Stem Cells 2004;22:1134-1141
www.StemCells.com
© 2004 AlphaMed Press
In Vitro Cultured Islet-Derived Progenitor Cells of Human Origin Express Human Albumin in Severe Combined Immunodeficiency Mouse Liver In Vivo
Marc-Alexander von Macha,
Jan Georg Hengstlerb,
Marc Brulportb,
Michael Eberhardtc,
Wiebke Schormannb,
Matthias Hermesb,
Dirk Prawittd,
Bernhard Zabeld,
Jens Groschee,
Andreas Reichenbache,
Beat Müllerc,
Ludwig Sacha Weilemanna,
Henryk Zulewskic
a II. Medical Department, University of Mainz, Mainz, Germany;
b Center for Toxicology, Institute of Legal Medicine and Rudolf-Boehm Institute of Pharmacology and Toxicology, University of Leipzig, Leipzig, Germany;
c Division of Endocrinology, Diabetes and Clinical Nutrition, University Hospital, Basel, Switzerland;
d Molecular Genetics Laboratory, University Childrens Hospital, University of Mainz, Mainz, Germany;
e Paul-Flechsig Institute, University of Leipzig, Leipzig, Germany
Key Words. Pancreas • Islet of Langerhans • Liver • Stem cell
Correspondence: Marc-Alexander von Mach, M.D., II. Medical Department, Langenbeckstr. 1, 55131 Mainz, Germany. Telephone: 49-6131-174154; Fax: 49-6131-176605; e-mail: marcm{at}giftinfo.uni-mainz.de
 |
ABSTRACT
|
|---|
Studies in rodents suggest the presence of a hepatopancreatic stem cell in adult pancreas that may give rise to liver cells in vivo. The aim of the present study was to determine the ability of human islet-derived cells to adopt a hepatic phenotype in vivo. Cultured human islet-derived progenitor cells that did not express albumin in vitro were stained with the red fluorescent dye PKH26 and injected into the liver of severe combined immunodeficiency mice. After 3 or 12 weeks, red fluorescent cells were detected in 11 of 15 livers and were mostly single cells that were well integrated into the liver tissue. Human albumin was found in 8 of 11 animals by immunohistochemistry, and human albumin mRNA was detected in 4 of 10 host livers. The mechanism underlying this phenomenon seems to be transdifferentiation, because human and mouse albumin were found to be expressed in distinct cells in the host liver.
 |
INTRODUCTION
|
|---|
During embryogenesis, progenitor cells of pancreas and liver emerge from neighboring areas of the gut endoderm [1]. There is a large body of evidence suggesting that such progenitors with the potential to generate liver cells from pancreatic cells and vice versa may still exist in adult life [25]. Using the model of mice with a knockout of the tyrosine catabolic enzyme fumarylacetoacetate hydrolase (FAH), which, without treatment, results in liver cirrhosis, Wang et al. [6] succeeded in correction of liver function by transplantation of cell suspensions from adult pancreas of wild-type animals. With this unique repopulation assay, the authors clearly demonstrated that progenitor cells with the ability not only to replace FAH knockout cells in the liver but also to correct the liver function exist in the pancreas, although the exact nature of these cells remains unknown. Interestingly, cells from cultured pancreatic ducts were not able to rescue the failing liver as did the crude pancreatic cell suspension [6], indicating that the presumed hepatopancreatic stem cells reside in areas outside the pancreatic ducts.
Numerous studies have shown the transdifferentiation potential of pancreatic cells of rodents into hepatocytes in vivo. Some very rare cases of human pancreatic cancer with hepatoid phenotype indicated the existence of similar cells in human pancreas [7]. Recently, progenitor cells have been described in rodent and human islets of Langerhans that express the neural stem cell marker nestin [8] and the side-population phenotype marker ABCG2 [9]. The side-population cells in bone marrow represent a particularly potent stem cell population [10]. Interestingly, the human nestin-expressing islet-derived progenitor (NIP) cells were able to adopt a hepatic phenotype in vitro with expression of markers like alpha feto protein and the transcription factor XBP [8]. In contrast to animal data, however, no in vivo studies have been published so far demonstrating transdifferentiation of human pancreatic cells into a hepatic phenotype. Recently, in vivo models for transplantation of human cord blood cells into severe combined immunodeficiency (SCID) mouse liver have been established [11, 12]. Using the model with direct injection of cells into the liver, we demonstrate in the present report that human cells from cultured pancreatic islets of Langerhans engraft into SCID mouse liver and form cells expressing human albumin in vivo.
 |
MATERIALS AND METHODS
|
|---|
Highly purified human islets are donations from the islet transplantation center in Geneva, Switzerland (Drs. José Oberholzer and Thierry Berney). Growth and expansion of nestin-positive cells were induced by RPMI-1640 medium with 10% fetal calf serum and supplemented with basic fibroblast growth factor and epidermal growth factor (20 ng/ml of each). Nestin-positive cells were characterized by reverse transcriptionpolymerase chain reaction (RT-PCR) and immunocytochemistry. More than 90% of cells were nestin positive. They were cultured for 4 months in the expansion medium, which was changed every 35 days. Trypsinization and reseeding were performed every 1014 days. All experiments were done with cells of passage 4 through 9. Before transplantation, NIP cells were harvested by trypsinization, washed twice with phosphate-buffered saline (PBS), and stained with the red fluorescent dye PKH26 (Sigma) according to the staining protocol of the supplier (Sigma). The concentration of PKH26 during incubation with NIP cells was 4 µM. Incubation was performed for 4 minutes at 25°C with 107 NIP cells per ml. Williams E medium with 1% bovine serum albumin (BSA) was used to stop the staining reaction. All centrifugation and washing steps during the staining procedure were performed at room temperature. Afterward, the NIP cells were resuspended in PBS at a concentration of 1.5 x 104 cells, 1.5 x 105, and 7.5 x 105 per 100 µl (Table 1
).
View this table:
[in this window]
[in a new window]
|
Table 1. Detection of donor-derived cells after transplantation of islet-derived progenitor cells into severe combined immunodeficiency mouse livers
|
|
The transplantation protocol was approved by the Animal Care and Use Committee in Rheinland-Pfalz, Germany. SCID mice (age, 620 weeks; weight, 1827 g) were obtained from Charles-River (Sulzfeld, Germany). They were fed a standard diet purchased from Sniff (Soest, Germany) and acidified drinking water ad libitum. Before transplantation, mice were anaesthetized by intraperitoneal injection of 61.5 mg/kg ketamine (ketamin-ratiopharm 50, Ratiopharm, Ulm, Germany) and 2.3 mg/kg xylazine (Rompun 2%, Bayer, Leverkusen, Germany). Ketamine and xylazine were combined immediately before administration. The peritoneal cavity was opened directly below the xiphoid cartilage, and the NIP cells were slowly (100 µl in approximately 60 seconds) injected into the parenchyma of the protruding liver lobe using a 26-gauge needle (0.45 x 25, Henke-Sass, Tuttlingen, Germany). Immediately before injection, the cell suspension was warmed to 37°C. Successful injection was approved by a short-term paleness of the liver lobe. Previously, negative findings regarding fluorescence signals, RT-PCR, and immunohistochemistry (see below) have been observed after injection of human mononuclear cells as controls [11].
Three or 12 weeks after transplantation (Table 1
), SCID mice were killed by neck dislocation, and after opening the peritoneal cavity, the protruding liver lobe that received the injection was excised. This liver lobe was divided into three parts. One part was fixed in 4% paraformaldehyde for immunohistochemical analysis, and two parts were shock frozen in liquid nitrogen for RNA isolation and fluorescence microscopy. Using a cryotome (CM 3000 cryostat, Leica Instruments GmbH, Nussloch, Germany), 5-µm-thick cryosections were produced. Cryosections were transferred onto Super-Frost Plus slides (Menzel, Braunschweig, Germany), air dried, and immediately analyzed by fluorescence microscopy using a standard filter setup for visualization of PKH26.
For immunohistochemistry, peroxidase was blocked in 7.5% H2O2 in methanol for 60 minutes at 4°C. Unspecific binding sites were blocked in 3% BSA for 2.5 hours at 37°C. Afterward, an avidin/biotin-block (Vector Laboratories, Burlingame, CA) was performed as described by the manufacturer. Slides were then incubated with a 1:50 dilution of an affinity purified human albumin antibody produced in goat (Bethyl Laboratories, Montgomery, TX; catalogue No. A80-229A) for 60 minutes at room temperature. Detection of first antibody was performed using commercial Vectastain Elite ABC Kit (Vector Laboratories) as described by the manufacturer, followed by a 5-minute incubation with 0.6 mg/mL diaminobenzidine at room temperature. Finally, the sections were counterstained with a 1:5 dilution of Mayers hemalum (Merck, Darmstadt, Germany).
For fluorescence-immunohistochemistry (confocal microscopy, 630-fold magnification), human albumin was detected using a polyclonal anti-human albumin antibody raised in rabbit (Abcam Ltd.) in a 1:500 dilution. Detection of the primary antibody was performed using a Cy3-labeled secondary antibody against rabbit, raised in donkey (Dianova GmbH) in a 1:1000 dilution. Counterstaining was done using 4',6'-diamidino-2-phenylindole (DAPI) (Molecular Probes) at a concentration of 2.3 µg/1,000 µL. Mouse albumin was detected using a polyclonal fluorescein isothiocyanatelabeled anti-mouse albumin antibody raised in goat (Bethyl Ltd.) in a 1:25 dilution. Counterstaining was done using DAPI (Molecular Probes) at a concentration of 2.3 µg/1,000 µL. A digital overlay was performed of Figures 2B and 2C
.
For RT-PCR, homogenization of liver samples was performed by a polytron homogenizer, and total RNA was isolated using RNeasy Midi Kit (Qiagen, Hombrechtikon, Switzerland). Total RNA, 1 µg, was subjected to RT-PCR using Omniscript and Taq PCR core kit (Qiagen). Negative controls without reverse transcriptase enzyme were run in parallel to exclude possible contamination. C-DNA was amplified for 38 cycles (94°C for 30 seconds; annealing temperature 60°C for 60 seconds; 72°C for 60 seconds) using the following human-specific, intron-spanning primers: albumin forward ACTTTTATGCCCCGGAACTC and reverse AGCAGCAGCACGACAGAGTA, ABCG2 forward CACA GGTGGAGGCAAATCTT and reverse TCCAGACACAC-CACGGATAA, SCF forward GGTGGCAAATCTTCCAA AAG and reverse TCTTTCACGCACTCCACAAG, c-Kit forward GGCATCACGGTGACTTCAAT and reverse GGT TTGGGGAATGCTTCATA, Thy-1 forward GTCCTTTC TCCCCCAATCTC and reverse GGGAGACCTGCAAGAC TGTT, IPF-1 forward CCTTTCCCATGGATGAAGTC and reverse TTGTCCTCCTCCTTTTTCCA, insulin forward CTACCTAGTGTGCGGGGAAC and reverse GCTGGTA GAGGGAGCAGATG, CD45 forward CAGGCAGCAAT GCTATCTCA and reverse CTGTGATGGTGGTGTTG-GAG, and adenine phosphoribosyltransferase (APRT) forward GCGTGGTATTCAGGGACATC and reverse CAGGG CGTCTTTCTGAATCT. Identity of the amplified PCR product was confirmed by sequencing.
Normal human metaphase spreads were prepared from approximately 70% confluent NIP cells in a T25 culture flask by addition of 20 µl colcemid (10 µg/ml, Karyo Max, Gibco-BRL) and incubation for 1.5 hours. Cells were then trypsinized, pelleted, and resuspended in hypotonic solution (KCl-Na-citrate). After fixation with methanol/acetic acid (3:1), typsin/giemsa G-banding was performed according to standard laboratory procedures. Slides were examined with a ZEISS-Axiophot (Zeiss), and images were taken using a CCD camera (Cohu) and specially designed software (Karyotech 2000).
 |
RESULTS
|
|---|
NIP cells expressed beside nestin also the side-population marker ABCG2 as well as SCF, c-Kit, and Thy-1, another potential marker for hepatic stem/progenitor cells (Fig. 1A
). These cells were negative for expression of the transcription factor IPF-1 and insulin but also the specific marker for hematopoietic cells CD45 (Fig. 1B
). Before transplantation, no albumin expression was found in cultured NIP cells (Fig. 1C
). To exclude numerical or structural chromosomal aberration due to prolonged growth stimulation in vitro, a karyotyping was performed and revealed a normal 46, XX karyotype (Fig. 2
).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 1. (A): NIP cells not only express the neural stem cell marker nestin but also the side-population marker ABCG2, SCF, c-Kit, and the hepatic stem cell marker Thy-1. NIP cells did not express IPF-1 or insulin. The human housekeeping gene APRT was used as positive control for RT-PCR. (B): Lack of CD45 expression in NIP cells with positive signal in human cord blood cells. (C): Detection of human albumin in SCID mouse liver after transplantation of NIP cells. RT-PCR analysis shows the expression of human albumin mRNA in transplanted SCID mouse number 18. Human albumin is not expressed by cultured NIP cells. HepG2 cells were used as positive control. SCID mouse liver was used as negative control. The origin of all PCR products was confirmed by sequencing. Abbreviations: APRT, adenine phosphoribosyltransferase; NIP, nestin-expressing islet-derived progenitor; RT-PCR, reverse transcriptionpolymerase chain reaction; SCID, severe combined immunodeficiency.
|
|
Transplantation of 1.5 x 104 human NIP cells failed to result in detectable red fluorescent cells that became detectable only after transplantation of 1.5 x 105 cells in three of four animals (Table 1
). We next evaluated the impact of time after transplantation on engraftment frequency and found similar results 3 and 12 weeks after transplantation. Cells expressing human albumin were found in liver sections of 8 out of 11 animals. The cells were well integrated into the liver tissue and were predominantly found adjacent to vascular structures (Fig. 3
). Transplantation of NIP cells without prior tagging with PKH26 seemed to be more successful and resulted in detection of human albumin-positive cells in all four grafted animals. To analyze fusion as a possible mechanism underlying this phenomenon, immunohistochemistry studies were performed using mouse-specific and human-specific anti-albumin antibodies. In case of fusion, we expected both types of albumin to be expressed in the grafted cell. Using confocal microscopy, expression of human and mouse albumin was found in distinct cells, suggesting that NIP cells did adopt a hepatic phenotype by differentiation induced by surrounding liver tissue rather than fusion (Fig. 4
). Additionally, RT-PCR was performed, demonstrating the presence of human albumin mRNA in 4 of 10 animals (Fig. 1C
). In the four human albuminpositive livers, the human APRT was also amplified using RT-PCR, although the signal was less abundant than albumin (data not shown). No mononuclear cell infiltration associated with human albuminpositive cells and no neoplasm were observed 3 and 12 weeks after transplantation. In our model, the occurrence of human albuminpositive cells in general, however, was a rare event, with detection of one to three positive cells on every second slice.

View larger version (173K):
[in this window]
[in a new window]
|
Figure 3. Immunohistochemistry 3 weeks after transplantation of human islet-derived progenitor cells into SCID mouse liver using a monoclonal antibody specific for human albumin and diaminobenzidine (brown) for staining (A), nontransplanted SCID mouse liver as negative control (B), and human liver (C) as positive control (bar = 20 µm). Note the proximity of grafted cells to vascular structures.
|
|

View larger version (106K):
[in this window]
[in a new window]
|
Figure 4. Fluorescence-immunohistochemistry with human and mouse specific antibodies against albumin using confocal microscopy with 630-fold magnification. (A): One cell stained with antibodies against human albumin. (B): The same cell with additional 4',6'-diamidino-2-phenylindole staining for cell nuclei. (C):Albumin staining with antibodies against mouse albumin. (D): Digital overlay of human and mouse albumin staining showing no costaining for mouse albumin in the human albumin-positive cell.
|
|
 |
DISCUSSION
|
|---|
Adoption of a hepatic phenotype by human NIP cells has been previously described in vitro [8], suggesting that these cells may represent a common hepatopancreatic precursor. In the present study, we show for the first time that cultured NIP cells from human islets of Langerhans express human albumin in vivo when transplanted into SCID mouse liver. During the expansion period, these cells were negative for the albumin transcript and thus acquired this phenotype after injection into the liver only. The immunohistochemistry results clearly show the expression of human albumin after transplantation and demonstrate that these cells are well integrated into the host liver tissue (Fig. 3
), although it was in general a rare event, with one to three cells every second slice. The human albuminpositive cells were found mostly as scattered single cells, with rarely also formation of small clusters. Interestingly, we found more human albuminpositive cells after transplantation without labeling with PKH26, probably because of its known cytotoxic effect [13]. The dose-finding experiment showed that at least 1.5 x 105 injected cells are required for detection of human albuminpositive cells, and the best results were obtained with 7.5 x 105 cells, in which human albuminexpressing cells were found in all recipient livers. Interestingly, many of the scattered cells were found adjacent to vascular structures (Fig. 3
), as already described by Newsome et al. [12] in their study with infused human cord blood cells. In their report, the appearance of human albuminpositive cells in general was a rare event, with similar efficiency after 4, 6, or 16 weeks [12]. Likewise, we have seen very similar results 3 and 12 weeks after transplantation, although we did not quantify the real transplantation efficiency in this proof-of-principle study. The RT-PCR studies confirmed the immunohistochemistry results in some but not all animals (Fig. 1
, Table 1
). This may be because of the enormous dilution of human mRNA with mouse mRNA in the RT process. The appearance of human albuminpositive cells in the transplanted livers does not necessarily indicate fully functioning hepatocytes, although albumin is the most characteristic protein synthesized by mature liver, accounting for more than 10% of total protein synthesis and the most abundant transcript in hepatocytes [14].
In the elegant studies by Wang et al. [6], a repopulation assay of FAH-deficient animals was used as a gold standard to determine the replacement of liver function by pancreatic stem/progenitor cells in the failing organ. This type of experiment, however, is not yet feasible for studies with human cells using SCID mice as recipients.
The mechanism underlying the adoption of a hepatic phenotype by grafted human NIP cells seems to be transdifferentiation rather than fusion, because expression of mouse and human albumin was found in distinct cells (Fig. 4
). In a fused cell, we would expect to find expression of mouse and human albumin in the same cell. Fusion, however, cannot be excluded based on these findings alone, although it seems less likely. In particular, we cannot rule out that fusion was indeed the initial event, followed by reduction division, which restored the cell to its normal (in our case human) diploid state with expression of human albumin only. Reduction division after fusion has been described for hematopoietic cells that fused with hepatocytes [15]. An increasing number of most recent reports demonstrates that cell fusion is a common phenomenon when hematopoietic stem cells engraft into liver tissue [15, 16] and in the central nervous system [17]. Moreover, fusion of human hematopoietic stem cells that were injected in utero in swine were shown to yield transdifferentiation and retroviral transfer among species [18], indicating that fusion of stem cells may be a common phenomenon in vivo. However, transdifferentiation of hematopoietic stem cells into hepatocytes without evidence for fusion was also reported recently [12]. Cell fusion in vivo has been described for hematopoietic stem cells but not pancreatic stem cells. The NIP cells used in our study were negative for the specific marker for hematopoietic cells CD45 (Fig. 1B
).
Recently, human nestin-positive islet-derived progenitor cells have been shown to engraft into many tissues, including the liver, of immunocompetent mice [19] without rejection, although the investigators did not analyze the expression of tissue-specific genes of human origin. This remarkable study, however, stresses a particular characteristic of NIP cells as stem/progenitor cells that are not rejected in a xeno-transplantation setting [19].
In the present study, expression of human albumin in SCID mouse liver after transplantation of NIP cells is another important in vivo proof for the stem cell potential of these cells.
 |
SUMMARY
|
|---|
Human islet-derived stem cells are capable of adopting a hepatic phenotype in a SCID mouse liver in vivo, suggesting the presence of a hepatopancreatic stem/progenitor cell within or adjacent to the islets of Langerhans. The mechanism underlying this phenomenon seems to be trans-differentiation, although fusion with host hepatocyte cannot be completely ruled out. In the context of these recent findings, one could envision new therapeutic avenues for the treatment of liver cirrhosis using human pancreatic stem/ progenitor cells in which such cells could be isolated from pancreatic biopsies and expanded in vitro before trans plantation.
 |
ACKNOWLEDGMENTS
|
|---|
We thank M. Holl for expert technical assistance. This study was supported by the German Research Foundation, the German Federal Ministry of Education and Research, the Swiss National Research Foundation (404640-101232 to H.Z.) and the Juvenile Diabetes Research Foundation (5-2001-857 to H.Z.), and the Interdisciplinary Centre for Clinical Research at the University of Leipzig (01KS9504, project Z10).
 |
REFERENCES
|
|---|
- Deutsch G, Jung J, Zheng M et al. A bipotential precursor population for pancreas and liver within the embryonic endoderm. Development 2001;128:871881.[Abstract]
- Grompe M. Pancreatic-hepatic switches in vivo. Mech Dev 2003;120:99106.[CrossRef][Medline]
- Shen CN, Horb ME, Slack JM et al. Transdifferentiation of pancreas to liver. Mech Dev 2003;120:107116.[CrossRef][Medline]
- Horb ME, Shen CN, Tosh D et al. Experimental conversion of liver to pancreas. Curr Biol 2003;13:105115.[CrossRef][Medline]
- Zalzman M, Gupta S, Giri RK et al. Reversal of hyperglycemia in mice by using human expandable insulin-producing cells differentiated from fetal liver progenitor cells. Proc Natl Acad Sci U S A 2003;100:72537258.[Abstract/Free Full Text]
- Wang X, Al-Dhalimy M, Lagasse E et al. Liver repopulation and correction of metabolic liver disease by transplanted adult mouse pancreatic cells. Am J Pathol 2001;158:571579.[Abstract/Free Full Text]
- Paner GP, Thompson KS, Reyes CV. Hepatoid carcinoma of the pancreas. Cancer 2000;88:15821589.[CrossRef][Medline]
- Zulewski H, Abraham EJ, Gerlach MJ et al. Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 2001;50:521533.[Abstract/Free Full Text]
- Lechner A, Leech CA, Abraham EJ et al. Nestin-positive progenitor cells derived from adult human pancreatic islets of Langerhans contain side population (SP) cells defined by expression of the ABCG2 (BCRP1) ATP-binding cassette transporter. Biochem Biophys Res Commun 2002;293: 670674.[CrossRef][Medline]
- Zhou S, Schuetz JD, Bunting KD et al. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med 2001;7:10281034.[CrossRef][Medline]
- Beerheide W, von Mach MA, Ringel M et al. Downregulation of beta2-microglobulin in human cord blood stem cells after transplantation into livers of SCID-mice: an escape mechanism of stem cells? Biochem Biophys Res Commun 2002;294:10521063.[CrossRef][Medline]
- Newsome PN, Johannessen I, Boyle S et al. Human cord blood-derived cells can differentiate into hepatocytes in the mouse liver with no evidence of cellular fusion. Gastroenterology 2003;124:18911900.[CrossRef][Medline]
- Oh DJ, Lee GM, Francis K et al. Phototoxicity of the fluorescent membrane dyes PKH2 and PKH26 on the human hematopoietic KG1a progenitor cell line. Cytometry 1999;36:312318.[CrossRef][Medline]
- Eferl J, Sibilia M, Hilberg F et al. Functions of c-jun in liver and heart development. J Cell Biol 1999;145:10491061.[Abstract/Free Full Text]
- Wang X, Willenbring H, Akkari Y et al. Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature 2003;422:897901.[CrossRef][Medline]
- Camargo FD, Finegold M, Goodell MA. Hematopoietic myelomonocytic cells are the major source of hepatocyte fusion partners. J Clin Invest 2004;113:12661270.[CrossRef][Medline]
- Weimann JM, Johansson CB, Trejo A et al. Stable reprogrammed heterokaryons form spontaneously in Purkinje neurons after bone marrow transplant. Nat Cell Biol 2003;5:959966.[CrossRef][Medline]
- Ogle BM, Butters KA, Plummer TB et al. Spontaneous fusion of cells between species yields transdifferentiation and retroviral transfer in vivo. FASEB J 2004;18:548550.[Abstract/Free Full Text]
- Abraham EJ, Kodama S, Lin JC et al. Human pancreatic progenitor cell engraftment in immunocompetent mice. Am J Pathol 2004;164:817830.[Abstract/Free Full Text]
Received March 17, 2004;
accepted for publication September 28, 2004.
This article has been cited by other articles:

|
 |

|
 |
 
B. Tanner, D. Hasenclever, K. Stern, W. Schormann, M. Bezler, M. Hermes, M. Brulport, A. Bauer, I. B. Schiffer, S. Gebhard, et al.
ErbB-3 Predicts Survival in Ovarian Cancer
J. Clin. Oncol.,
September 10, 2006;
24(26):
4317 - 4323.
[Abstract]
[Full Text]
[PDF]
|
 |
|
