cells can respond to LIF signaling, we analyzed the phosphorylation state of STAT3 in transfected ES cells using a specific antibody that recognizes activated STAT3 that has been phosphorylated at the Tyr-705 residue. Western blotting of total cell extracts revealed that tyrosine phosphorylation of STAT3 was induced by LIF in both feeder cells alone and in ES cell/feeder cell cocultures (Figs. 1A, 1BGo, left). Immunoprecipitation of these extracts with an anti-myc antibody revealed that exogenous myc-tagged STAT3 expressed in ES cells was phosphorylated at the tyrosine residue in a LIF-dependent manner (Figs. 1A, 1BGo, right). These results indicate that exogenous STAT3 expressed in cynomolgus monkey ES cells is responsive to LIF signaling.



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Tyrosine phosphorylation of overexpressed STAT3 induced by LIF and IL-6/sIL-6R in CMK6 (A and C) and CMK9 (B and D) cells. Embryonic stem cells cultured on MEFs or SL10 feeder cells were transfected with empty vector (Mock) or myc-tagged STAT3 and then stimulated with LIF or IL-6/sIL-6R for 15 minutes. The cell lysates were immunoprecipitated using anti-myc antibody and then subjected to immunoblotting. Immunoblots of cell lysates and IPs were sequentially probed with antibodies specific for phosphorylated (pY705, pS727), nonphosphorylated, and myc-tagged STAT3. Abbreviations: IL-6, interleukin 6; IP, immunoprecipitate; MEF, mouse embryonic fibroblast; sIL-6R, soluble interleukin 6 receptor.

 
It has been reported that STAT3 is also activated by several different cytokines, including the IL-6 family of cytokines, which shares a common gp130 receptor [17]. Furthermore, the self-renewal of murine ES cells is maintained by a combination of IL-6 and sIL-6R [18, 19]. To address whether STAT3 is also activated by IL-6/sIL-6R in cynomolgus monkey ES cells, transfected cells were treated with LIF or IL-6/sIL-6R, and the cell extracts were immunoprecipitated using an anti-myc antibody. Immunoprecipitation of myc-tagged STAT3 demonstrated a prominent increase in tyrosine phosphorylation in response to LIF (Figs. 1C, 1DGo, right). Likewise, an increase in tyrosine-phosphorylated STAT3 was also detected in cells stimulated with IL-6/sIL-6R (Figs. 1C, 1DGo, right). In addition to tyrosine phosphorylation, it has been reported that serine phosphorylation of STAT3 is definitely required for full transcriptional activity [20]. Therefore, we analyzed the serine phosphorylation of STAT3 using a specific antibody that recognizes Ser-727–phosphorylated STAT3. As shown in Figures 1C and 1DGo, left, an increase in the level of Ser-727–phosphorylated STAT3 was observed after both LIF and IL-6/sIL-6R treatment in total cell extracts from ES cell/feeder cell cocultures. In contrast, when the cell extracts were immunoprecipitated using the anti-myc antibody, STAT3 expressed in ES cells was constitutively phosphorylated at Ser-727, independent of LIF and IL-6/sIL-6R treatment (Figs. 1C, 1DGo, right). Similar results were obtained when myc-tagged STAT3 was expressed in murine ES cells (data not shown). These data indicate that serine phosphorylation of STAT3 in cynomolgus monkey ES cells, distinct from feeder cells, does not significantly change upon the activation of gp130 signaling.

To further examine the phosphorylation of endogenous STAT3 in cynomolgus monkey ES cells, we developed a feeder-free culture system to eliminate contamination of MEF proteins. A recent report that undifferentiated human ES cells can be maintained on laminin or Matrigel, an extra-cellular matrix substrate, supplemented with MEF-conditioned media suggests that components of the ECM and soluble factors secreted by MEFs may be important for maintaining undifferentiated ES cells [21]. Therefore, we attempted to culture ES cells on ECM secreted by MEFs. MEFs were detached with an EDTA solution, allowing the matrix proteins to remain firmly attached to the culture dish, and then ES cells were seeded onto these MEF-secreted matrix-coated dishes. As shown in Figure 2AGo, CMK6 cells cultured on ECM showed a typical undifferentiated morphology, with a high nuclear to cytoplasmic ratio, similar to cells cultured on MEFs. To assess the degree to which these cells were truly undifferentiated, we used immunocytochemical analysis to examine the expression of markers of undifferentiation, such as alkaline phosphatase and Oct-3/4, a key transcription factor for ES cell self-renewal [22]. CMK6 cells cultured on ECM exhibited expression of alkaline phosphatase and nuclear Oct-3/4 at a level comparable to that of cells cultured on MEFs (Fig. 2AGo), and we could successfully maintain them in the undifferentiated state for limited numbers of passages (at least 2 weeks). In contrast, ES colonies developed a differentiated morphology, with markedly reduced expression of alkaline phosphatase and Oct-3/4, when ES cells were cultured on Matrigel without feeder cells (Fig. 2AGo). These data suggest that adhesion to the ECM or ECM-trapped soluble factors produced by MEFs is important for ES cell self-renewal. Under these culture conditions, we examined the state of endogenous STAT3 phosphorylation in undifferentiated CMK6 cells with or without LIF. Consistent with the data in Figure 1Go, tyrosine phosphorylation of endogenous STAT3 was induced by LIF treatment, whereas serine phosphorylation of STAT3 was not (Fig. 2BGo). Taken together, these results indicate that, in response to LIF, STAT3 in cynomolgus monkey ES cells is phosphorylated at the tyrosine residue that is required for dimerization and nuclear translocation.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 2. Tyrosine phosphorylation of endogenous STAT3 in CMK6 cells. (A): Expression of stem cell markers. CMK6 cells were cultured on MEFs, ECM, or Matrigel without feeder cells for 3 days and then stained for ALP and Oct-3/4. (B): Tyrosine phosphorylation of endogenous STAT3 induced by LIF. CMK6 cells cultured on ECM without feeder cells for 3 days were treated with or without LIF for 15 minutes, and then cell extracts were subjected to immunoblotting with antibodies against phosphorylated (pY705, pS727) and nonphosphorylated STAT3. Experiments were done in duplicate. Abbreviations:ALP, alkaline phosphatase; ECM, MEF-secreted matrix; MEF, mouse embryonic fibroblast.

 
LIF-Induced and IL-6/sIL-6R–Induced Nuclear Translocation of STAT3 in Monkey ES Cells
In response to cytokines and growth factors, phosphorylated STAT3 dimerizes, translocates to the nucleus, and binds specific DNA promoter sequences [17]. Therefore, we analyzed the changes in subcellular localization of STAT3 in cynomolgus monkey ES cells in response to cytokine treatment. In untreated cells, STAT3 was distributed diffusely in the cytoplasm and the nucleus, whereas after LIF treatment STAT3 was concentrated in the nucleus in both CMK6 and CMK9 cells (Figs. 3A, 3BGo). Similar nuclear translocation of STAT3 was observed when the cells were stimulated by IL-6/sIL-6R (Fig. 3AGo). Furthermore, tyrosine-phosphorylated STAT3 was only observed in the nucleus after LIF and IL-6/sIL-6R stimulation (Figs. 3A, 3BGo). These results indicate that STAT3 in cynomolgus monkey ES cells is phosphorylated and translocates to the nucleus after gp130 activation.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. Nuclear translocation of STAT3 induced by LIF and IL-6/sIL-6R in CMK6 (A) and CMK9 (B) cells. ES cells cultured on feeder cells were treated with or without LIF or IL-6/sIL-6R for 15 minutes, and then cells were fixed and stained with antibodies against phosphorylated (pY705) and nonphosphorylated STAT3. Dotted lines show the boundary between ES cells and feeder cells. Bar = 100 µm. Abbreviations: ES, embryonic stem; IL-6, interleukin 6; sIL-6R, soluble interleukin 6 receptor.

 
STAT3 Is Not Essential for the Maintenance of Self-Renewal in Monkey ES Cells
On the basis of the above observations, we reasoned that activation of STAT3 signaling might maintain cynomolgus monkey ES cells in an undifferentiated state, as it does for murine ES cells. When CMK6 cells were cultured on Matrigel-coated dishes without the feeder layer for 3 days, however, they uniformly differentiated, adopting a flattened, epithelial morphology with reduced expression of alkaline phosphatase and Oct-3/4, even in the presence of LIF or IL-6/sIL-6R (Fig. 4Go). To additionally investigate whether STAT3 can contribute to the self-renewal signaling of monkey ES cells, we attempted to compete against endogenous STAT3 by overexpressing a dominant interfering mutant of STAT3 (STAT3F), in which Tyr-705 was replaced with a phenylalanine residue. High levels of STAT3F expression have been shown to strongly induce differentiation in murine ES cells [23, 24]. We first tested the effect of overexpressed STAT3F on proliferation of undifferentiated murine ES cells. Vectors encoding wild-type STAT3 and STAT3F were transfected into R1 cells, a murine ES cell line, and stable transfectants were recovered by selection in G418 for 7 days. The differentiation state of these cells was assessed by morphology and alkaline phosphatase activity. As shown in Figure 5Go, more than 80%–95% of colonies expressing either empty vector (Mock) or wild-type STAT3 were undifferentiated. In contrast, cells expressing STAT3F underwent morphological differentiation and exhibited reduced alkaline phosphatase activity, even in the presence of LIF. These data are consistent with previous observations [23, 24] and confirm that STAT3 is a key factor in the maintenance of self-renewal in murine ES cells.



View larger version (100K):
[in this window]
[in a new window]
 
Figure 4. Differentiation of cynomolgus monkey embryonic stem cells in a feeder cell–free culture. CMK6 cells were cultured on feeder cells or Matrigel-coated dishes in the absence of feeder cells with or without LIF (1,000 U/ml) or IL-6/sIL-6R (200/250 ng/ml). After 3 days of culture, cells were stained for ALP and Oct-3/4. Abbreviations:ALP, alkaline phosphatase; IL-6, interleukin 6; MEF, mouse embryonic fibroblast; sIL-6R, soluble interleukin 6 receptor.

 


View larger version (97K):
[in this window]
[in a new window]
 
Figure 5. Differentiation of murine ES cells induced by STAT3F expression. R1 cells were transfected with empty vector (Mock), wild-type STAT3, or STAT3F and cultured with ES medium containing 200 µg/ml G418 for 7 days. The surviving colonies were visualized by ALP staining, and the numbers of undifferentiated or differentiated colonies were scored as a percentage of the number formed in the presence of G418 (right). Experiments were repeated at least three times with similar results. Three colony types were observed as indicated (left): undifferentiated cells (top), partly differentiated cells (middle), and differentiated cells (bottom).Abbreviations:ALP, alkaline phosphatase; ES, embryonic stem.

 
Next, we exploited the above vectors to determine if STAT3 plays a role in maintaining self-renewal in monkey ES cells. Stable transfectants expressing either the wild-type STAT3 or the dominant-negative mutant STAT3F were established by G418 selection for 10 days, and then colonies were stained with alkaline phosphatase as a marker of undifferentiation. As shown in Figure 6Go, stable transfectants harboring either an empty vector or wild-type STAT3 formed G418-resistant undifferentiated ES colonies with similar frequencies. Unexpectedly, we were also able to establish undifferentiated ES cells in those colonies overexpressing STAT3F. Even after prolonged culture of greater than 2 months, these cells did not show any morphological signs of differentiation, as was observed for murine ES cells. No differentiated ES colonies were observed in any of three independent experiments.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 6. Formation of stem cell colonies followed by transfection of STAT3 derivatives in cynomolgus monkey ES cells. CMK6 and CKM9 cells cultured on feeder cells were transfected with empty vector (Mock), wild-type STAT3, and STAT3F and cultured with ES medium containing 100 µg/ml G418 for 10 days. The surviving colonies were visualized by alkaline phosphatase staining (left), and the number of colonies was counted (right). No differentiated colonies were observed in three independent experiments. Data are the averages of three independent experiments; bars indicate standard deviations (n = 3). Abbreviation: ES, embryonic stem.

 
To further clarify these findings, we selected several transfectants expressing comparably high levels of exogenous STAT3, as assessed by immunoblotting, and used at least two independent clones for each transfectant in the following experiments. All of these clones had normal expression of stem cell markers, such as alkaline phosphatase, the cell-surface antigen SSEA-4, and the transcription factor Oct-3/4 (Figs. 7Go, 8BGo). To examine whether STAT3F overexpression competes with endogenous STAT3 function, LIF-induced STAT3 activation was determined by immunoblotting. In wild-type STAT3-and STAT3F-overexpressing cells, expression of the respective STAT3 proteins was approximately 10-fold higher than that of control cells transfected with empty vector (Mock) (Fig. 8AGo). In control cells and wild-type STAT3 clones, LIF induced tyrosine phoshorylation of STAT3, whereas the STAT3F clone had diminished levels of LIF-induced STAT3 phosphorylation (Fig. 8AGo). In contrast, a comparable level of Oct-3/4 expression was observed in all transformants. Furthermore, immunofluorescent visualization of phospho-STAT3 showed that nuclear translocation of phospho-STAT3 was induced by LIF in cells expressing either empty vector or wild-type STAT3 but was completely abolished in the STAT3F clones (Fig. 8BGo).



View larger version (127K):
[in this window]
[in a new window]
 
Figure 7. Expression of stem cell markers in STAT3 transfectants. Recovered stable embryonic stem clones expressing empty vector (Mock), wild-type STAT3, and STAT3F were fixed and stained for ALP and a cell-surface antigen, SSEA-4. Typical data, with two independent clones, one of each type, are shown.Abbreviation:ALP, alkaline phosphatase.

 


View larger version (36K):
[in this window]
[in a new window]
 
Figure 8. Inhibition of endogenous STAT3 activity by expression of the STAT3F mutant. (A): Tyrosine phosphorylation of STAT3 induced by LIF. ES clones expressing empty vector (Mock), wild-type STAT3, and STAT3F were treated with or without LIF for 15 minutes, and then cell extracts were subjected to immunoblotting with antibodies against phosphorylated and nonphosphorylated STAT3 and against Oct-3/4. (B): LIF-induced nuclear translocation of phosphorylated STAT3. ES clones were treated with or without LIF for 15 minutes, and then cells were fixed and stained with antibodies against phosphorylated STAT3 and Oct-3/4. Bar = 100 µm. (C): RT-PCR analysis of SOCS-3 and Nanog expression in CMK-6 cells. ES clones expressing empty vector (Mock), wild-type STAT3, and STAT3F were cultured on extracellular matrix for 3 days. The cells were stimulated with or without LIF (1,000 U/ml) for 1 hour, and then total RNA was isolated from them. Expression levels of SOCS-3, Nanog, and GAPDH were analyzed by RT-PCR. Abbreviations: ES, embryonic stem; RT-PCR, reverse transcriptase polymerase chain reaction.

 
We also examined whether overexpression of STAT3F blocks the transcriptional activity of endogenous STAT3. Using RT-PCR, we analyzed the induction of SOCS-3, a STAT3 target gene whose expression is induced by LIF [17]. As shown in Figure 8CGo, SOCS-3 mRNA was highly induced by LIF in cells expressing empty vector or wild-type STAT3 but was completely inhibited in the STAT3F clones. In contrast, expression of Nanog, which has been recently identified as a homeodomain transcription factor that is essential for the LIF signaling–independent maintenance of self-renewal in murine ES cells [25, 26], did not substantially change as a consequence of STAT3 expression. Likewise, GAPDH expression, examined as a control, was also not changed (Fig. 8CGo). These results indicate that the expression of STAT3F inhibits endogenous STAT3 in a dominant-negative manner.

Finally, we asked whether the blockage of STAT3 signaling affects the potential of ES cells to differentiate into all three embryonic germ layers. For this purpose, stable ES clones were cultured for 10 days in suspension to form EBs, at which point we analyzed the expression of several lineage-specific genes by RT-PCR (Fig. 9Go). EBs formed from each STAT3- or STAT3F-expressing clone were shown to express markers for all three germ layers: endoderm (albumin and {alpha}-fetoprotein), mesoderm ({alpha}-myosin heavy chain), and ectoderm (musashi1 and neurofilament 68KD). On the other hand, Oct-3/4, a marker of undifferentiated ES cells, was downregulated during differentiation. These results demonstrate that overexpression of either wild-type STAT3 or dominant-negative STAT3F does not affect the pluripotency of monkey ES cells. Taken together, these data clearly demonstrate that the LIF/gp130/STAT3 pathway is dispensable for the maintenance of self-renewal in cynomolgus monkey ES cells.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 9. In vitro differentiation of stable ES clones expressing STAT3 derivatives. ES clones expressing empty vector (Mock), wild-type STAT3, and STAT3F were cultured in suspension for 10 days without feeder cells to form EBs. Total RNA was isolated from undifferentiated ES cells and 10-day-old EBs and then analyzed by RT polymerase chain reaction for the expression of the following lineage-specific markers: endoderm, albumin (Alb), and {alpha}-fetoprotein (AFP); mesoderm and {alpha}-myosin heavy chain ({alpha}MHC); and ectoderm, musashi1, and neurofilament 68KD (NF68KD). Oct-3/4 and GAPDH served as an undifferentiated ES cell marker and internal control, respectively. Abbreviations: EB, embryoid body; ES, embryonic stem; RT, reverse transcriptase.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In murine ES cells, activation of the LIF/gp130/STAT3 signaling pathway efficiently supports ES-cell self-renewal, whereas in primates, including humans and monkeys, ES cells do not respond to LIF signaling in a similar fashion and require feeder cells to maintain their undifferentiated state. Because molecular pathways similar to the LIF/gp130/STAT3 signaling cascade that supports self-renewal of ES cells are expected to be conserved between primates and mice, it is important to determine the underlying cause of the different effects of this pathway on ES cell differentiation. Therefore, we examined STAT3 phosphorylation in response to LIF treatment in cynomolgus monkey ES cells. LIF treatment induced phosphorylation of Tyr-705 in STAT3, which then was translocated from the cytoplasm to the nucleus. We also confirmed that STAT3 activates transcription of specific genes on LIF treatment. These results indicate that cynomolgus monkey ES cells, like those from mice, do use LIF/gp130/STAT3 signaling to activate a common set of tar get genes. However, analysis using a dominant-negative mutant of STAT3 showed that self-renewal of cynomolgus monkey ES cells, unlike that of murine ES cells, is independent of STAT3 activity. In the context of complete block of endogenous STAT3 function, undifferentiated ES cells were obtained that were able to normally differentiate into all three germ layers in vitro. These findings indicate that STAT3 is not required for the maintenance of self-renewal in cynomolgus monkey ES cells.

Because multiple lines of evidence indicate that gp130-mediated activation of STAT3 plays an essential role in murine ES cell self-renewal [5, 6], it was a surprise that such an important mechanism supporting the maintenance of the undifferentiated state does not function equivalently in primate ES cells despite the clear presence of LIF-induced STAT3 activation. It is already known that in murine ES cells STAT3 regulates the expression of several genes, including c-fos, junB, and SOCS-3, but these genes do not appear to have significant functions in ES cells [5, 6, 17]. Although crucial STAT3 target genes have not been identified in ES cells, our present data suggest that there may be a fundamental difference between mouse and primate ES cells with regards to these targets. On the other hand, recent evidence has shown that the expression of LIF signaling components such as LIFR, gp130, and STAT3 in human ES cells is far less than in murine ES cells. In addition, it has been reported that SOCS-1, which inhibits STAT3 signaling, is enriched in human ES and EC cells but not in murine ES and EC cells [2730]. These results were thought to underlie the difference in response to LIF between human and murine ES cells. However, as we have shown, even though activation of STAT3 is induced by LIF, STAT3 signaling is not necessary for self-renewal of cynomolgus monkey ES cells. Our findings suggest that there exist pathways other than LIF/STAT3 that maintain self-renewal of primate ES cells. Previous studies in which genes involved in LIF signaling were specifically disrupted in mice indicate that they are dispensable for embryonic development before gastrulation [3135]. These findings suggest that there is an unknown signaling pathway that is functionally redundant to LIF signaling. This notion is additionally supported by evidence that an unidentified ES cell renewal factor (ESRF) can maintain the pluripotency of murine ES cells independently of LIF/gp130/STAT3 signaling [36]. It has also been reported that undifferentiated human ES cells can be maintained in a feeder- and serum-free culture system when cultured on laminin- or Matrigel-coated dishes supplemented with MEF-conditioned media or a combination of bFGF, transforming growth factor ß(TGF-ß), and LIF [21, 37]. Furthermore, a recent report demonstrated that activation of the canonical Wnt pathway is sufficient to maintain self-renewal of both human and murine ES cells [38]. Although the identification of these ESRF and MEF-derived self-renewal factors as Wnt or TGF-ßremains to be established, these observations demonstrate at the very least that the LIF/gp130/STAT3 pathway is not necessary for self-renewal of ES cells and that primate ES cells use mainly an as-yet unidentified signaling pathway for maintaining their stem cell identity.

Several intrinsic factors have been shown to be essential for the establishment of self-renewal and the suppression of lineage differentiation in murine ES cells. Oct-3/4, a POU (Pit, Oct, and Unc)-family transcription factor, is specifically expressed in pluripotent cells such as ES cells, early embryonic cells, and germ cells [39]. Inactivation of Oct-3/4 in ES cells results in the loss of pluripotency and spontaneous differentiation. However, Oct-3/4 expression alone does not seem to be sufficient for maintaining the self-renewal of ES cells, which typically remain dependent on LIF signaling [22]. On the other hand, the recently identified homeobox transcription factor Nanog has been shown to be essential in ES cell self-renewal [25, 26]. Interestingly, elevated expression of Nanog in ES cells is sufficient to sustain self-renewal independent of LIF signaling. Thus, Nanog seems to play a role in the LIF-independent signaling pathway for self-renewal, but the contribution of this pathway in primate ES cell self-renewal is still unclear.

In summary, we conclude that even though the LIF/gp130/STAT3 pathway functions in cynomolgus monkey ES cells, it is dispensable for the maintenance of ES cell self-renewal. Our findings clearly provide evidence of a fundamental distinction between primate and murine ES cells in the role of LIF signaling. Additional investigation is needed to determine why the response to LIF signaling in self-renewal is different between these two species.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This work was supported in part by grants from The National Bio Resource Project and the Japan Society for the Promotion of Science.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:154–156.[CrossRef][Medline]

  2. Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 1981;78:7634–7638.[Abstract/Free Full Text]

  3. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  4. Smith AG. Embryo-derived stem cells: of mice and men. Annu Rev Cell Dev Biol 2001;17:435–462.[CrossRef][Medline]

  5. Burdon T, Chambers I, Stracey C et al. Signaling mechanisms regulating self-renewal and differentiation of pluripotent embryonic stem cells. Cells Tissues Organs 1999;165:131–143.[CrossRef][Medline]

  6. Burdon T, Smith A, Savatier P. Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol 2002;12:432–438.[CrossRef][Medline]

  7. Burdon T, Stracey C, Chambers I et al. Suppression of SHP-2 and ERK signalling promotes self-renewal of mouse embryonic stem cells. Dev Biol 1999;210:30–43.[CrossRef][Medline]

  8. Matsuda T, Nakamura T, Nakao K et al. STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J 1999;18:4261–4269.[CrossRef][Medline]

  9. Suemori H, Tada T, Torii R et al. Establishment of embryonic stem cell lines from cynomolgus monkey blastocysts produced by IVF or ICSI. Dev Dyn 2001;222:273–279.[CrossRef][Medline]

  10. Thomson JA, Kalishman J, Golos TG et al. Isolation of a primate embryonic stem cell line. Proc Natl Acad Sci U S A 1995;92:7844–7848.[Abstract/Free Full Text]

  11. Thomson JA, Kalishman J, Golos TG et al. Pluripotent cell lines derived from common marmoset (Callithrix jacchus) blastocysts. Biol Reprod 1996;55:254–259.[Abstract]

  12. Boer PH, Potten H, Adra CN et al. Polymorphisms in the coding and noncoding regions of murine Pgk-1 alleles. Biochem Genet 1990;28:299–308.[CrossRef][Medline]

  13. Niwa H, Yamamura K, Miyazaki J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 1991;108:193–199.[CrossRef][Medline]

  14. Suemori H, Nakatsuji N. Growth and differentiation of cynomolgus monkey ES cells. Methods Enzymol 2003;365:419–429.[Medline]

  15. Rathjen PD, Toth S, Willis A et al. Differentiation inhibiting activity is produced in matrix-associated and diffusible forms that are generated by alternate promoter usage. Cell 1990;62:1105–1114.[CrossRef][Medline]

  16. Furuya M,Yasuchika K, Mizutani K et al. Electroporation of cynomolgus monkey embryonic stem cells. Genesis 2003;37:180–187.[CrossRef][Medline]

  17. Levy DE, Darnell JE Jr. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 2002;3:651–662.[CrossRef][Medline]

  18. Yoshida K, Chambers I, Nichols J et al. Maintenance of the pluripotential phenotype of embryonic stem cells through direct activation of gp130 signalling pathways. Mech Dev 1994;45:163–171.[CrossRef][Medline]

  19. Nichols J, Chambers I, Smith A. Derivation of germline competent embryonic stem cells with a combination of interleukin-6 and soluble interleukin-6 receptor. Exp Cell Res 1994;215:237–239.[CrossRef][Medline]

  20. Wen Z, Zhong Z, Darnell JE Jr. Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 1995;82:241–250.[CrossRef][Medline]

  21. Xu C, Inokuma MS, Denham J et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 2001;19:971–974.[CrossRef][Medline]

  22. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000;24:372–376.[CrossRef][Medline]

  23. Boeuf H, Hauss C, Graeve FD et al. Leukemia inhibitory factor-dependent transcriptional activation in embryonic stem cells. J Cell Biol 1997;138:1207–1217.[Abstract/Free Full Text]

  24. Niwa H, Burdon T, Chambers I et al. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 1998;12:2048–2060.[Abstract/Free Full Text]

  25. Chambers I, Colby D, Robertson M et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643–655.[CrossRef][Medline]

  26. Mitsui K, Tokuzawa Y, Itoh H et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003;113:631–642.[CrossRef][Medline]

  27. Schuringa JJ, van der Schaaf S, Vellenga E et al. LIF-induced STAT3 signaling in murine versus human embryonal carcinoma (EC) cells. Exp Cell Res 2002;274:119–129.[CrossRef][Medline]

  28. Sato N, Sanjuan IM, Heke M et al. Molecular signature of human embryonic stem cells and its comparison with the mouse. Dev Biol 2003;260:404–413.[CrossRef][Medline]

  29. Sperger JM, Chen X, Draper JS et al. Gene expression patterns in human embryonic stem cells and human pluripotent germ cell tumors. Proc Natl Acad Sci U S A 2003;100:13350–13355.[Abstract/Free Full Text]

  30. Richards M, Tan SP, Tan JH et al. The transcriptome profile of human embryonic stem cells as defined by SAGE. STEM CELLS 2004;22:51–64.[Abstract/Free Full Text]

  31. Stewart CL, Kaspar P, Brunet LJ et al. Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature 1992;359:76–79.[CrossRef][Medline]

  32. Li M, Sendtner M, Smith A. Essential function of LIF receptor in motor neurons. Nature 1995;378:724–727.[CrossRef][Medline]

  33. Ware CB, Horowitz MC, Renshaw BR et al. Targeted disruption of the low-affinity leukemia inhibitory factor receptor gene causes placental, skeletal, neural and metabolic defects and results in perinatal death. Development 1995;121:1283–1299.[Abstract]

  34. Yoshida K, Taga T, Saito M et al. Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders. Proc Natl Acad Sci U S A 1996;93:407–411.[Abstract/Free Full Text]

  35. Takeda K, Noguchi K, Shi W et al. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci U S A 1997;94:3801–3804.[Abstract/Free Full Text]

  36. Dani C, Chambers I, Johnstone S et al. Paracrine induction of stem cell renewal by LIF-deficient cells: a new ES cell regulatory pathway. Dev Biol 1998;203:149–162.[CrossRef][Medline]

  37. Amit M, Shariki C, Margulets V et al. Feeder and serum-free culture of human embryonic stem cells. Biol Reprod 2004;70:837–845.[Abstract/Free Full Text]

  38. Sato N, Meijer L, Skaltsounis L et al. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med 2004;10:55–63.[CrossRef][Medline]

  39. Pesce M, Gross MK, Scholer HR. In line with our ancestors: Oct-4 and the mammalian germ. Bioessays 1998;20:722–732.[CrossRef][Medline]

Received March 24, 2004; accepted for publication July 1, 2004.



This article has been cited by other articles:


Home page
Stem CellsHome page
H. Umehara, T. Kimura, S. Ohtsuka, T. Nakamura, K. Kitajima, M. Ikawa, M. Okabe, H. Niwa, and T. Nakano
Efficient Derivation of Embryonic Stem Cells by Inhibition of Glycogen Synthase Kinase-3
Stem Cells, November 1, 2007; 25(11): 2705 - 2711.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K. Adachi, E. Kawase, K. Yasuchika, T. Sumi, N. Nakatsuji, and H. Suemori
Establishment of the Gene-Inducible System in Primate Embryonic Stem Cell Lines
Stem Cells, November 1, 2006; 24(11): 2566 - 2572.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
S.-y. Yasuda, N. Tsuneyoshi, T. Sumi, K. Hasegawa, T. Tada, N. Nakatsuji, and H. Suemori
NANOG maintains self-renewal of primate ES cells in the absence of a feeder layer.
Genes Cells, September 1, 2006; 11(9): 1115 - 1123.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sumi, T.
Right arrow Articles by Suemori, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sumi, T.
Right arrow Articles by Suemori, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS
http://www.peprotech.com/