This article was retracted on April 2, 2006
Stem Cells 2004;22:950-961
www.StemCells.com
© 2004 AlphaMed Press
Effects of Type IV Collagen and Laminin on the Cryopreservation of Human Embryonic Stem Cells
Sun Jong Kima,b,
Jong Hyuk Parka,b,
Jeoung Eun Leea,
Jin Mee Kima,
Jung Bok Leea,b,
Shin Yong Moonc,
Sung Il Roha,
Chul Geun Kimb,
Hyun Soo Yoona
a Division of Stem Cell Biology, Medical Research Center, MizMedi Hospital;
b Department of Life Science, College of Natural Sciences, Hanyang University;
c Stem Cell Research Center, Seoul, Korea
Key Words. Human embryonic stem cells • Cryopreservation • Type IV collagen • Laminin
Correspondence: Hyun Soo Yoon, Ph.D., Division of Stem Cell Biology, Medical Research Center, MizMedi Hospital, 701-4 Naebalsan-dong, Kangseo-ku, Seoul 157280, Korea. Telephone: 82-2-2007-1840; Fax: 82-2-2007-1852; e-mail: yoon{at}mizmedi.net
 |
ABSTRACT
|
|---|
Previous reports have indicated that extracellular matrices (ECMs) affect the developmental fate of human embryonic stem cells (hESCs). Specially, type IV collagen and laminin, which belong to a group of macromolecular proteins with a substantial proportion of ECMs, are known to influence the proliferation and differentiation of hES cells. In this study, we evaluated the effects of type IV collagen and laminin in freezing medium on the survival and differentiation rates of hES cells after slow freezing and rapid thawing. The addition of type IV collagen (1 µg/ml) to the freezing medium significantly increased the survival rate of hES cells after thawing compared with that of a control group. The spontaneous differentiation rates of groups treated with type IV collagen (1 µg/ml) or laminin (1 µg/ml) were significantly lower than those of the control group. Frozen-thawed hES cells have currently been cultured for more than 70 passages and retain key properties of hES cells such as morphological characteristics, normal karyotype, marker expression (alkaline phosphatase, SSEA-1, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, Rex-1, and Oct-4), basement membranerelated gene expression, and the potential to differentiate into derivatives of all three germ layers. This new slow freezing method by ECM treatment is a reliable and effective cryopreservation method for pluripotent hES cells.
 |
INTRODUCTION
|
|---|
Human embryonic stem cells (hESCs) derived from the inner cell masses (ICMs) of blastocysts are pluripotent cells, which have the capacity to self-renew and to differentiate into a wide variety of tissues exhibiting characteristics of all three germ layers in vitro and in vivo and yet still retain a normal karyotype [13].
To exploit the remarkable potentials of hESCs, technical improvements for the handling, manipulation, and cryopreservation are an important part of hESC technology. The ability for successful cryopreservation of hES cells with limited loss in viability is essential for the success of widespread use of stem cells. Also, an effective freezing technique would allow the efficient preservation of stocks of early-passage hESCs, as well as the cryopreservation of specific clones developed from the original hESC lines such as genetically modified clones [4]. However, optimal cryopreservation conditions of hESCs have not been established clearly because of high rates of cell death from dissociation of clumps and spontaneous differentiation of hESCs after thawing.
Because ES cells originate from the pluripotent cells of blastocysts and retain ES cell properties in culture [5], it has been postulated that a blastocyst cryopreservation method might be effective with ES cells [6]. Recently, vitrification of hESCs by the open-pulled-straw technique has been reported as effective for their cryopreservation; all vitrified hESCs were recovered after thawing and retained the key properties of pluripotent stem cells. However, the vitrification of hESCs could increase the levels of cell death and spontaneous differentiation after thawing and limit the number of hESC clumps that can be cryopreserved simultaneously [7]. Furthermore, a potential hazard of vitrification is the transmission of infective agents into cells [8,9].
The conventional slow freezing and rapid thawing method is most commonly used for the cryopreservation of embryos and cell lines. Although this standard method is efficient for the cryopreservation of mouse ES (mES) cells, the survival of undifferentiated hESCs after conventional slow freezing is very poor, with most cells either differentiating or dying [7]. During slow freezing, there are many significant stresses on cells that can contribute to the loss of pluripotency, including osmotic stress, stresses to cell-junction and cell-transport systems, and disruption of organelles [10,11].
In particular, previous reports have indicated that the soluble factors and extracellular matrix (ECM) produced by feeder cells might be important for proliferation and maintenance of undifferentiated hESCs [12,13]. ECM provides a platform for multiple signaling mechanisms, which may explain its importance in cell differentiation, migration, and survival [14]. The basement membrane (BM) contains many molecules, including structural proteins, type IV collagen and laminin isotypes, and various glycoproteins rich in heparan sulfates [15]. Regulation of their assembly plays a crucial role during development, and type IV collagen and laminin are essential for this process [16]. In mES cells, the expression and accumulation of laminin and its companion matrix components on the cell surface and their assembly into the BM affect the differentiation of primitive endodermal and epiblast cells [17,18].
In this study, we evaluated the effects of type IV collagen and laminin in the freezing medium on the proliferation and differentiation of hESCs after slow freezing and rapid thawing.
 |
MATERIALS AND METHODS
|
|---|
hESC Culture
Miz-hES1 (National Institutes of Healthregistered), Miz-hES2, and Miz-hES3 cell lines were used to evaluate the effects of type IV collagen and laminin in the freezing medium during slow freezing and rapid thawing. These cell lines have been characterized and karyotyped previously [1]. hESC colonies were cultured on a feeder layer of mitotically inactivated primary mouse embryonic fibroblasts (PMEFs) in the gelatin-coated culture dish. The culture medium consisted of Dulbeccos modified Eagles medium/F12 (without pyruvate) supplemented with 20% knockout serum replacement (SR) (Gibco/BRL, Invitrogen, Carlsbad, CA), 0.1 mM ß-mercaptoethanol, 1% nonessential amino acids (Gibco/BRL), 100 U/ml penicillin G, 100 µg/ml streptomycin, and 4 ng/ml human recombinant basic fibroblast growth factor (Gibco/BRL).
Maintenance and Harvest of hESCs for Cryopreservation
For maintaining hESCs, approximately 100 undifferentiated hESCs in a colony were mechanically isolated under dissecting microscope, and the resulting clumps were propagated on a new feeder layer for approximately 5 days. For the freezing process, approximately 50 to 100 undifferentiated hESC clumps were isolated as above and randomly allocated for this experiment.
Cryopreservation of hESCs
The undifferentiated hESC clumps were harvested for routine passaging as described above and then transferred to the freezing medium (90% SR with 10% dimethylsulfoxide [DMSO]; frozen control group) with serial increments of DMSO (0%, 2%, 4%, 6%, 8%, and 10%). Human type IV collagen (Sigma, St. Louis) or human laminin (1, 2, and 5 µg/ml; Sigma) were added to the freezing medium in each experimental group. Thirty to 40 clumps of hESCs were loaded into a straw (IMV Technologies, LAigle Cedex, France) with slow freezing (at the rate of 1°C per minute until 80°C, seeding at 7°C) using a cell freezer (Cryo Magic, Miraebiotech, Seoul, Korea) and then stored in liquid nitrogen. At least 48 hours after cryopreservation, the hESC clumps were rapidly thawed in a water bath at 37°C, and DMSO in the thawing medium was gradually diluted (10%, 8%, 6%, 4%, 2%, and 0%). Thawed hESC clumps were then washed twice in the hESC culture medium and plated on a fresh feeder layer.
Assessment of Survival and Spontaneous Differentiation Rates of hESC after Cryopreservation
The survival and spontaneous differentiation rates of hESCs were compared among fresh control (not frozen-thawed), frozen control, and experimental treatment groups (type IV collagentreated or laminin-treated groups) after slow freezing and rapid thawing. The survival and spontaneous differentiation rates of frozen-thawed hESCs were observed at the time of the first passage and at third passage after plating. The level of differentiation for each colony was determined using inverted/phase-contrast microscopy based on morphological appearance; cells having areas with tight, small cells with a high nucleus-to-cytoplasm ratio were regarded as undifferentiated, whereas large cells with abundant cytoplasm were regarded as differentiated.
2 test was used for statistical analyses, and in all cases, a probability value of < .01 was considered as indication of statistical significance.
Fluorescent-Activated Cell Sorting Analysis of hESCs
On the third passage after thawing, confluent cultures of Miz-hES1, 2, and 3 cells from each treatment were harvested using 0.5 mM ethylenediaminetetraacetic acid (EDTA) (Sigma) in phosphate-buffered saline (PBS). All staining procedure was performed in staining buffer consisting of Dulbeccos PBS, Ca2+, Mg2+-free (Gibco/BRL, Invitrogen), supplemented with 2% heat-inactivated (HI) goat serum (HyClone Laboratories, Inc., Logan, UT), 0.1% sodium azide (Sigma), and 2 mM EDTA (Sigma). hESCs (5 x 105 cells) were blocked for 15 minutes at 4°C in 20% HI goat serum in staining buffer. Cells were incubated with TRA-1-60, 1:10 (Chemicon, Temecula, CA), or appropriate isotype-matched controls (Beckman Coulter, Miami) for 30 minutes at 4°C. Cells were washed two to three times in staining buffer and incubated for 30 minutes at 4°C with fluorescein isothiocyanate (FITC) IgM, 1:200 (Chemicon). Cells were washed as above and resuspended in staining buffer containing 1 µg/ml of propidium iodide (Sigma) to identify viable cells. Fluorescence-activated cell sorter (FACS) analysis was performed by using a COULTER EPICS AltraTM Flow Cytometer (Beckman Coulter). Acquired data were analyzed using EXPO32 multiCOMP software (Beckman Coulter). Two-tailed Students t-test was used for statistical analysis.
Real-Time Polymerase Chain Reaction for the Undifferentiation-Specific Transcription Factors of hESCs
Total RNA from each treatment was extracted using the QIA-GEN RNeasy kit (QIAGEN,Valencia, CA). Standard reverse transcription (RT) reaction was performed using random hexamers and AMV reverse transcriptase with 500 ng of total RNA (Roche Molecular Biochemicals, Mannheim, Germany). Real-time polymerase chain reaction (PCR) was performed using an iCycler (Bio-Rad Laboratories Ltd., Hemel Hempstead, U.K.) with an optical upgrade system under the following conditions: 12.5 µl of iQTM SYBR Green Supermix (Bio-Rad Laboratories Ltd.), 10 nM for each primer, and 100 ng of total cDNA in nuclease-free water. Gene-specific primers and probes were designed by Primer3 software (Whitehead Institute/MIT Center for Genome Research). The primers and probe were designed as above for Oct-4 (GenBank accession No. NM_002701
[GenBank]
; forward, GACAACAATGAGAACCTTCAGGAGA; reverse, TTCTGGCGCCGGTTACAGAACCA) and Rex-1 (GenBank accession No. NM_174900
[GenBank]
; forward, CTGAAGAAACGGGCAAAGAC; reverse, GAACATTCAAGGGAGCTTGC). The cycling parameters were 5 minutes of denaturation at 94°C followed by 28 cycles of 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 30 seconds, with a final extension at 72°C for 10 minutes. Relative quantity of gene expression between multiple samples was achieved by normalization against ß-actin by using the DDCT method of quantitation. Fold changes were calculated as 2
CT.
Semiquantitative RT-PCR for the Analysis of Basement Membrane-Specific Gene Expression
The RNA extraction and RT reaction were performed as described above. The PCR was carried out with 2 µl of cDNA template, 1 µl of a 10-mM deoxynucleotide triphosphate (dNTP) mixture, and 10 pmol of DNA primers selected for human genes. The primers were derived from different exons to ensure that PCR products represented the specific mRNA species and not the genomic DNA. Each gene transcript was amplified with 5 minutes of denaturation at 94°C, followed by 24 cycles at 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 30 seconds, with a final extension at 72°C for 10 minutes in a thermal cycler (Gene Amp 9600, Perkin-Elmer, Wellesley, MA). The following primers were synthesized for the human genes: perlecan (GenBank Accession No. NM_005529
[GenBank]
; forward, GCTATTCTGGCTTGTCCTGC; reverse, CGGGTACTCAGGTGGAAAGA), laminin
1 (GenBank Accession No. XM_209080; forward, ACT GAAGTACAGCGTGGCCT; reverse, GTTCAGACACTT CCCGGTGT), fibronectin 1 (GenBank Accession No. NM_002026
[GenBank]
; forward, AAGGTTCGGGAAGAGGTTGT; reverse, TGGCACCGAGATATTCCTTC), collagen type IV
1 (GenBank Accession No. NM_001845
[GenBank]
; forward, GGGCTACCTGGAGAAAAAGG; reverse, TCCTGGAGAGC CACCAATAC), nidogen (GenBank Accession No. NM_002508
[GenBank]
; forward, AGGGTGTCTGGGTGTTTGAG; reverse, CGAGCACTGGTGTCTGTTGT), dystroglycan 1 (GenBank Accession No. NM_004393
[GenBank]
; forward, CAGT GATGCTTGTGGCCTTA; reverse, CAGTGATGCTTGT GGCCTTA). The RT-PCR products have been confirmed by sequencing to match the amplification target. Semiquantitative RT-PCR was performed as above with ß-actin as an internal control. Products were analyzed on a 1.5% agarose gel and visualized by ethidium-bromide staining. The experiments were independently repeated three times. Students t-test was used for statistical analyses, and in all cases, a probability of < .05 was considered as indication of statistical significance.
Characterization and Cytogenetic Analysis of Cryopreserved hESCs
For immunocytochemistry, hESCs were washed with PBS and fixed in 4% paraformaldehyde in PBS at 4°C for 30 minutes. Alkaline phosphatase activity as well as cell-surface antibodies were detected using corresponding antibodies, MC480 (SSEA-1), MC-631 (SSEA-3), MC-813 (SSEA-4), TRA-1-60 [19], TRA-1-81 [19], and Oct-4 [20,21], as described previously [1]. For the cytogenetic analysis of hESCs, hESCs were incubated in hES culture media with 0.1 µg/ml colcemid (KaryoMax colcemid solution; Gibco/BRL) for 34 hours, trypsinized, incubated in 0.1% sodium citrate at 37°C for 20 minutes, and fixed in methanol and acetic acid (3:1, vol/vol). After Giemsa staining, a cytogenetic specialist at a resolution of 300 bands examined the karyotype of chromosomes. At least 50 cells were examined from each sample [1].
Teratoma Formation in Severe Combined Immunodeficient Mice
At the time of routine passage, clumps consisting of 300 to 400 undifferentiated cells originated from frozen-thawed hESCs (type IV collagentreated or laminin-treated) were harvested as above and injected with a sterile 26G needle into the testicular capsule of 4- to 8-week-old severe combined immunodeficient (SCID) mice (CB17 strain; Jackson Laboratory, Bar Harbor, ME). Ten to 12 weeks later, the resulting tumors were fixed in 10% neutral buffered formalin, embedded in paraffin, and examined histologically by staining with hematoxylin and eosin [1,22].
 |
RESULTS
|
|---|
Effects of Type IV Collagen or Laminin Concentration on the Survival and Differentiation Rate of hESCs after Slow Freezing and Rapid Thawing
When frozen hESC clumps were recovered after conventional slow freezing and rapid thawing, most hESC clumps were not attached and formed undersized colonies to end up with differentiation. Compared with fresh controls (45 days), the cryopreserved group required prolonged cultures (7 days) to allow proliferation of undifferentiated cells. Also, morphological appearance of the colonies was improved with extended culture of cryopreserved hESCs (Figs. 1A1D
).

View larger version (78K):
[in this window]
[in a new window]
|
Figure 1. Morphological features and FACS analysis of hESCs after slow freezing and rapid thawing. Representative morphologies of hESCs grown on primary mouse embryonic fibroblasts were presented from colonies of fresh control (A), frozen control (B), type IV collagen treatment (C), and laminin-treated frozen hESCs (D) at day 7 after thawing. At high magnification, the undifferentiated hESCs exhibit distinct cell borders, a high nucleus-to-cytoplasm ratio, and prominent nucleoli. The type IV collagentreated or laminin-treated groups contained compact undifferentiated colonies, as did the culture of fresh control cells, although the frozen control cells did not contain as many undifferentiated colonies as type IV collagentreated or laminin-treated frozen groups. FACS analysis of fresh control (E), frozen control (F), type IV collagentreated (G), and laminin-treated (H) frozen hESCs after slow freezing and thawing at third passage. Nonviable cells were identified using propidium iodide staining and excluded for the analysis. The horizontal marker in each plot is positioned to represent the fluorescence of ~ 99% of the appropriate fluorescein isotypematched control; the vertical marker is positioned to represent the TRA-1-60positive population. Values in each quadrant indicate the percentage of TRA-1-60positive cells. Scale bars indicate 100 µm (AD) and 10 µm (insets). Abbreviations: FACS, fluorescence-activated cell sorter; hESC, human embryonic stem cell.
|
|
To determine the effective concentration of type IV collagen and laminin treatments, we treated the type IV collagen or laminin at 1, 2, and 5 µg/ml in the freezing medium. The nonattached clumps after thawing were excluded to get the survival or differentiation rate after thawing. Compared with the frozen control group, the addition of type IV collagen (1 µg/ml) to the freezing medium significantly increased the survival rate (24 of 110 [21.8%] versus 40 of 110 [36.3%]; p < .01) (Table 1
). The increased concentration of type IV collagen (5 µg/ml) or laminin (5 µg/ml) did not improve the survival rate of hESCs. However, the differentiation rate was significantly reduced in the presence of type IV collagen or laminin. The addition of type IV collagen (1, 2, or 5 µg/ml) or laminin (1 or 2 µg/ml) to the freezing medium also significantly reduced the differentiation rate (p < .01) (Table 1
). The addition of ECMs in the thawing medium had no effect on the survival and differentiation rates (data not shown). Therefore, the addition of either 1 µg/ml type IV collagen or 1 µg/ml laminin only to the freezing medium was selected in subsequent experiments.
View this table:
[in this window]
[in a new window]
|
Table 1. Effects of ECM, type IV collagen, and laminin on the survival and differentiation rates of hES cells after slow freezing and rapid thawing
|
|
The addition of type IV collagen (1 µg/ml) to the freezing medium significantly increased the survival rate (60 of 249 [24.1%] versus 96 of 262 [36.6%]; p < .01). At third passage after thawing, the rate of spontaneous differentiation was lower in type IV collagentreated or laminin-treated frozen hES colonies than that of frozen control colonies (35 of 332 [10.5%] and 23 of 202 [11.4%] versus 89 of 254 [35.0%]; p < .01), and these values were similar to those of a fresh control group subcultured without cryopreservation (20 of 245 [8.2%]) (Table 2
). Addition of type IV collagen or laminin to freezing medium resulted in the decreased differentiation rate of hESCs after slow freezing.
View this table:
[in this window]
[in a new window]
|
Table 2. Survival and differentiation rates of hES cells after slow freezing and rapid thawing using the freezing medium containing either type IV collagen (1 µg/ml) or laminin (1 µg/ml)
|
|
FACS Analysis of Frozen-Thawed hESCs
To analyze the undifferentiation state of hESCs at the third passage after thawing, we compared the expression of TRA-1-60 in the fresh control, frozen control, type IV collagentreated, and laminin-treated hESCs by FACS analysis. TRA-1-60 expression in hESCs was in the range of 93%95% in fresh control (n = 5 to 13 in three cell lines), 90%93% in type IV collagentreated cells (n = 5 to 11 in three cell lines), 88%93% in laminin-treated cells (n = 5 to 11 in three cell lines), and 68%72% in frozen control cells (n = 5 to 11 in three cell lines), respectively (Figs. 1E1H
). TRA-1-60 expression was statistically significant among the fresh control group (94.2 ± 1.2%), type IV collagentreated group (91.7 ± 1.5%), laminin-treated group (90.4 ± 1.1%), and frozen control group (69.7 ± 1.6%) (Students t-test; fresh control versus frozen control, p < .01; type IV collagentreated or laminin-treated versus frozen control groups, p < .01). Addition of type IV collagen or laminin increased the undifferentiation status of hESCs after thawing.
Effect of Type IV Collagen or Laminin Treatment on the Transcription of Genes Encoding Undifferentiated hESC Markers
We investigated the expression of transcription factors known to be associated with pluripotency state. Several transcription factors expressed in undifferentiated mES cells and hESCs with decreased expression on differentiation were evaluated in the fresh control group, frozen control group, and type IV collagentreated or laminin-treated hESCs using quantitative RT-PCR. Significant difference was observed between the frozen control group and type IV collagentreated or laminin-treated hESCs (Table 3
). Oct-4 and Rex-1 expression was abundant in the fresh control group, type IV collagentreated hESCs (0.822, 0.809), and laminin-treated hESCs (0.816, 0.801) but was significantly decreased in the frozen control hESCs (0.212, 0.234). In this result, Oct-4 and Rex-1 expression was restored by addition of type IV collagen or laminin treatment to freezing medium.
View this table:
[in this window]
[in a new window]
|
Table 3. Results of real-time polymerase chain reaction for undifferentiated human embryonic stem cell marker expression after treatment with type IV collagen or laminin
|
|
Rescue of Basement Membrane-Related Gene Expression by Type IV Collagen or Laminin Treatment during Slow Freezing and Rapid Thawing
To analyze the effect of type IV collagen and laminin on BM of hESCs during cryopreservation, the steady-state transcription level of specific BM components was examined by semiquantitative RT-PCR. The addition of type IV collagen (1 µg/ml) or laminin (1 µg/ml) to the freezing medium affected the expression level of the BM-related gene of hESCs after thawing (Fig. 2A
). The expression of collagen type IV
1, laminin
1, fibronectin 1, nidogen, and perlecan was significantly increased in type IV collagentreated or laminin-treated groups compared with the frozen control group (p < .05). The BM-related gene expression in type IV collagentreated or laminin-treated groups was similar to that of the fresh control group (Figs. 2B2G
). Our results clearly show that type IV collagen or laminin treatment could rescue BM-related gene expression.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 2. Effects of type IV collagen and laminin treatment on the expression of genes encoding BM proteins after hES cryopreservation. (A): Expression of various BM-related genes in hESCs. Total RNA was extracted from fresh and frozen control cells, as well as from type IV collagentreated or laminin-treated hESCs after thawing. Lane 1: fresh control;, Lane 2: frozen control; Lane 3: type IV collagen treated; Lane 4: laminin treated. Various BM gene expression profiles were changed. Semiquantitative reverse transcriptionpolymerase chain reaction of the following BM proteins after thawing was performed: collagen type IV 1 (B), dystroglycan 1 (C), fibronectin 1 (D), laminin 1 (E), nidogen (F), and perlecan (G). Expression levels of BM-related genes were normalized to b-actin expression levels and are shown as relative quantification. Data are shown as mean ± standard deviation (n = 3). *p <.05, frozen control group versus type IV collagentreated or laminin-treated group. Abbreviations: BM, basement membrane; Coll, type IV collagen (1 µg/ml); hESC, human embryonic stem cell; Lami, laminin (1 µg/ml).
|
|
Characterization of hESCs after Slow Freezing and Rapid Thawing
The addition of type IV collagen or laminin to the freezing medium could maintain the key properties of Miz-hES1 cells after slow freezing and rapid thawing. hESCs were analyzed immunocytochemically using a series of antibodies against cell-surface carbohydrate antigens after thawing, which are specifically expressed on undifferentiated hESCs. They exhibited high levels of alkaline phosphatase (AP) activity (Fig. 3A
). SSEA-1 was not expressed in undifferentiated hESCs (Fig. 3B
). SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 were strongly expressed (Figs. 3C3F
). Also, Oct-4 was expressed specifically in undifferentiated hESCs but not in differentiated cells (Figs. 4A, 4B
). When karyotype analysis was examined at passage 30 after thawing, hESCs had a normal 46 XY karyotype (Fig. 4C
). Similar results were obtained from two other cell lines (Miz-hES2 and Miz-hES3) (data not shown).

View larger version (164K):
[in this window]
[in a new window]
|
Figure 3. Marker expression in Miz-hES1 cells after addition of type IV collagen or laminin in freezing medium. Staining of Miz-hES1 colonies with alkaline phosphatase (A), SSEA-1 (B), SSEA-3 (C), SSEA-4 (D), TRA-1-60 (E), and TRA-1-81 (F). Colonies consisting of stained, central, and undifferentiated cells were strongly stained by antibodies of each surface marker protein. Scale bars indicate 100 µm.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 4. Characterization of type IV collagentreated or laminin-treated Miz-hES1 cell line at passage 30 after thawing. (A): Immunostaining of Miz-hES1 cells with antiOct-4 antibody. Oct-4 was expressed homogeneously in undifferentiated hESCs. (B): Oct-4 expression by RT-PCR. Oct-4 was expressed only in undifferentiated Miz-hES1 cells (not in differentiated Miz-hES1 cells). Lane 1: 100-bp DNA ladder; lane 2: negative control; lane 3: primary mouse embryonic fibroblasts; lane 4: undifferentiated Miz-hES1 cells; lane 5: differentiated Miz-hES1 cells (day 30). The sizes of PCR product of the human ß-actin, mouse b-actin, and human Oct-4 primers are 838, 540, and 445 bp, respectively. (C): Karyotype analysis of hESC lines using G-band method. The karyotype of Miz-hES1 was examined at passage 30 after thawing. The karyotype was found to be normal (46 XY). Abbreviations: hESC, human embryonic stem cell; RT-PCR, reverse transcriptionpolymerase chain reaction.
|
|
Differentiation of Frozen and Thawed hESCs In Vivo
The developmental potential of the addition of type IV collagen or laminin on frozen-thawed hESCs was examined in vivo using a teratoma model. The three hESC lines (Miz-hES1, Miz-hES2, and Miz-hES3 of 44, 51, and 36 passages after thawing, respectively) used in this research formed teratomas after injection into SCID mice. Each teratoma contained representative tissues of the three embryonic germ layers, including endoderm (glandular-like tissue), mesoderm (osteoid-like tissue, cartilage, and adipocyte), and ectoderm (neural tube components). Representative tissues of three germ layers from frozen and thawed hESCs are demonstrated (Fig. 5
).

View larger version (163K):
[in this window]
[in a new window]
|
Figure 5. In vivo differentiation of type IV collagentreated or laminin-treated frozen-thawed human embryonic stem cells. (A): Choroids plexus-like tissue from frozen-thawed Miz-hES1 cells. (B): Cartilage-like tissue from frozen-thawed Miz-hES1 cells. (C): Osteoid- and marrow-like tissue from frozen-thawed Miz-hES2 cells. (D): Neural tube-like tissue from frozen-thawed Miz-hES3 cells. (E):Adipocyte-like cells from frozen-thawed Miz-hES2 cells. (F): Glandular-like tissue from frozen-thawed Miz-hES3 cells. Magnification, x100. Scale bars indicate 100 µm.
|
|
 |
DISCUSSION
|
|---|
The conventional slow freezing and rapid thawing method is the most common cryopreservation method for various types of cells. However, it was reported that the survival of undifferentiated hESCs after the conventional slow freezing and rapid thawing method was very poor, especially with most hESCs undergoing either differentiating or dying. In previous studies, hESCs successfully retained their fundamental characteristics after cryopreservation with conventional slow freezing and rapid thawing. Nevertheless, the efficiency of the conventional slow freezing and rapid thawing method of hESCs was relatively low. In the previous report, only 16% (15 of 93) of hESCs developed after plating into undersized hES colonies, and these hES colonies were completely differentiated [7]. The slow freezing and rapid thawing process has been detrimental to cells, including the rate of exposure of the cells to the cryoprotectants during repetitive mixing, temperature, and the methods of dilution [10,11].
In the present study, the effects of the ECM addition in the freezing medium on the hESC survival and spontaneous differentiation rates after slow freezing and rapid thawing were evaluated by morphological observation. In our results, 20%24% of hESC clumps survived and formed colonies after thawing in frozen control and laminin-treated (1 µg/ml) groups. However, 37% of hESC clumps survived and formed colonies in the type IV collagen (1 µg/ml) group. The survival rate of the type IV collagentreated group was significantly higher than that of frozen control and laminin-treated groups (Table 2
). These results suggest that the survival rate of hESCs after thawing may be improved by the addition of type IV collagen. hESC colonies that were formed after thawing formed undersized colonies with complete differentiation. At the third passage after thawing, the spontaneous differentiation rate was increased in frozen control hES colonies. Furthermore, the differentiation rate was significantly decreased by the treatment of type IV collagen (1 µg/ml) or laminin (1 µg/ml) (Table 2
). These results suggest that the spontaneous differentiation rate of hESC after thawing could be decreased by the addition of type IV collagen or laminin in the freezing medium.
It should be noted that hESC cultures represent mixed populations of cells, and it may be extremely difficult to determine the difference between the undifferentiation and differentiation states. Therefore, further analysis is required to determine whether these differences will correlate with other characteristics of the cells such as capacity to differentiate. In our FACS analysis, TRA-1-60 expression was similar in fresh control, type IV collagentreated, and laminin-treated groups but was decreased in frozen control (Fig. 1B
). Also, quantitative comparison of transcription factors, Oct-4, and Rex-1 expression showed a very similar pattern as a result of FACS analysis (Table 3
). As shown in our results, addition of type IV collagen or laminin to freezing medium decreased the absolute differentiation rate of hESCs after thawing.
The criteria that define hESCs include expression of AP, presentation of surface markers, expression of Oct-4, maintenance of a normal karyotype, and ability to differentiate into a wide variety of cell types. After slow freezing using ECMs treatment, Miz-hES1, Miz-hES2, and Miz-hES3 cells expressed high levels of AP and surface markers (SSEA-4, SSEA-3, TRA-1-60, and TRA-1-81) but did not express SSEA-1 with normal karyotype (Figs. 3
, 4
). Also, all three cell lines showed teratoma formation in SCID mice, which was similar to that obtained by injecting the mES cell line, and induced various cell types in the three embryonic germ layers in mice (Fig. 5
). These data demonstrate that hESCs maintain all ES cell features after slow freezing (i.e., pluripotency and unlimited proliferation capability with undifferentiated state), which has no effect on their remarkable developmental potential, and that they also maintain normal karyotypes.
From semiquantitative RT-PCR analysis, we observed that whereas the expression of BM components of hESCs was reduced during the conventional freezing and thawing protocol, the external addition of type IV collagen and laminin during slow freezing restored the expression of BM-specific genes, collagen type IV
1, laminin
1, fibronectin 1, and perlecan (Fig. 2
). These BM proteins are known to participate in hES ECM formation and remodeling and support the growth of undifferentiated hESCs [23]. In particular, previous reports have indicated that soluble factors and ECM produced by feeder cells might be important for proliferation and maintenance of undifferentiated hESCs [12]. Laminin is the first ECM protein expressed in two- to four-cell-stage mouse embryos and is a major component of the ECM and all basal laminae in vertebrates [19]. Through the interaction with integrin heterodimers such as
1ß1,
2ß1,
3ß1,
6ß1, and
6ß4 on the cell surface, laminin induces signals for promoting cell adhesion, growth, and migration. Among these integrins, only
6ß1 and
6ß4 are specific for laminin, whereas the others also interact with other matrix proteins such as collagen. Laminin receptor was found to be highly expressed on mES and embryonal carcinoma cells [16] and may be important for the maintenance of the undifferentiated state of hESCs [12].
In addition, ECM proteins mediated promotion or suppression of cell growth by either stimulation or inhibition of key cell-cycle mediators, including cyclins and early response genes [24,25]. ECM also binds signaling molecules, such as fibroblast growth factor, epidermal growth factor, platelet-derived growth factor, and hedgehog families, and their binding might regulate transcription of genes whose function is associated with specialized ES cell differentiation, as exemplified by both induction and repression of genes [2629]. Therefore, our data are quite consistent with the notion that the ECMs profoundly influence major cellular processes governing growth, differentiation, and apoptosis of hESCs.
Taken together, rescue of BM component expression by the addition of type IV collagen or laminin to freezing medium might induce retention of the key properties of pluripotent cells. The differentiation fate of hESCs depends on the complex cocktail of growth factors, signaling molecules, and ECM proteins constituting the developmental niche in which the cells exist. Although the characteristics of these factors and their mutual interplay are still far from understood, several signaling systems have been pinpointed as regulating the differentiation fate of hESCs [30].
These days, genetic abnormality of hESCs with high passage number is currently an issue for quality control purpose cryopreservation of early passage numbers and frequent cryopreservation after karyotype analysis are demanding [31]. Therefore, our new cryopreservation protocol will contribute to both the quality and quantity controls of hESCs with normal karyotype and storage of hESCs every designated passage, respectively.
In conclusion, the current study indicates that the slow freezing method with the addition of either type IV collagen or laminin in freezing medium could improve cryopreservation of hESCs. Furthermore, the efficient cryopreservation approach presented here improves the quality and quantity controls of hESC lines, which are useful for studies in stem cell research and clinical application.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Douglas N. Foster at the University of Minnesota and Dr. Seungkwon You at Korea University for proofreading the manuscript. This research was supported by grants M102KL010001-02K1201-00310 and M102KL010001-03K1201-00610 from the Stem Cell Research Center of the 21st Century Frontier Research Program, funded by the Ministry of Science and Technology, Republic of Korea.
 |
REFERENCES
|
|---|
- Park JH, Kim SJ, Oh EJ et al. Establishment and maintenance of human embryonic stem cells on STO, a permanently growing cell line. Biol Reprod 2003;69:20072014.[Abstract/Free Full Text]
- Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:11451147.[Abstract/Free Full Text]
- Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000;8:399404.
- Gearheart J. New Potential for human embryonic stem cells. Science 1998;282:10611062.[Free Full Text]
- Bongso A, Fong CY, Ng SC et al. Isolation and culture of inner cell mass cells from human blastocysts. Hum Reprod 1994;9:21102117.[Abstract/Free Full Text]
- Freshney RI. Culture of Animal Cells: A Manual of Basic Technique. New York: Wiley-Liss Inc., 1994:255265.
- Reubinoff BE, Pera MF,Vajta G et al. Effective cryopreservation of human embryonic stem cells by the open pulled straw vitrification method. Hum Reprod 2001;16:21872194.[Abstract/Free Full Text]
- Hawkins AE, Zuckerman MA, Briggs M et al. Hepatitis B nucleotide sequence analysis: linking an outbreak of acute hepatitis B to contamination of a cryopreservation tank. J Virol Methods 1996;60:8188.[CrossRef][Medline]
- Tedder RS, Zuckerman MA, Goldstone AH et al. Hepatitis B transmission from contaminated cryopreservation tank. Lancet 1995;46:137140.
- Frederickx V, Michiels A, Goossens E et al. Recovery, survival and functional evaluation by transplantation of frozen-thawed mouse germ cells. Hum Reprod 2004;19:948953.[Abstract/Free Full Text]
- Woods EJ, Liu J, Pollok K et al. A theoretically optimized method for cord blood stem cell cryopreservation. J Hematother Stem Cell Res 2003;12:34150.[CrossRef][Medline]
- Xu C, Inokuma MS, Denham J et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nature Biotech 2001;19:971974.[CrossRef][Medline]
- Richards M, Fong CY, Chan WK et al. Human feeders support prolonged undifferentiated growth of human inner cell masses and embryonic stem cells. Nature Biotech 2002; 20:933936.[CrossRef][Medline]
- Li X, Chen Y, Scheele S et al. Fibroblast growth factor signaling and basement membrane assembly are connected during epithelial morphogenesis of the embryoid body. J Cell Biol 2001;153:811822.[Abstract/Free Full Text]
- Kleinman HK, McGarvey ML, Liotta LA et al. Isolation and characterization of Type IV procollagen, laminin, and heparan sulfate proteglycan from the EHS sarcoma. Biochemistry 1982;21:61886193.[CrossRef][Medline]
- Ekblom P,Vestweber D, Kemler R. Cell-matrix interactions and cell adhesion during development. Annu Rev Cell Biol 1986;2:2747.[CrossRef][Medline]
- Li S, Harrison D, Carbonetto S et al. Matrix assembly, regulation, and survival functions of laminin and its receptors in embryonic stem cell differentiation. J Cell Biol 2002;157:12791290.[Abstract/Free Full Text]
- Jaroslaw C, Anna W. Embryonic stem cell differentiation: The role of extracellular factors. Differentiation 2001;68:167174.[CrossRef][Medline]
- Cooper S, Pera MF, Bennett W et al. A novel keratan sulfate proteoglycan from a human embryonal carcinoma cell-line. Biochem J 1992;286:959966.
- Carpenter MK, Rosler ES, Fisk GJ et al. Properties of four human embryonic stem cell lines maintained in a feeder-free culture system. Dev Dyn 2004;229:243258.[CrossRef][Medline]
- Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation of self-renewal of ES cells. Nat Genet 2000;24:372376.[CrossRef][Medline]
- Andrews PW, Oosterhuis JW, Damjanov I. Cell lines from human germ cell lines. In: Robertson EJ, ed. Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. Oxford, U.K.: IRL Press, 1987:20724.
- Lim JW, Bodnar A. Proteome analysis of conditioned medium from mouse embryonic feeder layers which support the growth of human embryonic stem cells. Proteomics 2002;2:11871203.[CrossRef][Medline]
- Zhu X, Assoian K. Integrin-dependent activation of MAP kinase: a link to shape-dependent cell proliferation. Mol Biol Cell 1995;6:273282.[Abstract]
- Srebrow A, Friedmann Y, Ravanpay A et al. Expression of Hoxa-1 and Hoxb-7 is regulated by extracellular matrix-dependent signals in mammary epithelial cells. J Cell Biochem 1997;69:377391.
- Burdon T, Smith A, Savatier P. Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol 2002;12:432438.[CrossRef][Medline]
- Cooper M, Tamura N, Quaranta V. The major laminin receptor of mouse embryonic stem cells is a novel isoform of the a6b1 integrin. J Cell Biol 1991;115:843850.[Abstract/Free Full Text]
- XIaofeng L, Ulrika T, Jan T et al. Akt/PKB regulates laminin and collagen IV isotypes of the basement membrane. Proc Natl Acad Sci U S A 2001;98:1441614421.[Abstract/Free Full Text]
- Chen Y, Li X, Eswarakumar P et al. Fibroblast growth factor (FGF) signaling through PI3-kinase and Akt/PKB is required for embryoid body differentiation. Oncogene 2000;19:37503756.[CrossRef][Medline]
- Watt FM, Hogan BL. Out of Eden: stem cells and their niches. Science 2000;287:14271430.[Abstract/Free Full Text]
- Draper JS, Smith K, Gokhale P et al. Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nat Biotechnol 2004;22:5354.[CrossRef][Medline]
Received on November 24, 2003;
accepted for publication on May 5, 2004.
This article has been cited by other articles:

|
 |

|
 |
 
C. I. Civin, A. M. Gewirtz, M. A. Goodell, R. G. Hawley, and M. J. Murphy
EDITORIAL RETRACTION
Stem Cells,
April 1, 2006;
24(4):
804 - 804.
[Full Text]
[PDF]
|
 |
|