First published online August 4, 2005
Stem Cells
Vol. 23 No.
10
November 2005, pp.
1535
-1540
doi:10.1634/stemcells.2005-0054; www.StemCells.com
© 2005 AlphaMed Press
Human ERas Gene Has an Upstream Premature Polyadenylation Signal That Results in a Truncated, Noncoding Transcript
Takashi Kamedaa,c,
James A. Thomsona,b
a The Genome Center of Wisconsin, National Primate Research Center, and the Department of Anatomy, University of Wisconsin-Madison Medical School, Madison, Wisconsin, USA;
b WiCell Research Institute, Madison, Wisconsin, USA;
c Department of Biochemistry, Akita University School of Medicine, Akita, Japan
Key Words. Embryonic stem cell • ERas • Pseudogene • Polyadenylation • Evolution
Correspondence: J.A. Thomson, V.M.D., Ph.D., Diplomate A.C.V.P., The Genetics and Biotechnology Building, 425 Henry Mall, Madison, Wisconsin 53706, USA. Telephone: 608-263-3585; Fax: 608-265-8984; e-mail: thomson{at}primate.wisc.edu
 |
ABSTRACT
|
|---|
The ERas gene is expressed in mouse embryonic stem (ES) cells and promotes their in vitro proliferation and tumorigenicity. We analyzed the expression of the human ERas gene in human ES cells by reverse transcriptionpolymerase chain reaction (RT-PCR) and serial analysis of gene expression but could not detect a full-length coding transcript. Sequence analysis predicted a premature polyadenylation signal for the human ERas transcript, which we confirmed by 3' RACE analysis. By RT-PCR, we identified a truncated noncoding transcript in human ES cells that is downregulated during differentiation, suggesting conserved tissue specificity of the promoter region. Previous reports and expressed sequence tag databases indicate that orthologues of this gene are expressed in other mammals, including the mouse, dog, and cow, which suggests that it became a silenced pseudogene relatively recently in mammalian evolution. In addition to the premature polyadenylation site, both the human and chimpanzee ERas genes include typical Alu-S retrotransposon insertions that could also influence expression at this locus. The lack of ERas expression in human ES cells suggests that they could have significantly different tumorigenic properties than mouse ES cells.
 |
INTRODUCTION
|
|---|
Embryonic stem (ES) cells are pluripotent cells that maintain the ability to differentiate to derivatives of all three embryonic germ layers, even after prolonged culture in the undifferentiated state [13]. Most gene products known to be involved in maintaining the ES cell state, such as Oct4 [4, 5], fibroblast growth factor 4 [6, 7], FoxD3 [8, 9], Sox2 [10], and Nanog [11, 12], have been functionally characterized only in mouse ES cells. However, there are significant differences between mouse and human ES cells in cell cycle time, growth factor requirements, and cell-surface marker expression that presumably reflect species-specific differences in early development [13, 14]. In most cases it is not yet clear what molecular mechanisms are responsible for these differences.
The mouse ERas gene is a recently identified gene that supports tumorigenic growth of mouse ES cells by producing a constitutively active Ras protein [15]. Disruption of the ERas gene in mouse ES cells by homologous recombination results in a significantly reduced proliferation rate and a reduced tumorigenic potential without loss of pluripotency [15]. The human ERas gene was initially reported as a processed pseudogene (HRasp, Ha-Ras2) [16, 17], with several base substitutions in coding regions, but was more recently described as potentially encoding a functional human ERas protein [15]. However, the expression of the ERas gene remained unclear.
Recent transcriptome analysis has failed to detect ERas gene expression in human ES cells [18, 19]. Here we examined the expression of human ERas gene in human ES cells in detail and identified a truncated ERas gene product resulting from a premature polyadenylation signal upstream of its coding sequence. These differences suggest that the tumorigenic potential of human ES cells could differ fundamentally from mouse ES cells and that predicting the behavior of transplanted human ES cells from the behavior of transplanted mouse ES cells is probably inappropriate.
 |
MATERIALS AND METHODS
|
|---|
Cell Culture
Human ES cells (H1 and H9) were cultured as previously described either on mouse embryonic fibroblasts (MEFs) or in medium conditioned by MEFs [3, 20]. HEK 293 cells were cultured in Dulbeccos modified Eagles medium with 10% fetal calf serum. To induce human ES cell differentiation, cells in feeder-free conditions were treated for 10 days with 10 µM retinoic acid in unconditioned media or with 0.1 µg/ml BMP4 (Upstate, Waltham, MA, http://www.upstate.com) in conditioned media [21].
Reverse TranscriptionPolymerase Chain Reaction
mRNA was prepared with Trizol (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) and a Dyna-bead kit (Dynal Bio-tech, Oslo, Norway, http://www.dynalbiotech.com) according to the manufacturers protocols. Reverse transcriptionpolymerase chain reaction (RT-PCR) was performed with Titan one-tube RT-PCR kit (Roche, Indianapolis, http://www.diagnostics.roche.com) with or without templates (poly A RNA from human ES cells or human genomic DNA). For one RT-PCR reaction, each poly A RNA corresponding to approximately 0.11 µg of total RNA or 1 µg of genomic DNA was used as the template.
The primers used for ß-actin were CCAAGGCCAACCGCGAGAAGATGAC and AGGGTACATGGTGGTGCCGCCAGAC, which give rise to an amplified fragment of 587 bp. The primers used for oct-4 were AGAAGAGGATCACCCTGGGAT and AGAACCACACTCGGACCACAT, which give rise to an amplified fragment of 330 bp. The primers used for ERas coding sequence were ATGGAGCTGCCAACAAAGCCTGGCA and TTCAGGCCACAGAGCAGCCACAGT, which give rise to an amplified fragment of 702 bp. The primers used for ERas upstream region were TAACTAACACTAATTGACCAC and TTTATTGGGAACCTACTGTGT, which give rise to an amplified fragment of 703 bp. The RT-PCR reaction conditions were as follows: 1 cycle of 30 minutes of RT at 55°C and 3 minutes of denaturation at 95°C, 21 to 38 cycles of 1 minute of denaturation at 95°C, 1 minute of annealing at 55°C (for oct-4 and ERas upstream) or 72°C (for ß-actin and ERas), and 2 minutes of extension at 72°C. In some cases, the initial RT was omitted to check the DNA contamination. The PCR products were subjected to 1.0% or 1.8% agarose gel electrophoresis and visualized by staining with ethidium bromide. The identification of PCR products was confirmed by DNA sequencing.
Sequence and Library Analysis
We used the SHES2 library (http://www.transcriptomes.org/) for the serial analysis of gene expression (SAGE) [22] to analyze the gene expression profile of human ES cells. Genomic sequences and expressed sequence tag (EST) clone information were obtained from the GenBank database (http://www.ncbi.nlm.nih.gov/) in NCBI. The chimpanzee genomic sequence was obtained from the Genome Sequencing Center of Washington University in St. Louis (http://www.genome.wustl.edu/). Sequence analysis was performed with the Blast search tool in NCBI and Genetyx-Mac software (Genetyx Corporation, Tokyo). Interspersed repeat elements were analyzed using the RepeatMasker software (Institute for Systems Biology, Seattle, http://www.repeatmasker.org/).
Polyadenylation Signal Analysis by 3' RACE
Polyadenylation signal candidates (A-1, A-2, and A-3) in the ERas upstream region were synthesized to test for activity. The nucleotides to produce A-1 were GGAAGATTAAATTATAATTTAAAAGCCTGGCATGAACTGAGCACCTTCTGCATGCTTATCACCCGCTACTGACATATAGTTCACTTTTTTTTTTTTTTTTTTTandGCAAAAAAAAAAAAAAAAAAAAGTGAACTATATGTCAGTAGCGGGTGATAAGCATGCAGAAGGTGCTCAGTTCATGCCAGGCTTTTAAATTATAATTTAATCT. The nucleotides to produce A-2 were GGAACAGTAGGTTCCCAATAAATGTATGTTGAATAATTAATAAAGACTACATTCTAATGATAATGGCTAACAGACCACGTGATTTACATATTTATTTGGTTTATTATATTAT and GCAATAATATAATAAACCAAATAAATATGTAAATCACGTGGTCTGTTAGCCATTATCATTAGAATGTAGTCTTTATTAATTATTCAACATACATTTATTGGGAACCTACTGT. Th e nucleotides to produce A-3 were GGACAATAAATGTTGAAATAATGACACCCCACTGTCTCCTTGCCCTCAAATGGTCTCCCCTAACGTATCCCCTGTTGTCTTGCTTCTTCTCTTC and GCAGAAGAGAAGAAGCAAGACAACAGGGGATACGTTAGGGGAGACCATTTGAGGGCAAGGAGACAGTGGGGTGTCATTATTTCAACATTTATTG. The annealed nucleotides were subcloned into between two Sap I sites of pNeoEGFP plasmid (Clontech, Palo Alto, CA, http://www.clontech.com) to produce pNeoA-1EGFP, pNeoA-2EGFP, and pNeoA-3EGFP, respectively. The plasmids were transfected into HEK 293 cells using the FuGENE 6 reagent (Roche), and the mRNAs were recovered 2 days later. 3' RACE analysis was performed with RACE Core Set, 3'-Full kit (TaKaRa Mirus Bio, Madison, WI, http://www.takaramirusbio.com) with a forward primer of TTAATACGACTCACTATAGG. The sequences of 3' RACE products, around the polyadenylation site, were analyzed using a primer of GATGGAAGCCGGTCTTGTCGA.
 |
RESULTS
|
|---|
Full-Length ERas mRNA Expression Is Not Detectable in Human ES Cells
We examined ERas expression by RT-PCR by using primers for the coding region, using poly A RNA from human ES cells as the template. Although the expression of ß-actin or oct-4 gene was easily detectable by RT-PCR, we never detected the expression of ERas gene in several RT-PCR conditions (Fig. 1
). However, we easily amplified the ERas coding sequence by the RT-PCR reaction, lacking an intron, when we used genomic DNA as the template (Fig. 1
). This result is consistent with the previous reports that the ERas gene exists in the human genome [1517] but is not expressed in human ES cells [18, 19], suggesting that the expression of this gene is different between human and mouse.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 1. Analysis of the ERas gene expression in human embryonic stem (ES) cells. The expressions of ß-actin and oct-4 genes are detectable by reverse transcriptionpolymerase chain reaction using mRNA from H1 and H9 human ES cells. ERas gene expression is not detected, whereas the target sequence is easily amplified when the genomic DNA (H1g and H9g) is used as the reaction template. The negative control () indicates no template in the reaction.
|
|
Analysis of the Transcriptional Activity on Human ERas Locus by SAGE and EST Clone Screening
To examine the transcriptional activity of ERas locus in human ES cells, we also checked a deep SAGE library of human ES cells (line H9) for 22 potential sense tags around the ERas locus (Fig. 2
; Table 1
). SAGE tags for ES cell markers oct-4 and nanog and SAGE tags for X-linked genes hprt1 (hypoxanthine phosphoribosyltransferase 1) and pgk1 (phosphoglycerate kinase 1) were present, but no full-length (17-base) SAGE tags representing the ERas gene were present in the library. When we reduced the tag length to 13 bases, to follow the incompletely cloned minor tags, we identified a tag (Fig. 2
, tag h) located approximately 0.7 kbp upstream of the ERas coding sequence. We detected no tags in the antisense orientation around the ERas locus. These data suggest that this locus is expressed weakly, if at all, in human ES cells.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 2. Genomic structures of the ERas locuses in the X chromosome of human, mouse, and dog. The ERas genes are located between the HDAC 6 (histone deacetylase 6) and PCSK1N (proprotein convertase subtilisin/kexin type 1 inhibitor) genes in these species. The structure of the chimpanzee and rat ERas locus is highly conserved to the human and mouse locus, respectively. The locations of potential serial analysis of gene expression (SAGE) tags are indicated in the box, used for the human ERas analysis. The corresponding sequence to the BX100754
[GenBank]
expressed sequence tag clone is indicated by an arrow. A1, A2, and A3 indicate the locations of the predicted polyadenylation signals. The locations of reverse transcriptionpolymerase chain reaction primers are indicated by the small arrows, used to check the expressions of the coding and the upstream region of the ERas gene. The inserted Alu elements in human ERas locus and the exons (E1 and E2) of mouse ERas gene are also indicated.
|
|
Identification of a Premature Polyadenylation Signal in the Human ERas Locus
In examining EST databases for evidence of human ERas expression, we identified a clone (GenBank accession no. BX100754
[GenBank]
) of a polyadenylated, 280-bp fragment of the noncoding human ERas upstream region obtained from a human colon cancer sample (Fig. 2
). Interestingly, the incompletely cloned SAGE tag (Fig. 2
, tag h) of the ERas locus also corresponds to this region (Fig. 2
; Table 1
). These data suggested the existence of a premature upstream polyadenylation signal in the human ERas locus.
We searched for possible polyadenylation signals in the ERas upstream region and found three candidates (A-1, A-2, and A-3) having typical AATAAA or ATTAAA motifs with a following GU/U-rich element (Figs. 2
, 3A
). The A-1 element contains the SAGE tag f. The A-2 element includes the polyadenylation site of the BX100754
[GenBank]
EST clone and the SAGE tag h. The A-3 element maps between the SAGE tags k and l. Each element was cloned into a pNeoEGFP plasmid between the strong cytomegalovirus promoter and the typical SV40 polyadenylation signal (Fig. 3B
) and transfected into HEK293 cells. The resulting transcripts were analyzed by 3' RACE. As shown in Figure 3C
, the A-2 element functioned effectively as a polyadenylation signal. However, the A-1 element demonstrated no activity, and the A-3 element demonstrated only weak activity for inducing premature polyadenylation. By sequencing, we checked the polyadenylation site associated with the A-2 element and found that it corresponded to the polyadenylation site of the BX100754
[GenBank]
EST clone (Fig. 3A
).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 3. Analysis of the premature polyadenylation signal on the upstream of human ERas. (A): The sequences of the polyadenylation signal candidates. The polyadenylation signal (poly A signal) and the following GU/U-rich element are indicated by the solid or broken lines, respectively. The predicted serial analysis of gene expression (SAGE) tags (tags f and h) are also indicated by double lines. The polyadenylated sites in the A-2 and A-3 elements are boxed. The black arrowheads indicate the major polyadenylation sites in each element, and the white arrowhead indicates the polyadenylated site of the BX100754
[GenBank]
expressed sequence tag clone. (B): Diagram of the constructs used for the analysis of the polyadenylation inducing ability of A-1, A-2, and A-3 elements. These elements were inserted into the pNeoEGFP plasmid between the cytomegalovirus (CMV) promoter and the SV40 polyadenylation signal (SV40 poly A) to produce the pNeoA-1EGFP, pNeoA-2EGFP, and pNeoA-3EGFP. The IVS represents an artificial intron. The location of the forward primer for the 3' RACE analysis is indicated by a small arrow. (C): The result of the 3' RACE analysis on the HEK 293 cells. The cells were transfected with pUC119 (control), pNeoEGFP, pNeoA-1EGFP, pNeoA-2EGFP, and pNeoA-3EGFP, respectively, and the expressed mRNA was analyzed 2 days after the transfection. The result without template mRNA, lane (), is also displayed. The upper bands (~1.6 kbp) and the lower bands (~0.6 kbp) correspond to the fully transcribed and the premature polyadenylated products, respectively.
|
|
The Human ERas Promoter Is Weakly Active in Human ES Cells and Is Downregulated During Differentiation
The premature polyadenylation signal upstream of the human ERas coding region suggested to us that the ERas promoter could still be active in human ES cells but that a truncated transcript would be produced that would have been missed in our previous analysis. We thus used RT-PCR analysis to examine the region upstream of the premature polyadenylation signal (Fig. 2
) and indeed detected expression in human ES cells (Fig. 4A
). After the induction of differentiation by retinoic acid or BMP4 treatment, the ERas upstream region expression was downregulated (Fig. 4B
), suggesting that this promoter still may maintain some tissue specificity comparable with the mouse ERas gene [15].

View larger version (36K):
[in this window]
[in a new window]
|
Figure 4. (A): Reverse transcription(RT) polymerase chain reaction analysis on the premature product of human ERas gene. The poly A RNA from the H1 and H9 human embryonic stem cells was analyzed with (RT +) or without (RT ) the RT procedure. (B): The effect of cell differentiation on the expression of the premature mRNA of human ERas gene. To induce differentiation, the H9 cells were treated with 10 µM of retinoic acid (RA) or 0.1 µg/ml of BMP-4 for 10 days (lane +). The control cells (lane ) were cultured under normal conditions. Oct-4 and ß-actin expression was also analyzed.
|
|
Comparative Analysis on ERas Gene
Our results indicate that the full-length ERas gene is not transcribed in human ES cells, but previous results have shown that it is both transcribed and physiologically significant in mouse ES cells [15]. We were therefore interested in whether this gene is transcribed in other mammalian species. Using the Blast homology search program, we searched the EST clones for ERas orthologues in other species and found clones from Canis familiaris (dog) from the testis (GenBank: CO609560
[GenBank]
, CO598019
[GenBank]
, and CO600209
[GenBank]
) and Bos taurus (cattle) from the pooled library of multiple tissues, including liver, lung, hypothalamus, pituitary, and placenta (GenBank: CB454861
[GenBank]
and CB456439
[GenBank]
) and from the adult brain (GenBank: CO891744
[GenBank]
) that correspond to the previously described v-Ha-ras 3 gene [23]. We also found the genomic sequences of each ERas locus of human (GenBank: AF196971
[GenBank]
), mouse (GenBank: NT_039700
[GenBank]
), rat (GenBank: NW_048035), dog (GenBank: AAEX01047891), and chimpanzee (chimpanzee genomic project Contig files of 1804.5 and 1804.6). Each of the ERas genes is located on the X chromosome. The neighboring 5' and 3' genes, histone deacetylase 6 (HDAC 6) and proprotein convertase subtilisin/kexin type 1 inhibitor (PCSK1N), respectively, are also conserved among these species (Fig. 2
). The ERas amino acid sequences of each mammal, predicted from the genomic and cDNA sequences, are well conserved among these species (the arrangement is indicated in Fig. 5
).

View larger version (77K):
[in this window]
[in a new window]
|
Figure 5. The alignment on the predicted ERas amino acid sequences of five mammals (mus, mouse; rat, rat; hom, human; can, dog; bos, cattle). The human and chimpanzee ERas sequences are identical. The cattle sequence is incomplete at the N-terminal end (indicated by X). The amino acids conserved among the species are marked by red characters.
|
|
In both the human and chimpanzee ERas genes, there are two typical Alu-S retrotransposon insertions in the upstream region, near the possible promoter region and the conserved premature polyadenylation signal of A-2 (Fig. 2
). The Alu-S subfamily is thought to have been amplified in ancestral primate genomes from approximately 4830 million years ago [2426]. These elements can affect adjacent gene expressions [24, 27], and their presence could diminish ERas promoter activity. The Alu-S insertions, combined with the acquired premature polyadenylation before the divergence from chimpanzee, would ensure the complete silencing on the human ERas gene.
 |
DISCUSSION
|
|---|
In this report, we confirmed the lack of full-length ERas gene expression in human ES cells but identified a truncated transcript of the 5' noncoding region that is terminated by a premature polyadenylation signal. The expression of the ERas gene in species as divergent as mice, dogs, and cows suggests that its inactivation in higher primates is a relatively recent event in mammalian evolution. Disruption of the mouse ERas gene by homologous recombination resulted in impaired growth and reduced tumorigenicity of mouse ES cells but did not impair normal development [15]. It is tempting to speculate that some of the differences in proliferation rate or other properties of mouse and human ES cells are related to the differences of expression of this constitutively active ERas gene, although mouse and human ES cells differ significantly in other pathways also [19]. However, transient transfection of human ES cells with an expression vector placing ERas under the control of the human elongation factor 1 promoter induced significant cell death, and to date we have been unable to establish stable ERas expressing human ES cells. An antioncogenic role of activated Ras by the induction of apoptosis has been reported [2830], so this is not a surprising result, but it does imply broader differences between mouse and human ES cells in cell-cycle or apoptotic control. Thus, although the physiological significance of the species difference in ERas expression is not yet clear, it does suggest that the behavior of transplanted mouse ES cells will not accurately predict the behavior of transplanted human ES cells and that the use of primate models will be more appropriate to demonstrate the safety of human ES cellbased therapies.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. J. Yu, Dr. Y. Kim, and Ms. D. Faupel in our laboratory for technical assistance and manuscript preparation. We appreciate and thank Dr. M. Marra and Dr. C. Eaves in the Genomic Science Center, British Columbia Cancer Agency for the analysis on the human ES cell SAGE database SHES2. This research was supported by funds from the University of Wisconsin Foundation.
DISCLOSURES
J.A.T. owns stock in and within the past 2 years served as an officer or member of the Board of Cellular Dynamics International.
 |
REFERENCES
|
|---|
- Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:154156.[CrossRef][Medline]
- Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 1981;78:76347638.[Abstract/Free Full Text]
- Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:11451147.[Abstract/Free Full Text]
- Scholer HR, Balling R, Hatzopoulos AK et al. Octamer binding proteins confer transcriptional activity in early mouse embryogenesis. EMBO J 1989;8:25512557.[Medline]
- Nichols J, Zevnik B, Anastassiadis K et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998;95:379391.[CrossRef][Medline]
- Yuan H, Corbi N, Basilico C et al. Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes Dev 1995;9:26352645.[Abstract/Free Full Text]
- Wilder PJ, Kelly D, Brigman K et al. Inactivation of the FGF-4 gene in embryonic stem cells alters the growth and/or the survival of their early differentiated progeny. Dev Biol 1997;192:614629.[CrossRef][Medline]
- Sutton J, Costa R, Klug M et al. Genesis, a winged helix transcriptional repressor with expression restricted to embryonic stem cells. J Biol Chem 1996;271:2312623133.[Abstract/Free Full Text]
- Hanna LA, Foreman RK, Tarasenko IA et al. Requirement for Foxd3 in maintaining pluripotent cells of the early mouse embryo. Genes Dev 2002;16:26502661.[Abstract/Free Full Text]
- Avilion AA, Nicolis SK, Pevny LH et al. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 2003;17:126140.[Abstract/Free Full Text]
- Mitsui K, Tokuzawa Y, Itoh H et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003;113:631642.[CrossRef][Medline]
- Chambers I, Colby D, Robertson M et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643655.[CrossRef][Medline]
- Thomson JA, Odorico JS. Human embryonic stem cell and embryonic germ cell lines. Trends Biotechnol 2000;18:5357.[CrossRef][Medline]
- Pera MF, Trounson AO. Human embryonic stem cells: prospects for development. Development 2004;131:55155525.[Abstract/Free Full Text]
- Takahashi K, Mitsui K, Yamanaka S. Role of ERas in promoting tumour-like properties in mouse embryonic stem cells. Nature 2003;423:541545.[CrossRef][Medline]
- Chang EH, Gonda MA, Ellis RW et al. Human genome contains four genes homologous to transforming genes of Harvey and Kirsten murine sarcoma viruses. Proc Natl Acad Sci U S A 1982;79:48484852.[Abstract/Free Full Text]
- Miyoshi J, Kagimoto M, Soeda E et al. The human c-Ha-ras2 is a processed pseudogene inactivated by numerous base substitutions. Nucleic Acids Res 1984;12:18211828.[Abstract/Free Full Text]
- Bhattacharya B, Miura T, Brandenberger R et al. Gene expression in human embryonic stem cell lines: unique molecular signature. Blood 2004;103:29562964.[Abstract/Free Full Text]
- Rao M. Conserved and divergent paths that regulate self-renewal in mouse and human embryonic stem cells. Dev Biol 2004;275:269286.[CrossRef][Medline]
- Amit M, Carpenter MK, Inokuma MS et al. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev Biol 2000;227:271278.[CrossRef][Medline]
- Xu RH, Chen X, Li DS et al. BMP4 initiates human embryonic stem cell differentiation to trophoblast. Nat Biotechnol 2002;20:12611264.[CrossRef][Medline]
- Velculescu VE, Zhang L, Vogelstein B et al. Serial analysis of gene expression. Science 1995;270:484487.[Abstract/Free Full Text]
- McCaffery RE, Coggins LW, Doherty I et al. Multiple Harvey-ras genes in the bovine genome. Oncogene 1989;4:14411448.[Medline]
- Mighell AJ, Markham AF, Robinson PA. Alu sequences. FEBS Lett 1997;417:15.[CrossRef][Medline]
- Kapitonov V, Jurka J. The age of Alu subfamilies. J Mol Evol 1996;42:5965.[CrossRef][Medline]
- Arcot SS, Wang Z, Weber JL et al. Alu repeats: a source for the genesis of primate microsatellites. Genomics 1995;29:136144.[CrossRef][Medline]
- Kazazian HH Jr. Mobile elements: drivers of genome evolution. Science 2004;303:16261632.[Abstract/Free Full Text]
- Khokhlatchev A, Rabizadeh S, Xavier R et al. Identification of a novel Ras-regulated proapoptotic pathway. Curr Biol 2002;12:253265.[CrossRef][Medline]
- Cox AD, Der CJ. The dark side of Ras: regulation of apoptosis. Oncogene 2003;22:89999006.[CrossRef][Medline]
- Spandidos DA, Sourvinos G, Tsatsanis C et al. Normal ras genes: their onco-suppressor and pro-apoptotic functions. Int J Oncol 2002;21:237241.[Medline]
Received February 7, 2005;
accepted for publication June 6, 2005.
This article has been cited by other articles:

|
 |

|
 |
 
Y. Babaie, R. Herwig, B. Greber, T. C. Brink, W. Wruck, D. Groth, H. Lehrach, T. Burdon, and J. Adjaye
Analysis of Oct4-Dependent Transcriptional Networks Regulating Self-Renewal and Pluripotency in Human Embryonic Stem Cells
Stem Cells,
February 1, 2007;
25(2):
500 - 510.
[Abstract]
[Full Text]
[PDF]
|
 |
|
