Stem Cells http://www.stemcellsportal.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ben-Hur, T.
Right arrow Articles by Reubinoff, B. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ben-Hur, T.
Right arrow Articles by Reubinoff, B. E.

Stem Cells 2004;22:1246-1255 www.StemCells.com
© 2004 AlphaMed Press

Transplantation of Human Embryonic Stem Cell–Derived Neural Progenitors Improves Behavioral Deficit in Parkinsonian Rats

Tamir Ben-Hura, Maria Idelsonb, Hanita Khanerb, Martin Perac, Etti Reinhartza, Anna Itzika, Benjamin E. Reubinoffb,d

a Department of Neurology, Agnes Ginges Center for Human Neurogenetics,
b Hadassah Embryonic Stem Cell Research Center, Goldyne Savad Institute of Gene Therapy, Hadassah University Hospital, Jerusalem, Israel;
c Monash Institute of Reproduction and Development, Monash University, Australia;
d Department of Obstetrics and Gynecology, Hadassah University Hospital, Jerusalem, Israel

Key Words. Parkinson’s disease • Cell therapy • Human ES cells

Correspondence: Benjamin E. Reubinoff, M.D., Goldyne Savad Institute of Gene Therapy, Hadassah University Hospital, Ein-Kerem, P.O.B. 12,000, Jerusalem, Israel 91120. Telephone: 972-2-6778589; Fax: 972-2-6430982; e-mail: reubinof{at}md2.huji.ac.il


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
Human embryonic stem cells (hESCs) may potentially serve as a renewable source of cells for transplantation. In Parkinson’s disease, hESC-derived dopaminergic (DA) neurons may replace the degenerated neurons in the brain. Here, we generated highly enriched cultures of neural progenitors from hESCs and grafted the progenitors into the striatum of Parkinsonian rats. The grafts survived for at least 12 weeks, the transplanted cells stopped proliferating, and teratomas were not observed. The grafted cells differentiated in vivo into DA neurons, though at a low prevalence similar to that observed following spontaneous differentiation in vitro. Transplanted rats exhibited a significant partial correction of D-amphetamine and apomorphine-induced rotational behavior, along with a significant improvement in stepping and placing non-pharmacological behavioral tests. While transplantation of uncommitted hESC-derived neural progenitors induced partial behavioral recovery, our data indicate that the host-lesioned striatum could not direct the transplanted neural progenitors to acquire a dopaminergic fate. Hence, induction of their differentiation toward a midbrain fate prior to transplantation is probably required for complete correction of behavioral deficit. Our observations encourage further developments for the potential use of hESCs in the treatment of Parkinson’s disease.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
Pharmacological treatments of Parkinson’s disease have limited long-term success and are associated with serious motor side effects. Transplantation of dopaminergic (DA) neurons is an alternative potential therapeutic approach, and clinical relief of Parkinsonism has been demonstrated in some patients following implantation of fetal-derived DA neurons [13]. However, limited donor tissue supply, ethical considerations, and complicating dyskinesias are major limitations of this mode of therapy.

Pluripotent human embryonic stem cells (hESCs) [4, 5], which potentially proliferate indefinitely in culture, may supply unlimited numbers of DA neurons for transplantation. The potential of mouse ES cells to generate functional DA neurons and to correct behavioral deficits after engraftment into Parkinsonian rats has been demonstrated [6, 7]. When low numbers of undifferentiated mouse ES cells were implanted into the rat DA-depleted striatum, the cells proliferated and differentiated into functional DA neurons that reduced Parkinsonism. However, lethal teratomas developed in 20% of the animals [6]. In an alternative approach, highly enriched populations of midbrain neural precursors were developed in vitro from mouse ES cells and then implanted into Parkinsonian rats. The engrafted cells led to the recovery from Parkinsonism, and teratoma tumor formation was not observed [7]. The potential therapeutic effect of engrafted hESCs in a Parkinsonian animal model has not yet been evaluated.

We previously derived highly enriched cultures of neural progenitors (NPs) from hESCs [8]. These NPs may serve as a platform for generating DA neurons to treat Parkinsonism. Here, we have implanted the human NPs into Parkinsonian rats. We demonstrate the long-term survival of the graft, lack of teratoma formation, spontaneous differentiation of a relatively small fraction of the transplanted cells into DA neurons, and a significant partial behavioral improvement in the transplanted animals.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
Cell Culture
hESCs (HES-1 cell line) [5] with a stable normal (46XX) karyotype were cultured on a mitomycin C–treated mouse embryonic fibroblast feeder layer in gelatin-coated tissue culture dishes, as previously described [5]. To induce neural differentiation, clumps of undifferentiated hESCs were plated on fresh mitotically inactivated feeders and cultured for 8 days in serum-containing medium comprised of Dulbecco’s Modified Eagle’s Media (DMEM; Gibco, Gaithersburg, MD) containing glucose at 4500 mg/L without sodium pyruvate, supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), 0.1 mM ß-mercaptoethanol, 1% nonessential amino acids, 2 mM glutamine, penicillin at 50 U/ml, streptomycin (Gibco) at 50 µg/ml, and noggin (R&D Systems Inc., Minneapolis) at 500 ng/ml. The medium was replaced every other day. Noggin was then omitted, and the cells were further cultured in the same medium for an additional 6 days. At this time, 70%–90% of the colonies differentiated almost uniformly into tightly packed small cells with a uniform gray opaque appearance under dark field stereomicroscopy. Patches containing about 150 cells each were cut out from the gray opaque areas using a razor blade (surgical blade #15), then replated in serum-free medium that consisted of DMEM/F12 (1:1), B27 supplementation (1:50), 2 mM glutamine, penicillin at 50 U/ml, and streptomycin (Gibco) at 50 µg/ml, supplemented with 20 ng of human recombinant epidermal growth factor per ml, and 20 ng of basic fibroblast growth factor per ml (R&D Systems, Inc.). The clusters of cells developed into round spheres that were subcultured once a week, as previously described [8]. The medium was replaced twice a week.

Immunocytochemical Studies
Differentiation was induced on laminin as previously described [8]. Cells were fixed with 4% paraformaldehyde, either 18 hours (for NP markers) or 1 week (for neuronal markers) after plating, then stained for neural cell adhesion molecule (NCAM) (1:10; Dako, Carpinteria, CA), nestin (1:200), polysialic acid NCAM (PSA-NCAM) (1:200; both from Chemicon, Temecula, CA), A2B5 (1:20; American Type Culture Collection [ATCC], Manassas, VA), ß-tubulin III (1:2000) and serotonin (1:1000; both from Sigma, St. Louis), and tyrosine hydroxylase (TH) (1:100; Pel-Freez, Rogeus, AZ). Primary antibody localization was performed by using swine anti-rabbit and goat anti-mouse immunoglobulins conjugated to fluorescein isothiocyanate (FITC) (Dako, A/S Denmark; 1:20–50), goat anti-mouse immunoglobulin M (IgM) conjugated to FITC (Jackson Laboratory, West Grove, PA; 1:100), goat anti-rabbit Ig conjugated to Texas Red (Jackson Laboratory; 1:100), and goat anti-mouse IgG conjugated to CyTH3 (Jackson Laboratory; 1:500). Proper controls for primary and secondary antibodies revealed neither nonspecific staining nor antibody cross-reactivity. To determine the percentage of specific cell types, 200–500 cells were scored within random fields for each marker in three separate experiments.

RT-PCRAnalysis
Total RNA was extracted from (a) hESC colonies (1 week after passage), (b) free-floating spheres after 6 weeks in culture, and (c) differentiated cells growing from the spheres 1 week after plating in differentiation-inducing conditions, as detailed above. The medium that was used to induce differentiation was supplemented with the combination of 400 µM ascorbic acid (Sigma) and the survival factors NT3 at 10 ng/ml, NT4 at 20 ng/ml, and BDNF at 10 ng/ml (all human recombinants from R&D Systems Inc.). Total RNA was isolated using RNA STAT-60 solution (TEL-TEST, Inc., Friendswood, TX) or TRI-reagent (Sigma), followed by treatment with RNase-free DNase (Ambion, RNA Company, Austin, TX). The cDNA synthesis was carried out using Moloney murine leukemia virus reverse transcriptase (RT) and oligo as a primer, according to the manufacturer’s instructions (Promega, Madison, WI). To analyze relative expression of different mRNAs, the amount of cDNA was normalized based on the signal from glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Levels of different mRNAs expressed by neural spheres and differentiated cells were compared with that in the undifferentiated hESCs. Polymerase chain reaction (PCR) was carried out using standard protocols with Taq DNA polymerase (Gibco). Amplification conditions were as follows: denaturation at 94°C for 15 seconds, annealing at 55–60°C for 30 seconds, and extension at 72°C for 45 seconds. The number of cycles varied between 18 and 40, depending on the abundance of particular mRNA. Primer sequences (forward and reverse 5'-3') and the length of the amplified products were as follows:

Oct4 (CGTTCTCTTTGGAAAGGTGTTC, ACACTCGGACCACGTCTTTC; 320 bp)

Otx2 (CGCCTTACGCAGTCAATGGG, CGGGAAGCTGGTGATGCATAG; 641 bp)

Pax2 (TTTGTGAACGGCCGGCCCCTA, CATTGTCACAGATGCCCTCGG; 300 bp)

Pax5 (CCGAGCAGACCACAGAGTATTCA, CAGTGACGGTCATAGGCAGTGG; 403 bp)

En1 (CTGGGTGTACTGCACACGTTAT, TACTCGCTCTCGTCTTTGTCCT; 357 bp)

En2 (GTGGGTCTACTGTACGCGCT, CCTACTCGCTGTCCGACTTG; 368 bp)

Lmx1B (TCCTGATGCGAGTCAACGAGTC, CTGCCAGTGTCTCTCGGACCTT; 561 bp)

Nurr1 (GCACTTCGGCAGAGTTGAATGA, GGTGGCTGTGTTGCTGGTAGTT; 491 bp)

Ptx3 (TGGGAGTCTGCCTGTTGCAG, CAGCGAACCGTCCTCTGGG; 372 bp)

TH (GTCCCCTGGTTCCCAAGAAAAGT, TCCAGCTGGGGGATATTGTCTTC; 331 bp)

AADC (CTCGGACCAAAGTGATCCAT, GGGTGGCAACCATAAAGAAA; 252 bp)

Pax6 (AACAGACACAGCCCTCACAAACA, CGGGAACTTGAACTGGAACTGAC; 274 bp)

Nkx2.2 (ACGAATTGACCAAGTGAAGCTAC, AACCCGGGCTGCGGCTGCAGGAAT; 379 bp)

Olig2 (GCTGTGGAAACAGTTTGGGT, AAGGGTGTTACACGGCAGAC; 291 bp)

HB9 (CAAGAAACAGCGAGAGGGAG, AACGCTCGTGACATAATCCC; 300 bp)

ß-actin (CGCACCACTGGCATTGTCAT, TTCTCCTTGATGTCACGCAC; 200 bp)

GAPDH (AGCCACATCGCTCAGACACC, GTACTCAGCGCCAGCATCG; 301 bp)

Sphere Transplantation
6-Hydroxydopamine (8 µg/rat) was stereotaxically injected in 4 µ1 into the right substantia nigra of male Sprague-Dawley rats (weighing 250–280 g; coordinates of injection: P = 4.8, L = 1.7, H = –8.6 from bregma). Eighteen days after 6-hydroxydopamine injection, rats were selected for transplantation if they had >350 rotations per hour after s.c. injection of apomorphine (25 mg/100 g body weight) and, if 2 days later, they also had >360 (mean 520 ± 38) rotations per hour after i.p. injection of D-amphetamine (4 mg/kg). Two to five days later, partially mechanically dissociated spheres (passaged for 6 weeks) were transplanted (400,000 cells in 12–14 µ1/animal [7]) along two tracts per striatum [6] (coordinates: anteromedial tract, A = 1, L = 2, H = –7.5 to –4; posterolateral tract, A–P = 0, L = 3.5, H = –7.5 to –4.5). Control sham-operated rats were injected with vehicle solution. All rats received daily i.p. injections of 10 mg cyclosporine A per kg (Sandimmune; Novartis, Basel, Switzerland).

Behavioral Tests
At 2 weeks and 1, 2, and 3 months after transplantation, the severity of the disease was scored by pharmacological tests in sphere- and vehicle-transplanted animals. Rotations were counted for 1 hour after s.c. injection of apomorphine, and again 2 days later after i.p. D-amphetamine by a computerized rotometer system (San-Diego Instruments, San Diego).

Nonpharmacological tests were performed at 2 weeks and 3 months after transplantation. These included stepping adjustments [9] and forelimb placing [10] tests. The number of stepping adjustments was counted for each forelimb during slow sideway movements in forehand and backhand directions over a standard flat surface. The stepping adjustments test was repeated three times for each forelimb during three consecutive days. The forelimb-placing test assesses the rats’ ability to make directed forelimb movements in response to a sensory stimulus. Rats were held with their limbs hanging unsupported. They were then raised to the side of a table so that their whiskers made contact with the top surface while the length of their body paralleled the edge of the tabletop. Control rats place their forelimb on the tabletop in response to whisker stimulation almost every time, whereas injured rats do not. Each test included 10 trials of placement of each forelimb and was repeated daily for three consecutive days. The results of both tests are expressed as percentage of forelimb stepping adjustments and placing in the lesioned side, as compared with the nonlesioned side. All behavioral tests were performed blinded to treatment.

Brain Immunohistochemistry
Rats were euthanized by pentobarbital overdose and perfused with saline and 4% paraformaldehyde. Serial 8 µm coronal frozen sections were prepared, and every seventh section was stained with hematoxylin and eosin (H&E) to identify and map the grafts’ location. Immunofluorescent stainings were performed following 4% formaldehyde fixation with the following primary antibodies: human-specific mitochondria (MITO, 1:20); TH (1:100), nestin (1:50), Musashi (1:400), neuronal nuclei marker (NeuN, 1:50), human dopamine transporter (DAT, 1:2000), human-specific ribonuclear protein (RNP, acetone fixation, 1:20), proliferating cell nuclear antigen (PCNA, methanol fixation, 1:100; all from Chemicon); glial fibrillary acidic protein (GFAP) (1:200), NCAM (1:10), CD44 (1:20; all from Dako); neuro-filament heavy chain (NF, 1:100), ß-tubulin III (1:50; both from Sigma); and Ki67 antigen (1:100; Novocastra Laboratories, Newcastle, U.K.). Goat anti-mouse IgG conjugated to Alexa 488 or Cy3, goat anti-mouse IgM conjugated to Texas Red, goat anti-rabbit IgG conjugated to Alexa 488 or to Texas Red (Jackson Laboratory; 1:100), and goat anti-rat IgG conjugated to Alexa 488 (Molecular Probes, Eugene, OR; 1:500) were used where appropriate for detection of primary antibodies. The number of 4',6'-diamidino-2-phenylindole hydrochloride (DAPI)+ nuclei within the grafts was counted every fourth section in eight animals using a computerized image analysis system (Image-Pro version 4.1, Media Cybernetics, Silver Spring, MD). The graft borders were defined by anti-human-specific mitochondria staining. Cell counts from serial sections were corrected according to the Abercrombie method (1946) and adjusted to the total size of the graft [11]. From the 10 animals that were evaluated for amphetamine-induced rotational behavior, serial brain sections were available in six animals for counting of TH+ neurons. TH+ neurons were counted every fourth section, double-labeled for TH and human mitochondria, and adjusted for the whole graft following Abercrombie correction (1946) [11]. Images were taken by a fluorescent (Nikon E600, Kanagawa, Japan) and a confocal microscope (Zeiss, Feldbach, Switzerland) to ensure colocalization of nuclear, cytoplasmic, or membranal signals to the same cell.

Statistical Analysis
Values in the behavioral tests and cell counts are given as mean ± standard error. The mean number of rotations in the pharmacological behavioral tests, at baseline and after 12 weeks, were compared by Student’s t-test. The mean results (in percentage) of nonpharmacological tests were also compared among the experimental groups using Student’s t-test. One-tailed analysis of variance, followed by the Bonferroni post hoc test, was used for multiple comparisons in the pharmacological behavioral tests. Pearson’s correlation coefficient was calculated to determine the association between total number of TH+ neurons and recovery of amphetamine-induced rotational behavior. A p < .05 was considered statistically significant.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
Development and Characterization of hESC-Derived NPs
Differentiation of hESCs into highly enriched cultures of NPs was accomplished according to our two-step protocol [8] with some modifications [12]. In the first step, hESC colonies (Fig. 1AGo) were cultured for prolonged periods on feeders in the presence of the bone morphogenetic protein antagonist noggin. Under these culture conditions, in most colonies, the hESCs differentiated almost uniformly into tightly packed small progenitors. In parallel, the colonies acquired a nearly uniform gray opaque appearance under dark field stereomicroscope (Fig. 1BGo). A detailed characterization of these progenitors and the effect of noggin on the differentiation of hESCs are reported elsewhere [12]. In the second step, clumps of 150 progenitors were isolated from the colonies and further propagated for 6 weeks as spheres (Fig. 1CGo) in serum-free medium supplemented with mitogens [8]. Prior to transplantation, the phenotype of the cells within the spheres and their potential to develop into midbrain DA neurons was characterized. Indirect immunofluorescence analysis (Figs. 1D–GGo) demonstrated that >90% of the cells within the spheres expressed NP markers (PSA-NCAM 94.7% ± 2.4%, A2B5 90.7% ± 3.2%, NCAM 91.3% ± 2.2%, nestin 94.7% ± 0.7%). Thus, the spheres were highly enriched for NPs.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 1. Derivation and characterization of spheres. Dark field stereomicroscope images of (A) an undifferentiated hESC colony 1 week after passage; (B) noggin-treated colony at 2 weeks after passage; and (C) hESC-derived spheres. Immunostaining of the progenitors for (D) PSA-NCAM, (E) A2B5, (F) NCAM, and (G) nestin. Double immunolabeling showing differentiated NPs co-expressing ß-tubulin III and (H) TH or (I) serotonin, respectively. Semiquantitative reverse transcription–polymerase chain reaction demonstrating the expression of (J) Oct4, markers along dopaminergic neuron development, forebrain and spinal cord markers within cultures of hESCs, and undifferentiated and differentiated NPs. A ± indicates presence or absence of reverse transcriptase. Space bars: (A, B), 100 µm; (C), 200 µm; (D–I), 50 µm. Abbreviations: hESC, human embryonic stem cell; NP, neural progenitor; PSA-NCAM, polysialic acid neural cell adhesion molecule; TH, tyrosine hydroxylase.

 
Successful differentiation of the hESC-derived NPs into midbrain DA neurons probably requires the induction of the same key regulatory genes that are expressed by NPs during the development of the midbrain in vivo. These genes include the Otx, Pax2, Pax5, En1, En2, Nurr1, and Lmx1b genes [13]. Markers of DA neurons and regulatory genes in their development were expressed by the NPs, suggesting that they had the developmental potential to differentiate into midbrain DA neurons. Markers of other brain areas were also expressed by the spheres. Oct4, a marker of undifferentiated hESCs, was not detected, suggesting that the spheres did not include undifferentiated cells (Fig. 1JGo).

We further characterized the phenotype of the NPs following spontaneous differentiation in vitro. Upon withdrawal of mitogens from the medium and plating on laminin, the spheres attached rapidly, and cells migrated out to form a monolayer of differentiated cells. After 7 days of differentiation, the expression of the regulatory genes of midbrain development and markers of DA neurons was upregulated in the differentiated progeny (Fig. 1JGo). Double-labeling studies showed that 29.0% ± 0.6% of the cells were immunoreactive with anti-ß-tubulin III (a neuronal marker), 0.56% ± 0.05% of the cells co-expressed ß-tubulin III and TH (Fig. 1HGo), and 0.89% ± 0.11% co-expressed ß-tubulin III and serotonin (Fig. 1IGo). These results suggested that a low percentage (<1%) of the progenitors spontaneously differentiated into putative midbrain or hindbrain neurons.

Survival and Differentiation after Transplantation to Parkinsonian Rats
We next explored the survival, differentiation, and function of the NPs after transplantation into the right striatum of Parkinsonian rats. First, 6-hydroxydopamine was injected into the right substantia nigra to deplete dopaminergic innervation in the ipsilateral striatum. At 3 weeks after formation of the lesion, hESC-derived neural spheres that had been passaged for 6 weeks were grafted into the right striatum of rats that were preselected for pharmacological-induced high rotational activity. The rats were sacrificed for histopathological analysis of the graft 24 hours after transplantation (n = 6 animals), and after behavioral follow-up of 12 weeks (21 sphere- and 17 vehicle-grafted rats).

TH immunohistochemistry showed a rich fiber network in the striatum contralateral to the lesion (Fig. 2AGo), but there was no staining on the lesioned side (Fig. 2BGo). The grafts were easily identified in brain sections following H&E staining (Fig. 2CGo), fluorescent DAPI nuclear counterstaining, and indirect immunofluorescence staining for human-specific markers. At 12 weeks after transplantation, a graft was not identified in two rats, and the brains of three rats were processed for RT-PCR analysis (see below). In each of the remaining 16 animals, two grafts were found, most often as a tubular mass of cells along the needle tract within the striatum. In five animals, one of the two grafts was ectopic and was observed as a round mass in the cortex. An inflammatory process was not observed in the transplanted striata or in the control-depleted striata.



View larger version (87K):
[in this window]
[in a new window]
 
Figure 2. Immunohistochemical characterization of transplanted neural progenitors. Immunofluorescence staining for TH in the (A) nonlesioned and (B) lesioned striatum 18 days after 6-hydroxy-dopamine injection. (C): Hematoxylin and eosin staining of a graft 12 weeks after transplantation. (D): Low power field showing the elongated vertical graft in the striatum decorated with human-specific MITO, surrounded by rat tissue. (E): Human identity of cells was confirmed by staining with an anti-RNP antibody (inset: DAPI nuclear counterstain). (F): Immunoreactivity of cells within the graft with human-specific antinestin. (G–J): Confocal microscopy of immunofluorescent-stained sections at 12 weeks post-transplantation showed some human cells expressing markers of neural precursors and also cells expressing glial markers. Confocal images showing grafted cells expressing (G) human mitochondria and mushashi-1, (H) human-specific N-CAM, (I) human-specific CD44, and (J) human mitochondria and GFAP (nuclei indicated by *). (K): Low power image of brain section double stained with antihuman mitochondria and anti–heavy chain NF with DAPI nuclear counterstain, showing that the majority of the transplant did not stain with the neuronal marker. Some NF+ human cells (inset, arrow) were identified mainly near the interface of the graft. (L): Nuclear co-expression of human RNP and NeuN. (M): Double immunostaining of the graft in the striatum showing TH+ cells and fibers within the human mitochondrial–stained graft, with some outgrowth of TH+ fibers at the periphery of graft, into the human mitochondria–negative rat tissue. (N–R): Generation of dopaminergic cells from the transplants. (N):A cell coexpressing TH and human mitochondria within the graft. Confocal microscopy images confirmed the coexpression of human mitochondria and TH [(O): merged image; (P): TH alone; (Q): human mitochondria alone, Nomarsky optics background] or human mitochondria and DAT (R) within the same cells. The nuclei (located by Nomarsky optics) are indicated by asterisks. (S): Immunostaining of the graft for nestin at 24 hours after transplantation. (T–U): Transplanted cells stop proliferating after transplantation. Multiple PCNA+ cells were found at (T) 24 hours post-transplantation but not at (U) 12 weeks after transplantation. Space bars: (G–J) and (L–U), 10 µm; (A, B, D–F, K), 50 µm; (C), 200 µm. All panels apart from (A, B, S, andT) show stainings of grafts 12 weeks after transplantation. Abbreviations: CC, corpus callosum; DAPI, 4',6'-diamidino-2-phenylindole hydrochloride; DAT, human dopamine transporter; GFAP, glial fibrillary acidic protein; MITO, antimitochondria; N-CAM, neural cell adhesion molecule; NeuN, neuronal nuclei marker; NF, neurofilament; PCNA, proliferating cell nuclear antigen; RNP, ribonuclear protein; Str, striatum; TH, tyrosine hydroxylase;V, brain ventricle.

 
We used human-specific anti-mitochondria (Fig. 2DGo) and anti-RNP (Fig. 2EGo) antibodies to specifically identify human cells in transplanted rat brain sections. At 12 weeks post-transplantation, cells that were immunoreactive with the anti-human mitochondria antibodies were found only along the needle tract and within the striatum, and there was no indication of cell migration to neighboring brain regions.

The number of cells within the grafts was evaluated by counting the number of nuclei within the human mitochondria positively stained grafts in serial sections. At 12 weeks post-transplantation, the average number of human cells per striatum was 294,774 ± 72,401 (n = 8), 73.5% of the initial 400,000 cells that were injected into each animal. Survival of the transplanted cells, as well as their proliferation (see below), could contribute to this figure.

Immunostaining with human-specific and neural markers showed cells within the grafts that maintained the phenotype of undifferentiated NPs and expressed nestin, mushashi-1, and NCAM (Fig. 2F–HGo), as well as differentiated cells expressing the astroglial progenitor marker CD44, the astrocyte marker GFAP, and the neuronal markers heavy chain NF and NeuN (Fig. 2I–LGo). Double staining for human mitochondria and TH showed the presence of graft-derived TH+ cells and fibers (Fig. 2M–QGo). TH+ fibers were commonly observed within the area of distribution of the grafted cells in the host striatum, with some outgrowth from this area into the host striatum (Fig. 2MGo). In vehicle-grafted animals, there were no TH+ cells in the ipsilateral striatum.

At 12 weeks post-transplantation, the number of TH+ cells in the human mitochondria–stained areas was counted in serial sections spanning the entire graft in six brains and adjusted to the full volume of the graft. The grafts generated 389 ± 83 TH+ neurons (102–630 TH+ neurons per brain), which were 0.18% ± 0.05% of the total number of cells within the graft.

Cells that were decorated with an antibody directed against human dopamine transporter, a specific marker of DA neurons, were identified within the graft and were undetectable in the striatum of medium-grafted controls (Fig. 2RGo).

To further confirm the expression of human dopaminergic neuronal markers in the transplanted brains, we performed RT-PCR analysis of striatal samples from vehicle-grafted (n = 2) and NP-grafted (n = 3) rats. Human-specific transcripts of midbrain and DA neuron markers were expressed only in samples from NP-grafted animals (Fig. 3FGo). Expression of the transcripts was found only on the transplanted side, and not on the nonlesioned side of the same animals (not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 3. Transplantation of human embryonic stem cell–derived NPs improves motor function in Parkinsonian rats. The number of apomorphine- or D-amphetamine–induced rotations was calculated individually for each rat as a percentage of its performance at baseline. For each time point, the value represents the mean ± standard error percentage of rotations. Rotational behavior that was induced by (A) apomorphine, and (B) D-amphetamine decreased significantly in transplanted animals, as compared with baseline and control rats. Both (C) stepping and (D) placing are indicated as the percentage of forelimb stepping adjustments and placing in the lesioned side, as compared with the nonlesioned side. Both tests improved significantly (p = .0012 and .0003, respectively) in transplanted rats, as compared with controls. (E): The total number of TH+ neurons in the graft of individual rats correlated with the extent of reduction of amphetamine-induced rotations at 12 weeks following transplantation (r = –.97; p = .001). (F): Reverse transcription polymerase chain reaction was used to analyze striata samples from sphere-grafted and vehicle-grafted animals for the expression of human-specific transcripts of midbrain and dopaminergic neuron markers. The human-specific transcripts (for En1, En2, TH, L-AADC, and GAPDH) were expressed only by animals that received NPs and were not detected in sham-operated animals. ß-actin primers were not human specific. A ± indicates presence or absence of reverse transcriptase. {blacksquare}, controls;{Delta}, transplanted group. *p < .05, as compared with baseline and controls for the pharmacological tests and with the control group for the nonpharmacological tests. Abbreviations: AADC, acid decarboxylase; GAPDH, glyceraldehyde-3-phosphate; NP, neural progenitors; TH, tyrosine hydroxylase.

 
Given the potential of ES cells to generate teratomas after transplantation, we evaluated the percentage of proliferating cells within the grafts. At 24 hours post-transplantation, the grafts were heavily stained with the neural precursor cell marker nestin (Fig. 2SGo). At that time, the majority (64.5% ± 0.9%) of cells within the graft were in a proliferative state, as indicated by their immunoreactivity with anti-PCNA (Fig. 2TGo) and anti-ki67 (not shown). At 12 weeks, there were very rare PCNA+ cells (0.2% ± 0.05%; Fig. 2UGo). In addition, serial H&E-stained sections covering the entire brain did not reveal teratomas or any other tumor formation in transplanted rats.

Functional Recovery of Sphere-Grafted Parkinsonian Rats
Pharmacological-induced rotational behavior was measured in rats that were transplanted either with spheres or with medium at 2 weeks (baseline), 4 weeks, 8 weeks, and 12 weeks after engraftment. Two rats in which no graft was found did not exhibit any improvement in motor function and were excluded from the analysis. In transplanted rats (n = 19), apomorphine-induced rotations decreased in the transplanted group from an average of 624 ± 50 times per hour at baseline to 423 ± 36 rotations per hour at 12 weeks (31% decrease, p = .0015; Fig. 3AGo). The control group of rats (n = 17) rotated 567 ± 41 times per hour at baseline and 571 ± 27 after 12 weeks. Amphetamine-induced rotations decreased in the transplanted group of rats (n = 10) from 607 ± 63 per hour at baseline to 334 ± 41 per hour at 12 weeks (45% decrease, p = .001; Fig. 3BGo). Amphetamine-induced rotations increased in the control group (n = 10) from 480 ± 66 times per hour to 571 ± 74 rotations per hour at 12 weeks. The total number of TH+ neurons in the engrafted striatum, at 12 weeks after transplantation, was compared with the degree of behavioral improvement (n = 6 animals; Fig. 3EGo). A significant correlation was found between the number of TH+ neurons and the degree of improvement in amphetamine-induced rotational behavior (r = –.97, p = .001).

Stepping adjustments [9] and forelimb placing [10] are nonpharmacological tests, which may provide a more direct measure of motor deficits that are analogous to those found in human Parkinson’s disease [7]. Stepping and placing were examined at baseline (2 weeks) and at 12 weeks after transplantation. At 2 weeks, the transplanted rats (n = 11) did not make any stepping or placing movements on the lesioned side. At 12 weeks, there was a significant improvement in both nonpharmacological tests and in baseline and control rats (n = 10; Fig. 3C–DGo).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
hESCs attract remarkable interest due to their potential value for cell therapy in Parkinson’s disease. Here, we present the first histological and behavioral analysis following transplantation of hESC-derived neural progeny in a rat model of Parkinson’s disease.

We used a simple protocol to direct the differentiation of hESCs into highly enriched cultures of NPs. The NPs expressed transcripts of key regulatory genes of midbrain development, as well as markers of DA neurons, supporting their potential to differentiate into midbrain DA neurons.

After transplantation, a significant functional effect was apparent, as shown by four different behavioral tests. While the pharmacological tests represent asymmetry in dopamine release and in postsynaptic sensitivity to dopamine, the non-pharmacological tests indicate reduced motor activity, which is more closely relevant to the motor manifestations of human Parkinson’s diseases. The improvement of behavior was correlated with the demonstration of transplant-derived DA cells, as indicated by immunofluorescence stainings and RT-PCR. At the RNA level, human-specific transcripts of key regulatory genes of midbrain development, as well as markers of DA neurons, were observed in brain samples from the location of the graft. At the protein level, human cells decorated with antibodies against the dopamine neuron–specific marker DAT were observed within the grafts.

It has been shown that low numbers of TH+ cells can bring about functional recovery in the rat Parkinson model. Transplantation studies of in vitro–expanded rat mesencephalic precursors demonstrated that 1,200 grafted DA cells induced partial functional recovery [14]. Studies of primary fetal rat mesencephalic grafts demonstrated that 1,200 dopamine neurons induced complete recovery of amphetamine-induced rotational behavior 6 weeks after transplantation, and that about 400 TH+ neurons were required for a 50% reduction in motor asymmetry [15]. In our study, the hESC-derived grafts gave rise to 389 ± 83 TH+ cells, which is consistent with the partial functional effect observed. In addition, the degree of functional improvement correlated with the TH+ cell counts.

Several studies have suggested that behavioral recovery following cell transplantation may be related to a trophic effect on dying host dopamine neurons [16]. It is possible that trophic effects may have partly contributed to the behavioral recovery that we observed. Further studies are required to confirm that hESCs can differentiate into DA neurons with phenotypes, functionality, and interactions with host neurons that are identical to those of authentic midbrain DA neurons, and to evaluate their potential trophic effect.

Transplantation of neural precursors into the brain at the acute stage of stroke or in inflammatory disease results in their migration toward the lesion and differentiation into the type of cells that were injured [17]. Here, the 6-hydroxy-dopamine lesion induces neuronal degeneration that lacks components of active inflammation or a regenerative process in the brain. The host tissue probably could not direct the transplanted NPs to acquire a DA fate and the proportion of graft-derived TH+ cells in vivo was low, which is similar to their spontaneous occurrence in vitro. Therefore, commitment of the human cells to a DA fate, prior to their transplantation, is a prerequisite for obtaining a larger number of graft-derived DA neurons. Also, it will be important to define the specific developmental stage of such committed precursors that will result in optimal survival, functional integration, and behavioral effects.

Transplantation of low numbers of dissociated undifferentiated mouse ES cells into Parkinsonian rats gave rise to a larger number of TH+ neurons than seen in this study [6]. The reason for this difference is unknown. It may be related to the transplantation of dissociated cells in the mouse ES cell study, as opposed to clumps described in this study, to differences in the stage of development of transplanted cells, or to differences in the biology of cells originating from different species.

The undifferentiated ES cells that were transplanted in the mouse study gave rise to teratomas in a high percentage of the animals. Our cultures of committed NPs did not include undifferentiated hESCs, as suggested by the lack of expression of Oct4. At 12 weeks after transplantation, the engrafted NPs ceased to proliferate, and teratomas or non-neural tissue were not observed. Since a comprehensive search for hESC-derived mesodermal and endodermal progeny was not performed, the differentiation of transplanted human cells to non-neural lineages cannot be ruled out. Thus, while these results are encouraging, additional extensive long-term studies are required to determine the safety of hESC-derived neural progeny transplantation and to rule out potential hazards such as tumor formation or the development of non-neural cells.


    CONCLUSIONS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
In conclusion, we show for the first time partial functional recovery following transplantation of hESC-derived NPs in an experimental model of Parkinson’s disease. The transplanted NPs were not directed by the host striatum to differentiate into DA neurons; therefore, induction of their differentiation into a DA fate, prior to transplantation, may potentially improve the functional effect that we have observed [7, 18]. Our observations encourage further efforts that may eventually allow the use of hESCs for the treatment of Parkinson’s disease.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
We gratefully acknowledge the support of Eithan Galun from the Institute of Gene Therapy and Neri Laufer from the Department of Gynecology at Hadassah University Hospital. We also wish to thank Orna Singer, Talia Mordechai, and Pavel Itsykson from the Hadassah Embryonic Stem Cell Research Center for technical support. The study was supported by grants from ESI Pte Ltd. and the National Institute of Neurological Diseases and Stroke.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 

  1. Bjorklund A, Lindvall O. Cell replacement therapies for central nervous system disorders. Nat Neurosci 2000;3: 537–544.[CrossRef][Medline]

  2. Freed CR, Greene PE, Breeze RE et al. Transplantation of embryonic dopamine neurons for severe Parkinson’s disease. N Engl J Med 2001;344:710–719.[Abstract/Free Full Text]

  3. Olanow CW, Goetz CG, Kordower JH et al. A double-blind controlled trial of bilateral fetal nigral transplantation in Parkinson’s disease. Ann Neurol 2003;54:403–414.[CrossRef][Medline]

  4. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  5. Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000;18:399–405.[CrossRef][Medline]

  6. Bjorklund LM, Sanchez-Pernaute R, Chung S et al. Embryonic stem cells develop into functional dopaminergic neurons after transplantation in a Parkinson rat model. Proc Natl Acad Sci U S A 2002;99:2344–2349.[Abstract/Free Full Text]

  7. Kim JH, Auerbach JM, Rodriguez-Gomez JA et al. Dopamine neurons derived from embryonic stem cells function in an animal model of Parkinson’s disease. Nature 2002; 418:50–56.[CrossRef][Medline]

  8. Reubinoff BE, Itsykson P, Turetsky T et al. Neural progenitors from human embryonic stem cells. Nat Biotechnol 2001;19:1134–1140.[CrossRef][Medline]

  9. Olsson M, Nikkhah G, Bentlage C et al. Forelimb akinesia in the rat Parkinson model: differential effects of dopamine agonists and nigral transplants as assessed by a new stepping test. J Neurosci 1995;15:3863–3875.[Abstract]

  10. Lindner MD, Plone MA, Francis JM et al. Rats with partial striatal dopamine depletions exhibit robust and long-lasting behavioral deficits in a simple fixed-ratio bar-pressing task. Behav Brain Res 1997;86:25–40.[CrossRef][Medline]

  11. Abercrombie M. Estimation of nuclear population from microtome sections. Anat Rec 1946;94:239–247.[CrossRef]

  12. Pera MF, Andrade J, Houssami S et al. Regulation of human embryonic stem cell differentiation by BMP-2 and its antagonist noggin. J Cell Sci 2004;117:1269–1280.[Abstract/Free Full Text]

  13. Wurst W, Bally-Cuif L. Neural plate patterning: upstream and downstream of the isthmic organizer. Nat Rev Neurosci 2001;2:99–108.[CrossRef][Medline]

  14. Studer L, Tabar V, McKay RD. Transplantation of expanded mesencephalic precursors leads to recovery in Parkinsonian rats. Nat Neurosci 1998;1:290–295.[CrossRef][Medline]

  15. Nakao N, Frodl EM, Duan WM et al. Lazaroids improve the survival of grafted rat embryonic dopamine neurons. Proc Natl Acad Sci U S A 1994;91:12408–12412.[Abstract/Free Full Text]

  16. Ourednik J, Ourednik V, Lynch WP et al. Neural stem cells display an inherent mechanism for rescuing dysfunctional neurons. Nat Biotechnol 2002;20:1103–1110.[CrossRef][Medline]

  17. Ben-Hur T, Einstein O, Mizrachi-Kol R et al. Transplanted multipotential neural precursor cells migrate into the inflamed white matter in response to experimental autoimmune encephalomyelitis. Glia 2003;41:73–80.[CrossRef][Medline]

  18. Barberi T, Klivenyi P, Calingasan NY et al. Neural subtype specification of fertilization and nuclear transfer embryonic stem cells and application in Parkinsonian mice. Nat Biotechnol 2003;21:1200–1207.[CrossRef][Medline]

Received April 25, 2004; accepted for publication July 13, 2004.



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
M. S. Cho, Y.-E. Lee, J. Y. Kim, S. Chung, Y. H. Cho, D.-S. Kim, S.-M. Kang, H. Lee, M.-H. Kim, J.-H. Kim, et al.
Highly efficient and large-scale generation of functional dopamine neurons from human embryonic stem cells
PNAS, March 4, 2008; 105(9): 3392 - 3397.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
D. Yang, Z.-J. Zhang, M. Oldenburg, M. Ayala, and S.-C. Zhang
Human Embryonic Stem Cell-Derived Dopaminergic Neurons Reverse Functional Deficit in Parkinsonian Rats
Stem Cells, January 1, 2008; 26(1): 55 - 63.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
E. Hedlund, J. Pruszak, A. Ferree, A. Vinuela, S. Hong, O. Isacson, and K.-S. Kim
Selection of Embryonic Stem Cell-Derived Enhanced Green Fluorescent Protein-Positive Dopamine Neurons Using the Tyrosine Hydroxylase Promoter Is Confounded by Reporter Gene Expression in Immature Cell Populations
Stem Cells, May 1, 2007; 25(5): 1126 - 1135.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
S. Shin, Y. Sun, Y. Liu, H. Khaner, S. Svant, J. Cai, Q. X. Xu, B. P. Davidson, S. L. Stice, A. K. Smith, et al.
Whole Genome Analysis of Human Neural Stem Cells Derived from Embryonic Stem Cells and Stem and Progenitor Cells Isolated from Fetal Tissue
Stem Cells, May 1, 2007; 25(5): 1298 - 1306.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J. A. Rodriguez-Gomez, J.-Q. Lu, I. Velasco, S. Rivera, S. S. Zoghbi, J.-S. Liow, J. L. Musachio, F. T. Chin, H. Toyama, J. Seidel, et al.
Persistent Dopamine Functions of Neurons Derived from Embryonic Stem Cells in a Rodent Model of Parkinson Disease
Stem Cells, April 1, 2007; 25(4): 918 - 928.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
K.-C. Sonntag, J. Pruszak, T. Yoshizaki, J. van Arensbergen, R. Sanchez-Pernaute, and O. Isacson
Enhanced Yield of Neuroepithelial Precursors and Midbrain-Like Dopaminergic Neurons from Human Embryonic Stem Cells Using the Bone Morphogenic Protein Antagonist Noggin
Stem Cells, February 1, 2007; 25(2): 411 - 418.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Yasuhara, N. Matsukawa, K. Hara, G. Yu, L. Xu, M. Maki, S. U. Kim, and C. V. Borlongan
Transplantation of Human Neural Stem Cells Exerts Neuroprotection in a Rat Model of Parkinson's Disease
J. Neurosci., November 29, 2006; 26(48): 12497 - 12511.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
P. A De Sousa, G. Galea, and M. Turner
The road to providing human embryo stem cells for therapeutic use: the UK experience.
Reproduction, November 1, 2006; 132(5): 681 - 689.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
L. Gruen and L. Grabel
Concise Review: Scientific and Ethical Roadblocks to Human Embryonic Stem Cell Therapy
Stem Cells, October 1, 2006; 24(10): 2162 - 2169.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
A. Brederlau, A. S. Correia, S. V. Anisimov, M. Elmi, G. Paul, L. Roybon, A. Morizane, F. Bergquist, I. Riebe, U. Nannmark, et al.
Transplantation of Human Embryonic Stem Cell-Derived Cells to a Rat Model of Parkinson's Disease: Effect of In Vitro Differentiation on Graft Survival and Teratoma Formation
Stem Cells, June 1, 2006; 24(6): 1433 - 1440.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Trounson
The Production and Directed Differentiation of Human Embryonic Stem Cells
Endocr. Rev., April 1, 2006; 27(2): 208 - 219.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. W. Lensch and G. Q. Daley
Scientific and clinical opportunities for modeling blood disorders with embryonic stem cells
Blood, April 1, 2006; 107(7): 2605 - 2612.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
H. Fukuda, J. Takahashi, K. Watanabe, H. Hayashi, A. Morizane, M. Koyanagi, Y. Sasai, and N. Hashimoto
Fluorescence-Activated Cell Sorting-Based Purification of Embryonic Stem Cell-Derived Neural Precursors Averts Tumor Formation after Transplantation
Stem Cells, March 1, 2006; 24(3): 763 - 771.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Martinat, J.-J. Bacci, T. Leete, J. Kim, W. B. Vanti, A. H. Newman, J. H. Cha, U. Gether, H. Wang, and A. Abeliovich
Cooperative transcription activation by Nurr1 and Pitx3 induces embryonic stem cell maturation to the midbrain dopamine neuron phenotype
PNAS, February 21, 2006; 103(8): 2874 - 2879.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
S. P. Raikwar, T. Mueller, and N. Zavazava
Strategies for Developing Therapeutic Application of Human Embryonic Stem Cells
Physiology, February 1, 2006; 21(1): 19 - 28.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
E. Banin, A. Obolensky, M. Idelson, I. Hemo, E. Reinhardtz, E. Pikarsky, T. Ben-Hur, and B. Reubinoff
Retinal Incorporation and Differentiation of Neural Precursors Derived from Human Embryonic Stem Cells
Stem Cells, February 1, 2006; 24(2): 246 - 257.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
Y.-S. Fu, Y.-C. Cheng, M.-Y. A. Lin, H. Cheng, P.-M. Chu, S.-C. Chou, Y.-H. Shih, M.-H. Ko, and M.-S. Sung
Conversion of Human Umbilical Cord Mesenchymal Stem Cells in Wharton's Jelly to Dopaminergic Neurons In Vitro: Potential Therapeutic Application for Parkinsonism
Stem Cells, January 1, 2006; 24(1): 115 - 124.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
R. Sanchez-Pernaute, L. Studer, D. Ferrari, A. Perrier, H. Lee, A. Vinuela, and O. Isacson
Long-Term Survival of Dopamine Neurons Derived from Parthenogenetic Primate Embryonic Stem Cells (Cyno-1) After Transplantation
Stem Cells, August 1, 2005; 23(7): 914 - 922.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
L. Thompson, P. Barraud, E. Andersson, D. Kirik, and A. Bjorklund
Identification of Dopaminergic Neurons of Nigral and Ventral Tegmental Area Subtypes in Grafts of Fetal Ventral Mesencephalon Based on Cell Morphology, Protein Expression, and Efferent Projections
J. Neurosci., July 6, 2005; 25(27): 6467 - 6477.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Keller
Embryonic stem cell differentiation: emergence of a new era in biology and medicine
Genes & Dev., May 15, 2005; 19(10): 1129 - 1155.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted