|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ORIGINAL ARTICLE-CHARACTERIZATION SERIES |
a Robarts Research Institute, Krembil Centre for Stem Cell Biology, London, Ontario, Canada;
b Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts, USA;
c CyThera, Inc., San Diego, California, USA
Key Words. Human embryonic stem cells • Epigenesis • X-chromosome inactivation • Differentiation
Correspondence: Melissa K. Carpenter, Ph.D., CyThera, Inc., 3550 General Atomics Court, San Diego, California 92121, USA. Telephone: 858-455-2736; Fax: 858-455-3962; e-mail: mcarpenter{at}cytheraco.com
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The selection of the X chromosome to be inactivated can be either random or nonrandom (imprinted); this selection is tissue specific, with some tissues exhibiting random XCI and others imprinted XCI. Specifically, in mice, X inactivation is imprinted in the extraembryonic trophectoderm and primitive endoderm lineages during preimplantation development [4]; in these tissues, the maternal allele is expressed whereas the paternal allele is silenced. In contrast, cells of the epiblast randomly inactivate either of the X chromosomes. To date, the developmental regulation of XCI in humans is unclear. Studies have demonstrated that XIST is detectable in oocytes and in both male and female preimplantation embryos up until the blastocyst stage of development [5, 6]. In contrast to the mouse, XIST expression in human extraembryonic trophectoderm is not limited to the paternal allele [7, 8]. However, similar to mouse, epiblast derivatives also exhibit random XCI patterns. In both mouse and humans, once an X chromosome is inactivated, the same X is silenced in all descendent cells; thus, females are mosaic for their X inactivation pattern [9, 10].
Evaluation of the mechanisms involved in the process of XCI has largely been limited to studies in mouse ESCs. The recent availability, however, of hESCs now provides a unique tool to assess this process in early human development. hESCs are derived from human blastocysts, have an apparently unlimited proliferative capacity, differentiate into ectoderm, mesoderm, and endoderm, and may therefore provide a model system for studying early developmental processes. In the present study, we demonstrate the novel finding that individual hESC lines exhibit distinct patterns of X inactivation. Further analysis of XCI may thus be an important mechanism by which to examine epigenetic states and developmental competence in hESC lines, important considerations for use of hESCs as a model of early human development or in cell replacement therapies.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Treatment of hESCs with 5-Aza-2'-Deoxycytidine
Upon confluence, H7 and H9 hESCs were passaged into differentiation medium (knockout[KO]-DMEM, 20% fetal bovine serum [FBS], 1% nonessential amino acids, 1 mM glutamine, and 0.1 mM ß-ME) onto Matrigel-coated plates. On days 1 and 2, medium was exchanged with differentiation medium with or without 1, 5, or 10 µM 5-aza-2'-deoxycytidine (cat. #11390; Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), as specified for individual experiments. Cells received either a 24-hour or 48-hour pulse treatment of 5-aza-2'-deoxycytidine, as specified in individual experiments. Cells were collected for analysis on days 3, 7, 14, and 28, as indicated.
Differentiation In Vitro: Formation of Embryoid Bodies
Undifferentiated hESCs were harvested for embryoid body (EB) formation after a 2- to 5-minute incubation in 200 U/ml collagenase at 37°C. hESCs were then resuspended in differentiation medium (KO-DMEM, 20% FBS, 1% nonessential amino acids, 1 mM glutamine, and 0.1 mM ß-ME) and plated on ultralow attachment plates (Corning, Corning, NY, http://www.corning.com). After 4 days in suspension culture, EBs were collected and replated onto gelatin-coated plates (for subsequent RNA isolation) and chamber slides or coverslips (for subsequent immunocytochemistry [ICC] and fluorescence in situ hybridization [FISH] analyses) for the time periods indicated.
Cytogenetic Analysis
Karyotype analysis on each cell line was carried out via g-banding and was conducted at or close to the initiation of each experiment by the Regional Cytogenetics Laboratory, London Health Sciences Center, London, Ontario, Canada (H1, H7, and H9) or at the University of California, San Diego Medical Genetics, Cytogenetic Laboratory, San Diego (BG02 and CyT25). Twenty cells were assessed in each culture tested. Euploid cultures exhibited a normal karyotype in all 20 cells assessed.
Flow Cytometry
Confluent cultures of hESCs were harvested by incubation in collagenase for 35 minutes at 37°C and then with versene (GIBCO, Grand Island, NY, http://www.invitrogen.com) for 1020 minutes at 37°C. The cells were then collected and passed through a 100-µm strainer. All staining was performed in staining buffer (Dulbeccos phosphate-buffered saline [PBS], Ca2+-free, Mg2+-free) supplemented with 2% heat-inactivated fetal bovine serum (Hyclone, Logan, UT, http://www.hyclone.com). After a 15-minute block at 4°C in staining buffer supplemented with 20% normal goat serum, the cells were incubated in primary antibodies for 30 minutes at 4°C. The following antibodies were used: SSEA-4 (MC813-70) (Developmental Studies Hybridoma Bank, University of Iowa, Iowa City, IA, http://www.uiowa.edu/~dshbwww) at a 1:10 dilution; Tra-1-60 (a gift from Dr. Peter Andrews, University of Sheffield, Sheffield, U.K.) at a 1:60 dilution, Tra-1-81 (a gift from Dr. Peter Andrews) at a 1:80 dilution, and SSEA-1 (MC-480) (Developmental Studies Hybridoma Bank) at a 1:40 dilution, as well as appropriate isotype-matched controls (100 µl per test; 5 x 105 cells per sample). Cells were subsequently washed two to three times with staining buffer and incubated for 30 minutes at 4 °C with fluoresce in isothiocyanateconjugated goat F(ab')2 anti-mouse IgG3, 1:100 and phycoerythrin-conjugated goat F(ab')2 anti-mouse IgM, 1:100 (Southern Biotechnology Associates, Birmingham, AL, http://www.southernbiotech.com) as appropriate. Cells were washed once again and resuspended for analysis in staining buffer containing 7-AAD (5 µl per 1 x 106 cells) to identify nonviable cells. Flow cytometric analysis was performed with the FACSCalibur Flow Cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). Acquired data were analyzed with FlowJo software.
Immunofluorescence and In Situ Hybridization
Cell Preparation Cell fixation and preparation was performed in a similar fashion as described by Lawrence et al. [13]. Briefly, cells were plated on either chamber slides or coverslips and rinsed sequentially with the following: x 1 PBS, cytoskeletal (CSK) buffer (100 mM NaCl, 300 mM sucrose, 3 mM MgCl2, and 10 mM PIPES, pH 6.8) for 30 seconds on ice, CSK buffer plus 0.5% Triton X-100 (Sigma-Aldrich) for another 30 seconds on ice, and then CSK buffer alone. The cells were fixed in 4% paraformaldehyde for 10 minutes at room temperature and stored at 4°C in PBS/Tween (0.2%) for subsequent ICC analysis and in 70% EtOH for subsequent FISH analysis.
Immunofluorescence
At 37°C and in a humidity chamber, the cells prepared as above were first blocked with blocking buffer (x 1 PBS, 5% goat serum, and 0.2% Tween) for 30 minutes, after which cells were incubated with primary antibodies for 1 hour. The primary antibodies used were anti-histone MacroH2A1 (Upstate, Waltham, MA, http://www.upstate.com) 1:200; SSEA-4 (MC813-70) (Developmental Studies Hybridoma Bank) 1:20; anti-human
-fetoprotein, clone C3 (Sigma-Aldrich) 1:500; anti
smooth muscle actin (Sigma-Aldrich) 1:400; anti-neuronal class III ß-tubulin (Covance, Princeton, NJ, http://www.covance.com) 1:500; Oct-4 (N-19) (Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com) 1:80, and Tra-1-60(agift from Dr. Peter Andrews) 1:100. The cells were subsequently washed with PBS/Tween (0.2%) and again at 37°C in a humidity chamber, blocked for another 5 minutes in blocking buffer, and incubated for 30 minutes with the following appropriate secondary antibodies at 1:200 dilutions: Alexa Fluor goat anti-mouse 594 IgG; Alexa Fluor goat anti-rabbit 488 IgG; Alexa Fluor rabbit anti-goat IgG (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com); and goat anti-mouse IgM (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com). The cells were then rinsed with PBS/Tween (0.2%), counterstained with 4,6-diamidino-2-phenylindole (DAPI) (1 µg/ml in PBS), and mounted with Vectashield (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). When conducting double immuno-RNA FISH for simultaneous detection of OCT3/4 and XIST RNA, detection of XIST (via the antidigoxigenin-fluorescein Fab) and incubation with the OCT-4 primary antibody were done concurrently. Detection of OCT-4 via the Alexa Fluor rabbit anti-goat 594 secondary antibody was conducted after appropriate rinses.
RNA and DNA Fluorescence In Situ Hybridization
Probes DNA probes used were a 10-kb human genomic XIST gene construct (XIST plasmid G1A) [14] and human Cot-1 DNA (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) [15]. The DNA probes (1 µg per reaction) were nick-translated using digoxigenin-16-dUTP (Roche Diagnostics) or synthesized using DIG-Nick Translation Mix following the manufacturers instructions (Roche Diagnostics).
In Situ Hybridization and Detection Hybridization and detection were performed as previously described [16, 17]. Briefly, cells were hybridized under nondenaturing conditions overnight at 37°C in 50% formamide/x2 standard saline citrate (SSC) using a probe concentration of approximately 5 µg/ml. Mouse Cot-1 DNA was incubated in the hybridization buffer for the hybridization. Posthybridization washes were performed as follows: 50% formamide/x4 SSC for 20 minutes at 37°C, x2 SSC for 20 minutes at 37°C, x1 SSC for 20 minutes at room temperature, and x 4 SSC for 1 minute at room temperature. Signal was subsequently detected after a 1-hour incubation at 37°C with anti-digoxigenin fluorescein (Roche Diagnostics), diluted 1:500 in x 4 SSC/1% bovine serum albumin. Postdetection washes were as follows: x 4 SSC for 10 minutes at room temperature in the dark with agitation (twice), incubation with DAPI (1 µg/ml in PBS) for 5 minutes at room temperature in the dark with agitation, and a rinse with x 1 PBS. Slides were mounted with vectashield (Vector Laboratories). Whole chromosome detection was performed as described [16]. An X-chromosome library hybridization (biotinylated X-chromosome paint from Oncor, Gaithersburg, MD) in conjunction with XIST RNA detection was used. Protocols for DNA and/or RNA FISH have been previously described in detail [17]. Posthybridization washes, detection, and postdetection washes were performed as described above.
Real-Time and Reverse TranscriptionPolymerase Chain Reaction
Total RNA was isolated from 0-day (undifferentiated cells) and 7- and 14-day EBs (differentiated cells) using RNeasy kits (Qiagen, Hilden, Germany, http://www1.qiagen.com). Briefly, cells were lysed in 600 µl/well (six-well plate) RLT buffer containing 10 µl/ml ß-ME and subsequently homogenized by filtration through a QIAshredder. One volume of 70% ethanol was then added to the homogenate, and the sample was applied to an RNeasy mini column. On-column DNase digestion was carried out during the isolation using an RNase-Free DNase Set (Qiagen). After a series of washes, RNA was eluted in RNase-free water. First-strand cDNA synthesis was subsequently carried out using approximately 1 µg of total RNA and Superscript II reverse transcription, following the manufacturers instructions (Invitrogen). Polymerase chain reaction (PCR) mixtures were prepared as described (Invitrogen); final MgCl2, dTNP, and oligonucleotide concentrations used were 1.5 mM, 200 µM, and 200 nM, respectively. Amplification parameters were as follows: 1 cycle at 94°C for 2 minutes; 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute; and 1 cycle at 72°C for 10 minutes. Quantitative real-time PCR was performed using a Stratagene Mx4000 and a Brilliant Cyber Green qPCR Core Reagent Kit (Stratagene, La Jolla, CA, http://www.stratagene.com) following the manufacturers instructions. Briefly, 1.5 mM MgCl2, 800 µM dNTPs, 200 nM oligonucleotide primers, 8% glycerol, 5% dimethylsulfoxide, 20 nM reference dye, and x 0.5 SYBR green dye were used in reaction mixtures. Samples were normalized against GAPDH. Primer sequences were as follows: XIST 5', agctcctcggacagctgtaa; XIST 3', ctccagatagctggcaacc; OCT3/4 5', cttgctgcagaagtgggtggaggaa; OCT3/4 3', ctgcagtgtgggtttcgggca; CRIPTO 5', acagaacctgctgcctgaat; CRIPTO 3', atcacagccgggtagaaatg; REX-1 5', tgaaagcccacatcctaacg; REX-1 3', caagctatcctcctgctttgg; NANOG 5', caaaggcaaacaacccactt; NANOG 3', tctgctggaggctgaggtat; STAT3 5', tttcacttgggtggagaagg; STAT3 3', ggctacctgggtcagcttcag; UTF-1 5', accagctgctgaccttgaac; UTF-1 3', ttgaacgtacccaagaacga; GAPDH 5', gagtcaacggatttggtcgt; GAPDH 3', ttgattttggagggatctcg.
| RESULTS |
|---|
|
|
|---|
To assess the status of XCI in hESCs, we first analyzed XIST expression in undifferentiated male (H1 and BG02) and female (H7, H9, and CyT25) hESC lines, all of which exhibited a normal karyotype as assessed via g-banding (data not shown). In these experiments, H1, H7, and H9 hESCs were maintained in feeder-free conditions, whereas the BG02 and CyT25 lines were maintained on MEFs, as described in Materials and Methods. Each cell line expressed standard markers of undifferentiated hESCs, including SSEA-4, TRA-1-60, CRIPTO, REX-1, OCT3/4, NANOG, STAT3, and UTF-1 (Figs. 1A
, 2Ai, 2Aii
). Quantitative PCR (Fig. 1B
) and flow cytometry analysis (Table 1
) similarly demonstrate expression of characteristic stem cell markers in each of the hESC lines used in this study.
|
|
|
|
|
H7 hESCs, in contrast, never accumulate XIST RNA (Figs. 2Aiv
, 3C
), and as such, we could not use XIST to localize the Xi in these cells. Rather, an X-specific centromere signal (Fig. 3C
) delineates both X chromosomes in the H7 line, allowing us to assess whether these reside within a chromosome-size territory lacking in Cot-1/hnRNA hybridization. In addition, neither of the two X chromosomes in H7 hESCs (Fig. 2Aviii
) exhibits a large clear hole in the hnRNA signal (Fig. 3C
), suggesting a lack of chromosome-wide silencing in this line, even after differentiation. Although technical limitations do not allow us to conclude that all genes on both X chromosomes remain active, results clearly indicate that the H7 hESCs do not show the chromosome-wide transcriptional silencing that is readily apparent in both H9 hESCs or normal control cells. Consistent with this, the DAPI-dense Barr bodies easily identified in the H9 cells are lacking in the H7 cells (Fig. 3C
). Together, these findings demonstrate that H7 hESCs lack clear hallmarks of chromosomal silencing in both the undifferentiated state and in cells 14 days after differentiation.
Differences in XCI Do Not Correlate with Differences in Gross hESC Expression Profiles
Despite differences in XCI between the H7 and H9 and CyT25 hESC lines, expression of several molecular markers that are characteristic of hESCs is appropriate and comparable between cell lines. Specifically, we demonstrate via reverse transcription (RT)-PCR that expression of CRIPTO, REX-1, OCT3/4, NANOG, STAT3, and UTF-1 does not vary between undifferentiated H1, H7, H9, CyT25, and BG02 hESC lines (Fig. 1A
). Quantitative PCR and flow cytometry analyses further demonstrate the expression of OCT3/4, NANOG, and SSEA-4, Tra-1-60, and Tra-1-81, respectively, in each of these lines (Figs. 1B, 1D
; Table 1
), indicating that differences in the pattern of XCI do not correlate with changes in expression of characteristic stem cell markers.
Macrochromatin Body Formation in Differentiated hESCs
We next evaluated whether downstream components of the X-inactivation process are expressed appropriately in various hESC lines. In differentiating mouse ESCs, an accumulation of MacroH2A1 and the formation of macrochromatin bodies (MCBs) occur at 5 days of differentiation, subsequent to the upregulation in Xist expression and coating of the X chromosome at 1 day of differentiation [2628]. Therefore, we assessed MCBs using immunocytochemical localization of MacroH2A1.
In undifferentiated H9 hESC cultures maintained in feeder-free conditions, MCBs are evident in nuclei of differentiating cells surrounding hESC colonies but are absent in the nuclei of cells within hESC colonies that express SSEA-4 (Figs. 4Ai, 4Aii, 4Aiii
). Therefore, the undifferentiated cells in these cultures exhibit XIST coating of the X chromosome but not MCB formation, demonstrating that the H9 hESCs may be in between these two developmental stages. Our observation that the differentiated cells outside of the colonies exhibit MCBs further indicates that the process of XCI is appropriately temporally regulated in cultures of H9 hESCs (see below). In contrast, MCBs are not evident during differentiation in either male H1 (data not shown) or female H7 (Figs. 4Aiv, 4Av, 4Avi
) hESC cultures, confirming a lack of XCI in both cell lines.
|
The percentage of hESCs exhibiting an accumulation of MCBs, in comparison, increases upon differentiation (Fig. 4B
). Moreover, MCBs are detectable in ectoderm, endoderm, and mesoderm derivatives of H9 hESCs; colocalization of MacroH2A1 with ß-tubulin is identifiable in 175-day-differentiated H9 neural progenitors (Fig. 4Avii
) and with smooth muscle actin (Fig. 4Aviii
) and
-fetoprotein (Fig. 4Aix
) after 7 to 14 days of hESC differentiation, providing further evidence that these female hESCs are differentiating appropriately and that X-inactivation progresses throughout in vitro differentiation. In contrast, there is a lack of expression of XIST transcripts (Figs. 1C, 1D
, 2Aiv
, 3C
) and MacroH2A1 accumulation (Figs. 4Ax, 4Axi, 4Axii
) in H7 hESC and EB cultures and in H7-derived neural progenitor cultures (37 days of differentiation; data not shown), providing strong evidence of a lack of classic XCI in this female hESC line.
XCI Occurs Appropriately in an Aneuploid H9 hESC Line
Supernumerary X chromosomes are tolerated in human cells when the extra X chromosomes are inactivated [29]. For instance, XXY or XXXY cells will exhibit XIST coating of one or two X-chromosomes, respectively. We have generated an H9 hESC subclone in which g-banding reveals that 5% of the cells within the culture have an XXX genotype. In these cultures, we observe patches of cells showing 2 XIST signals (Fig. 2Avi
); quantitation reveals that 12% ± 7% (mean ± SEM) of the cells in the culture exhibit two XIST signals. These data indicate that although this H9 subclone has an aneuploid karyotype, mechanisms are maintained for the appropriate dosage compensation of the X chromosome.
XCI Is Stable over Time In Vitro
Numerous hESC lines have now been derived, and despite differences in the derivation process and culture conditions, evaluation of standard markers, telomerase activity, pluripotency, and karyotype indicates that hESC lines are stable over extended periods of culture (see Hoffman and Carpenter for review [30]). In this study, we demonstrate that after more than 80 passages (20 months) in continuous culture, H9 hESCs also retain appropriate expression of XIST transcripts (Fig. 1C
, right panel).
Expression of XIST Is Modulated After Treatment with 5-Aza-2'-Deoxycytidine
5-Aza-2'-deoxycytidine is a well-known demethylating agent that is widely used to demonstrate a correlation between loss of methylation in specific regions of a gene and activation of gene activity. Here, we demonstrate via RT-PCR that after treatment with 5-aza-2'-deoxycytidine, XIST expression is detected in H7 hESCs (Fig. 2B
, Table 3
). In these experiments, H7 hESCs were treated with 1 or 10 µM 5-aza-2'-deoxycytidine for 24 or 48 hours, and expression of XIST and OCT3/4 was assessed 3, 14, and 28 days after treatment. Treatment with 5-aza-2'-deoxycytidine resulted in differentiation as indicated by the decrease in OCT3/4 expression. This was accompanied by the appearance of XIST expression by 3 days after treatment. The expression of XIST persisted for 28 days, the latest time point analyzed. However, the detection of XIST by PCR was not accompanied by Xist coating of an X chromosome, as assessed via FISH analysis (data not shown), indicating a continued lack of XCI in H7 hESCs.
|
| DISCUSSION |
|---|
|
|
|---|
Studies in mouse ESCs demonstrate expression of Xist from both X chromosomes in undifferentiated female ESCs. At the onset of cellular differentiation, however, Xist expression is upregulated on one of the two chromosomes while being silenced on the remaining X chromosome [22, 23]. Although our findings contrast with those in mouse ESCs, it is not particularly surprising given reports that clearly indicate differences between the two [32, 33]. It is also important to recognize that numerous hESC lines have now been derived, and although they express markers typical of ESCs, including SSEA-4, OCT3/4, Tra-160, and NANOG, many of these cell lines differ in the manner in which they were derived and maintained in culture [30]. Such differences may have significant effects on the characteristics of the resultant cell lines and may also contribute to differences in the regulation of developmental events occurring at the time of derivation, such as XCI.
Indeed, variability between hESC lines and even between subclones of various lines may also account for the difference in findings between our study and that of Dhara and Benvenisty [34], who report that both X chromosomes are active in undifferentiated H9 hESC cultures. Our finding that both H9 and CyT25 female cell lines exhibit XCI, despite differences in the manner in which each of these cell lines was maintained, i.e., feeder-free conditions versus culture on mitomycin C MEFs, respectively, suggests that variations in culture conditions are not primarily responsible for the differences in XCI. In addition, both the H7 and H9 lines were derived in the same laboratory, acquired from WiCell, and maintained in feeder-free conditions in our laboratory, yet these lines show different patterns of XCI. Furthermore, although systematic evaluations are still ongoing, we have not observed changes or loss of XCI in high-passage cultures (Fig. 1C
). As such, it is possible that differences in epigenetic status between hESC lines may reflect variability in embryo quality or grade, age of the embryo, or derivation techniques. One cannot discount the possibility, however, that differences between various hESC lines may have occurred simply as a result of clonal issues and low viability of cells thawed from primary vials. Regardless, although each of these hESC lines appears phenotypically stable in its expression of markers, expression of telomerase, ability to differentiate (pluripotency), and maintenance of a stable karyotype, we provide evidence that various hESC lines, and even subclones of the same line, exhibit distinct differences in status of XCI. Indeed, even after more than 1 month of differentiation, we did not observe detectable levels of XIST mRNA, transcriptional silencing, or XIST or MacroH2A1 accumulation in H7 hESCs. Although this line failed to undergo appropriate XCI in this study, H9hESCs exhibit temporal patterns of XCI consistent with in vivo studies [2628]. Furthermore, our findings that XXX H9 hESCs exhibit two inactivated X chromosomes suggest that the mechanism of XCI is appropriate in this line (Fig. 1Avi
). Again, we emphasize the demonstration that, despite significant differences in XCI between the H7 and H9 cell lines, expression of several markers characteristic of hESCs is appropriate between cell lines (Fig. 1A
). Thus, the observed differences in XCI do not seem to be due to differences in gross hESC expression profiles. As such, it will be important to fully characterize the pluripotent state in various human cell types and to further assess whether such observed differences in XCI correlate with differences in the developmental states or competence of various hESC lines. It will also be important to elucidate the molecular mechanisms by which epigenetic states may become altered upon prolonged culture and cellular differentiation. Specifically, assessing whether there is a loss of imprinting or otherwise inappropriate gene expression upon cell differentiation will have critical implications for the derivation of new hESC lines and for their use in cell replacement therapies.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
DISCLOSURES
The authors indicate no potential conflicts of interest.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
W. Liu and X. Sun Skewed X chromosome inactivation in diploid and triploid female human embryonic stem cells Hum. Reprod., May 8, 2009; (2009) dep126v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Nicholas, S. L. Chavez, V. L. Baker, and R. A. Reijo Pera Instructing an Embryonic Stem Cell-Derived Oocyte Fate: Lessons from Endogenous Oogenesis Endocr. Rev., May 1, 2009; 30(3): 264 - 283. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Sun, X. Long, Y. Yin, Y. Jiang, X. Chen, W. Liu, W. Zhang, H. Du, S. Li, Y. Zheng, et al. Similar biological characteristics of human embryonic stem cell lines with normal and abnormal karyotypes Hum. Reprod., October 1, 2008; 23(10): 2185 - 2193. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shen, Y. Matsuno, S. D. Fouse, N. Rao, S. Root, R. Xu, M. Pellegrini, A. D. Riggs, and G. Fan X-inactivation in female human embryonic stem cells is in a nonrandom pattern and prone to epigenetic alterations PNAS, March 25, 2008; 105(12): 4709 - 4714. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Silva, R. K. Rowntree, S. Mekhoubad, and J. T. Lee X-chromosome inactivation and epigenetic fluidity in human embryonic stem cells PNAS, March 25, 2008; 105(12): 4820 - 4825. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Navara, J. D. Mich-Basso, C. J. Redinger, A. Ben-Yehudah, E. Jacoby, E. Kovkarova-Naumovski, M. Sukhwani, K. Orwig, N. Kaminski, C. A. Castro, et al. Pedigreed Primate Embryonic Stem Cells Express Homogeneous Familial Gene Profiles Stem Cells, November 1, 2007; 25(11): 2695 - 2704. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Chow, L. L. Hall, S. E. L. Baldry, N. P. Thorogood, J. B. Lawrence, and C. J. Brown Inducible XIST-dependent X-chromosome inactivation in human somatic cells is reversible PNAS, June 12, 2007; 104(24): 10104 - 10109. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Allegrucci and L.E. Young Differences between human embryonic stem cell lines Hum. Reprod. Update, March 1, 2007; 13(2): 103 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hellman and A. Chess Gene Body-Specific Methylation on the Active X Chromosome Science, February 23, 2007; 315(5815): 1141 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Vickers, S. J. Canning, W. L. Craig, N. M. Masson, and I. J. Wilson X Inactivation Patterns of Closely, but Not Distantly, Related Cells Are Highly Correlated: Little Evidence for Stem Cell Plasticity in Normal Females Stem Cells, November 1, 2006; 24(11): 2398 - 2405. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Rao One Successful Series Begets Another Stem Cells, October 1, 2006; 24(10): 2160 - 2161. [Full Text] [PDF] |
||||
![]() |
M. Bibikova, E. Chudin, B. Wu, L. Zhou, E. W. Garcia, Y. Liu, S. Shin, T. W. Plaia, J. M. Auerbach, D. E. Arking, et al. Human embryonic stem cells have a unique epigenetic signature Genome Res., September 1, 2006; 16(9): 1075 - 1083. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |