HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 2005-0182v1 23/10/1634    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sekkaï, D. Articles by Bennaceur-Griscelli, A. Search for Related Content PubMed PubMed Citation Articles by Sekkaï, D. Articles by Bennaceur-Griscelli, A.

Microarray Analysis of LIF/Stat3 Transcriptional Targets in Embryonic Stem Cells

^a INSERM U362, Institut Gustave-Roussy, Villejuif, France;
^b LGRH-CEA, Evry, France;
^c Ludwig Institute for Cancer Research and Christian de Duve Institute of Cellular Pathology University of Louvain, Brussels, Belgium

Key Words. Stat3 • Self-renewal • Microarray • Leukemia inhibitor factor • grg5

Correspondence: Dalila Sekkaï, Ph.D., INSERM U362, Institut Gustave-Roussy. 39, rue Camille Desmoulins, 94805 Villejuif Cedex, France. Telephone: 33-0-142-114-233; Fax: 33-0-142-115-240; e-mail: dsekkai{at}igr.fr; and Annelise Bennaceur-Griscelli, M.D., Ph.D., INSERM U362, Institut Gustave-Roussy. 39, rue Camille Desmoulins, 94805 Villejuif Cedex, France. Telephone: 33-0-142-114-233; Fax: 33-0-142-115-240; e-mail: abenna{at}igr.fr

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mouse embryonic stem (ES) cells can be propagated in vitro while retaining their properties of pluripotency and self-renewal under the continuous presence of leukemia inhibitor factor (LIF). An essential role has been attributed to subsequent activation of the Stat3 transcription factor in mediating LIF self-renewal response. To date, however, downstream target genes of Stat3 in ES cells are still unknown. To isolate these genes, we performed a microarray-based kinetic comparison of LIF-stimulated (undifferentiated) ES cells versus ES cells induced to differentiate by shutting down Stat3 activity through either LIF deprivation or, more specifically, expression of a Stat3 dominant-negative mutant. In each case, we chose the earliest time at which ES cells lose their self-renewal properties, as illustrated by a decrease in the number of embryoid bodies and blast cell colony formation as well as germ layer marker expression. Comparison of the two independent approaches revealed similarly regulated genes that are likely to be involved in the Stat3 effects on ES cell self-renewal. For instance, upregulation of growth factors such as the transforming growth factor-ß relative Lefty1 or transcriptional regulators such as Id1 and Id2 and down-regulation of the groucho-like protein Aes1 (grg5) were found. Promoter analysis of the aes1 gene revealed three functional Stat3 consensus sites, as shown by luciferase assays. Furthermore, chromatin immunoprecipitation experiment demonstrated that Stat3 is recruited to the promoter of aes1 in ES cells. These data demonstrated that the aes1 gene is a direct transcriptional target of Stat3 in ES cells.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mouse embryonic stem (ES) cells are permanent pluripotent cells derived from the inner cell mass of the blastocyst. These cells undergo self-renewing divisions while retaining the capacity to generate all types of fetal and adult cell lineages and to participate fully in embryonic development when reintroduced into a blastocyst [1]. Mouse ES cells can be propagated in culture in the presence of leukemia inhibitor factor (LIF), which activates the gp130 signaling pathways, resulting in Jak-mediated Stat3 phosphorylation. Several studies have shown that Stat3 is one major player in this process [2–5]. Other transcriptional regulators, such as Oct3/4 [6], Nanog [7, 8], or Id1-3 [9], also participate in the maintenance of ES cell self-renewal, but Stat3 activation remains prominent because in the absence of LIF stimulation, endogenous expression of these factors is insufficient to sustain ES cell self-renewal. However, very little is known about the downstream target genes of activated Stat3 in ES cells. As their characterization could be of help to understand the molecular mechanisms underlying self-renewal, we used a microarray approach in this study to analyze gene profiling in ES cells with several repetitions of the experiments, allowing a robust statistical analysis of the results. To perform this approach, ES cells were first induced to differentiate upon LIF withdrawal, which led to the disruption of the signaling pathways lying downstream of gp130. To specifically target the stage when ES cells start losing their self-renewal potential without extensive engagement in differentiation, we characterized the earliest stage of appearance of mRNA-encoding germ layer markers and diminution of the ability of ES cells to generate in vitro embryoid bodies and blast cell colonies. In a more specific second strategy, we expressed a dominant-negative Stat3 mutant and identified several potential downstream Stat3 target genes. Comparison of the results obtained in the two independent microarray experiments revealed an overlap of several transcripts that are similarly regulated and are thus likely to participate in the Stat3-mediated self-renewal response.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell Culture
Gs2, IOUD2, and E14 cells were cultured in the absence of feeder in Glasgow’s minimum essential medium (Life Technologies, Rockville, MD, http://www.lifetech.com) supplemented with 15% fetal calf serum (FCS) (Hyclone, Logan, UT, http://www.hyclone.com), 450 µM monothioglycerol(MTG)(Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), and 1,000 U/ml LIF (Esgro, Temecula, CA, http://www.esgro-lif.com). For the Gs2 cells, the medium was supplemented with 1 µg/ml tetracycline (Sigma-Aldrich). Upon tetracycline removal, this cell line expresses a dominant-negative form of Stat3 (Stat3F), whose expression induces a 50% reduction of endogenous Stat3 activation [4, 6].

ES Cell Differentiation
Gs2 ES cells were first maintained for 24 or 48 hours in the absence of LIF or tetracycline. Then they were induced to differentiate in nonadherent conditions as described below in the absence of LIF but in the presence of 1 µg/ml tetracycline to avoid expression of Stat3F. The number of day-3 embryoid bodies (EB3) was determined by plating for 3 days 500 ES cells in a 35-mm Petri dish in 1% methylcellulose (Fluka Methocell MC, Sigma-Alrich) in Iscove’s modified Dulbecco’s medium (IMDM) supplemented with 10% FCS, 300 µM MTG, and 80 µg/ml insulin (Sigma-Aldrich). Blast cell colonies were formed by the two-step method described by Kennedy et al. [10]. EB3 was first formed by plating 4.5 x 10⁴ ES cells in a 100-mm Petri dish in 10 ml IMDM supplemented with 15% FCS, 450 µM MTG, 200 µg/ml iron-saturated transferrin (Sigma-Aldrich), and 50 µg/ml L-ascorbic acid (Sigma,-Aldrich) for 3 days. Cells were then dissociated by trypsinization, and for each condition, the same number (3 x 10⁴) of living cells was plated in 1% methylcellulose (Methocult, Fluka, Buchs, Switzerland, http://www.buchs-sg.ch) in 35-mm Petri dishes in 5 ml IMDM supplemented with 10% FCS, 450 µM MTG, 25 µg/ml L-ascorbic acid (Sigma-Aldrich), 200 µ/ml iron-saturated transferrin (Sigma-Aldrich), and 5 ng/ml vascular endothelial growth factor. After 4 days, blast colonies (BC4) were counted.

Sample Preparation
A total of 4 x 10⁵ cells were seeded in a 100-mm cell-culture plate under standard conditions (+LIF, Tet ON) in the absence of either tetracycline (Tet OFF) or LIF (–LIF) for 16, 24, and 48 hours. Total RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) and purified using Qiagen RNeasy kit (Qia-gen, Hilden, Germany, http://www1.qiagen.com). Concentration and quality were determined using an Agilent labchip Bioanalyzer (Agilent Technologies, Palo Alto, CA, http://www.agilent.com).

Microarray
We used an in-house c-DNA chip from the CEA (Evry, France, http://www.cea.fr). Approximately 9,000 clones were amplified and spotted onto GAPS II-coated slides (Corning, Corning, NY, http://www.corning.com). A complete description of the chips is available on the National Center for Biotechnology Information database (GEO, http://www.ncbi.nih.gov/geo/; platform #GPL1091). Total RNA 20 µg was reverse-transcribed at 42°C for 1 hour 30 minutes in a final volume of 30 µl with 400 U of Superscript II RNAseH^– reverse transcription (Invitrogen), oligodT (2 µg), dNTP (0.5 mM), and a 4:1 ratio of aminoallyl-dUTP (Sigma-Aldrich)/dTTP. RNA was then degraded with 2 U RNAseH (Invitrogen) at 37°C for 15 minutes. The reaction mixture was then filtered and concentrated using a Microcon 30 (Millipore, Billerica, MA, http://www.millipore.com), and indirect incorporation of Cy3 and Cy5 fluorescent labels (Amersham Biosciences, Piscataway, NJ, http://www.amersham.com) was performed in 10 µl of 50 mM NaCOOH for 1 hour at room temperature. Unincorporated dyes were quenched with 4.5 µl of 4 M hydroxylamine (Sigma-Aldrich) for 15 minutes. Labeled cDNA were pooled and purified on a nucleospin column (Macherey Nagel, NY, http://www.macherey-nagel.com), dried under vacuum, and resuspended in 30 µl of hybridization buffer (x 6 SSPE, x 2.5 Denhardt, x 0.5 SDS, 50% formamide) supplemented with 10 µg mouse cot1 DNA, 10 µg polydA, and 10 µg yeast tRNA (Invitrogen). Probes were heat-denatured and hybridized overnight at 42°C on the chip previously saturated by incubation in 20 x standard saline citrate (SSC), 10% SDS, 0.01% bovine serum albumin for 1 hour at 50°C. The chips were then washed twice in 500 ml of x 0.1 SSC and 0.1% SDS and once in 500 ml of x 0.1 SSC for 15 minutes at room temperature.

Microarray Analysis
All of the conditions were compared with Gs2 cells continuously maintained in the presence of LIF and tetracycline. Experiments were performed in both labeling orientations, allowing compensation for different dye incorporation efficiencies. For each time point, eight and six slides were performed independently for the Tet OFF and –LIF experiments, respectively. Slides were scanned in both Cy3 and Cy5 channels with AxonGenePix scanner. Grid alignments and spot detections were performed with the GenePix-Pro software (Axon Instruments/Molecular Devices Corp., Union City, CA, http://www.moleculardevices.com). Data are available at the NCBI gene expression and hybridization array data repository (GEO, http://www.ncbi.nlm.nih.gov/geo/; accession no. GSE1150 [NCBI GEO] , –LIF; and accession no. GSE 1151, Tet OFF). The data were thereafter processed with the GeneSpring software (Silicon Genetics, Palo Alto, CA, http://www.agilent.com/chem/genespring). After normalization by the lowess method, the data were filtered for nonreliable signals: using the GeneSpring software, the intensity in the control channel (+LIF/ON) for each spot was plotted against the standard deviation of normalized values for the totality of the spots to determine a threshold value for the mean of intensities in the control channel. The genes for which this value was under the threshold displayed high standard deviation and were thus excluded from the analysis. The mean of ratio (–LIF or Tet OFF vs. +LIF/ON) was calculated for each gene and asked for statistical variation from 1 by a Student’s t-test at a 1% significant level (p < .01). Hierarchical clustering was also done with the GeneSpring software using the Pearson’s correlation.

Real-Time Reverse Transcription–Polymerase Chain Reaction
Quantitative reverse transcription–polymerase chain reaction (RT-PCR) was performed on total RNA purified with the High Pure RNA extraction kit (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com). cDNA was synthesized from 2 µg of RNA with Superscript II reverse transcription (Invitrogen) using random hexamer primers. Quantitative PCR was performed on an ABI Prism 5700 sequence detection system (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com) using SYBR green chemistry. Primers were designed with the Primer Express software (Applied Biosystems) and are available on request.

Chromatin Immunoprecipitation
Chromatin immunoprecipitation (ChIP) of STAT3 binding regions was performed on 2 x 10⁷ cells, as described before [11], with protein A sepharose beads instead of Staph A cells. Ten microliters of the chromatin supernatant was saved before the IP as INPUT. IP was performed with anti-Stat3 antibody (2 µl; Cell Signaling Technology, Beverly, MA, http://www.cellsignal.com). Precipitated DNA samples were resuspended in 30 µl. PCR was performed on 1 µl of pure extracts or a 100-fold dilution (INPUT sample) with the Taq polymerase from Takara, using primers 5'-agt gga agc cag gca tag tg-3' and 5'-agg tga ctc cag gac att gg-3', amplifying part (187 bp) of the aes1 promoter (nucleotides –3419 to –3606) containing the putative Stat3 binding sites. Thirty-six cycles were performed at an annealing temperature of 66°C.

Transfection and Luciferase Measurements
pRcCMV and pRcCMVStat3 expression vectors were a gift from J. Bromberg [12]. An annealed oligonucleotide corresponding to the –3490 to –3419 region of aes1 promoter containing the three putative (agctcttctgggtaatagctcaactcctaattcccagaatg-cagttcactccaggatc) or mutated (agctcacctgggtcatagctcaactccta-aaccccagtctgcagaccactcgaggatc) stat3 binding sites was cloned between the SstI and BglII sites of the pGL2-promoter luciferase reporter plasmid (Promega, Madison, WI, http://www.promega.com) to generate the pAES1 or pAES1mut plasmids, respectively.

293T cells were grown in Dulbecco’s modified Eagle’s medium containing 10% FCS. A total of 10⁵ cells was seeded in a 35-mm dish 24 hours before transfection using Fugene6 reagent (Roche Diagnostics). Total DNA for transfection was 1.6 µg, including 0.75 µg of empty pRcCMV or pRc CMV-Stat3 expression vector, 0.75 µg of luciferase reporter construct (pAES1 or pAES1mut), and 0.1 µg of ß-galactosidase internal control vector to correct for variation in transfection efficiency.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Earliest Stages of ES Cell Differentiation
To identify downstream Stat3 target genes specifically involved in self-renewal regulation, we first determined the time window when a consistent decrease in ES cell potential occurred without extensive differentiation. To this end, we used the previously described Gs2 ES cell line expressing the tetracycline regulatable dominant-negative form of Stat3, which induces the differentiation within 6 days [4]. This Stat3F mutant differs from the wild-type protein by a mutation in the Y705 residue (Y705-F) and is believed to act by competitive inhibition of Stat3 phosphorylation at gp130 docking sites and, possibly, by sequestrating Stat3 partners in the cytoplasm. As shown in Figure 1A, Gs2 ES cells cultured under standard condition (+LIF/ON) formed characteristic round-shaped colonies, whereas morphological changes occurred 96 hours after LIF (–LIF) or tetracycline withdrawal (Tet OFF), with the presence of most large flattened differentiated colonies. To determine the time of engagement into differentiation in the two conditions, we also examined the expression of marker genes for the three germ layers [6, 13, 14]. The ectoderm (FGF-5) and parietal and visceral endoderm (GATA-4) markers were detected 48 hours after Stat3F expression and increased during differentiation, whereas the mesoderm marker brachyury appeared later, at 72 hours (Fig. 1B). We also tested the ability of ES cells maintained for 24 or 48 hours without LIF or tetracycline to subsequently form EB3 and BC4 in the absence of LIF and the presence of tetracycline to avoid Stat3F expression during the differentiation step (Table 1). A decrease in BC4 formation was observed when the cells were precultured for 48 hours without tetracycline (55% of the control). More pronounced effects were seen when the cells were LIF-deprived for 48 hours because only 54% (EB3) and 35% (BC4) of the colonies were obtained. Overall, for a given duration of preculture, LIF deprivation is more potent than Stat3F expression for abrogating pluripotency. This feature, consistent with the morphology (Fig. 1A) and the gene expression level of differentiation markers and microarray data (Fig. 1B and see below), may reflect the already described partial inhibition of endogenous Stat3 by Stat3F ([4] and data not shown).

View larger version (69K): [in this window] [in a new window]   Figure 1. Morphological changes and germ layer marker expression on Gs2 embryonic stem cell differentiation. (A): Phase-contrast images of Gs2 embryonic stem cells plated at 5 x 103 cells per cm2 and cultured under standard conditions (leukemia inhibitor factor [LIF] 100 U/ml and tetracycline [Tet] 1 µg/ml; control), without Tet (Tet OFF), or without LIF (–LIF) for 96 hours. All photographs are at the same magnification, x 4. (B): Reverse transcription–polymerase chain reaction kinetic analysis of lineage-specific marker expression after Tet removal. As a positive control, cells were cultured for 96 hours without LIF.

Microarray Analysis After LIF Deprivation
We first analyzed the modulation of gene expression upon LIF removal for 16, 24, and 48 hours in the presence of tetracycline (Tet ON). For each time point, six independent hybridizations were performed. The data were globally normalized and filtered as described in the experimental procedure section. Among a total of 5,891 genes, 277 were identified as differentially expressed at least at one time point according to a Student’s t-test with a 99% confidence level (p < .01, supplemental online data 1). Kinetic analysis revealed that most of the statistically significant modulations occurred at 48 hours (277 vs. 43 and 46 genes at 16 and 24 hours, respectively). These differentially expressed genes were then grouped according to their expression profile by hierarchical clustering with the Pearson’s correlation. Gene clusters with related expression pattern were easily distinguishable (Fig. 2). mRNAs increasing from 16 to 48 hours were grouped in cluster A, whereas those showing a decrease during this period were grouped in cluster B. Examples of known genes from these two clusters, showing the highest variations (mean of ratio > 1.5), are given in Figure 2. Among those, several genes were expected to vary upon ES cells differentiation. We indeed found a decrease in mRNA levels of osteopontin (spp1) [15], activin beta-B (Inhbb) [14, 16], and zinc finger protein 57 (zfp57) [17] and an increase in mesoderm-specific transcript (mest) mRNA. Other genes previously reported to vary (socs3 [18], zfp42/rex1 [6], and CD9 [15]) were also found but are not shown in Figure 2 because of a t-test p value above .01 (.02, .03, and .07, respectively). Interestingly, a decrease in Stat3 and socs3 expression, both described as Stat3 targets, was also found [19, 20]. These observations support evidence for a differentiation of ES cells and validate our approach. Several other genes whose expression has not previously been reported to vary were identified, some of which play an important role in the regulation of cell cycle or differentiation. For instance, mRNA levels of the helix-loop-helix (HLH) transcriptional regulators Id1 and Id2 were found to increase. This was also the case for mRNA-encoding cell-cycle regulators, such as the cyclin-dependent kinase inhibitor p57^kip2 and cyclin D3. In addition, this study also pointed to several genes encoding proteins that can interfere with signaling pathways such as transforming growth factor (TGF)-ß or Wnt pathway, known to be important for the control of stem cells properties [21, 22]. This is the case for lefty1 (ebaf), a member of the TGF-ß superfamily, whose expression increased after LIF removal, and for aes1 (grg5), encoding a groucho-like partner of Tcf/LEF transcription factors, the nuclear mediators of Wnt signaling [23], whose expression is diminished.

View larger version (64K): [in this window] [in a new window]   Figure 2. Modulation of gene expression upon LIF withdrawal. Gene expression was analyzed after LIF removal for 16, 24, and 48 hours. Statistically significant modulations in gene expression (Student’s t-test, p < .01) were grouped by hierarchical clustering with the Pearson’s correlation. Shown are examples of known genes with variation above 1.5-fold. Color code: yellow, no variation; red, upregulation; green, downregulation.

View larger version (52K): [in this window] [in a new window]   Figure 3. Modulation of gene expression after Stat3F induction. Expression of Stat3F was induced by tetracycline removal for 16, 24, or 48 hours, and gene expression was analyzed. Statistically significant modulations in gene expression (t-test, p < .01) were grouped by hierarchical clustering with the Pearson’s correlation. Shown are examples of known genes with variation above 1.5-fold. Color code: yellow, no variation; red, upregulation; green, downregulation.

View larger version (18K): [in this window] [in a new window]   Figure 4. Validation through real-time reverse transcription–polymerase chain reaction (RT-PCR) of the variation of several common genes. (A): Real-time RT-PCR measurement of mRNA level after Stat3F expression (Tet OFF) or leukemia inhibitor factor (LIF) removal (–LIF) for 48 hours in Gs2 cells. (B): Upregulation and downregulation of, respectively, Id2 and aes1 mRNA level in IOUD2 and E14 ES cells after LIF removal for 48 hours. Data were normalized with gapdh as standard.

View larger version (17K): [in this window] [in a new window]   Figure 5. Functionality of the STAT binding sites in the promoter of aes1. (A): 293T cells were cotransfected with aes1 promoter-driven luciferase expression vectors (wild-type, AES1, or mutated, AES1mut) and empty (pRc) or Stat3 expression vector (pRc S3) as indicated. Luciferase activity was measured 48 hours after transfection and normalized with ß-galactosidase activity as an internal control. Values are means ± SE from three independent transfections. (B): Embryonic stem cells were LIF-starved for 48 hours and then restimulated for 15 minutes (lanes 1, 3, and 5). Polymerase chain reaction amplification with primers toward part of the aes1 promoter containing the putative STAT3 binding sites was performed on chromatin sample (INPUT, positive control) or on Stat3-immunoprecipitated or irrelevant immunoglobulin G-immunoprecipitated (negative control) chromatin samples (ChIP) as indicated.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Some of these genes can act as potential links between LIF/gp130/Stat3 and multiple signaling pathways previously involved in the maintenance of stem cell properties such as bone morphogenic protein (BMP) and Wnt [9, 21, 22]. This is the case for the secreted Lefty1 protein of the TGF-ß superfamily, an antagonist of Nodal signaling. By negatively interacting with the EGF-CFC coreceptors, Lefty antagonizes signaling of the Nodal/Vg1/GDF TGF-ß subset of ligands [28, 29]. Lefty has also been implicated in the antagonism of TGF-ß1 [30], BMP signaling [30–32], as well as the Wnt pathway [33] and has been shown to activate the MAP kinase pathway [34]. In mouse ES cells, Lefty1 expression increases upon retinoic acid–induced differentiation [35], whereas, in contrast, activin expression falls dramatically when the cells are induced to differentiate [16]. Interestingly, Nodal has a negative effect on neural differentiation from ES cells [36], and activation of the TGF-ß/activin/nodal signaling through SMAD2/3 has been described to be associated with pluripotency and required for the maintenance of the undifferentiated state in human ES cells and in ex vivo mouse blastocyst outgrowth [37]. Our results of an increase in expression of an antagonist of these ligands and a concomitant decrease of the inhibin ß-B subunit of activin upon LIF withdrawal and Stat3F expression suggest that Stat3 contributes to maintaining an optimal TGF-ß/activin/nodal signaling in undifferentiated ES cells.

We also demonstrated an upregulation of Id1 and Id2 mRNA level. Id proteins are inhibitors of basic HLH transcription factors, which often positively regulate differentiation. In ES cells, Id1–3 proteins were identified as direct targets of BMP signaling [9, 38] and display opposite functions depending on the presence or absence of LIF. In the presence of LIF, they mediate the BMP4 inhibitory effect on neuroectodermal differentiation, thus participating in self-renewal. However, in the absence of LIF, they rather promote differentiation into non-neural fates [9], suggesting that LIF/Stat3 signal neutralizes the BMP promesodermal effect. Our observation of an increase in Id1 and Id2 mRNAs after Stat3F expression suggests that LIF/gp130/Stat3 antagonizes the BMP signaling pathway at the level of Id1 and Id2 transcription.

Because Stat3 acts mainly as a transactivator, direct Stat3 targets are expected to be found among the downregulated group of mRNA, whereas upregulated genes are more likely to be indirect targets. We identified aes1 (grg5) as a downregulated gene and could further show that three Stat-binding sites were present in the promoter region of aes1. We established through ChIP experiments that endogenous Stat3 binds to this promoter and can stimulate transcription from these sites, strongly suggesting that Stat3 directly transactivates aes1 in ES cells. Aes1 belongs to the TLE/grg groucho-like family of transcriptional corepres-sors, which bind and repress various transcription factors, including Tcf proteins, the nuclear mediators of the canonical Wnt signaling [23]. Activation of the Wnt/ß-catenin pathway leads to the maintenance of pluripotency in both ES and hematopoietic adult stem cells [21, 22, 39–41]. Interestingly, Aes1 lacks the C-terminal region of TLE/grg proteins and is a naturally occurring trans–dominant-negative molecule alleviating transcriptional repression by TLE/grg proteins [23, 42, 43]. Thus, in contrast to its full-length relatives, Aes1 acts by derepressing, rather than by inhibiting, Tcf-mediated transactivation and may therefore increase the canonical Wnt signaling in ES cells. Hence, Aes1 could both contribute to the positive effect of Stat3 on self-renewal and mediate a crosstalk between LIF/gp130/Stat3 and Wnt signaling. Aes1-null mice are viable, and approximately half of the mice exhibit a growth defect [44, 45]. However, the lack of abnormal embryonic or perinatal lethality, as seen in Stat3 knockout mice [46], may imply a functional redundancy with, for instance, other splice forms of TLE/grg proteins featuring only the amino terminal domains typical of aes1 [47, 48]. Interestingly, certain functions of aes1 are revealed when the level of one of its transcription factor partners is twofold lowered, as recently reported in skeletal development [49]. Accordingly, the putative role of aes1 in maintaining the activity of various transcription factors in ES cells above a critical threshold may be revealed in a sensitized background, for instance, when the Wnt signaling is weakened. Further functional analysis on aes1 and other identified genes is required to better understand the molecular mechanisms involved in ES cell self-renewal; however, our work sheds new light on the mechanisms underlying ES cell self-renewal.

	ACKNOWLEDGMENTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
We thank Prof. A. Smith for the gift of the Gs2 cells, J. Bromberg for pRcCMV and pRcCMV-Stat3 expression vector, and Edwige Leclercq and Marie-Hélène Courtier for helpful technical assistance with the RT-PCR experiments. D.S. is a recipient of a fellowship from Institut Gustave-Roussy. This work was supported in part by a grant from Association Contre le Cancer (ARC 4728).

DISCLOSURES
The authors indicate no potential conflicts of interest.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Smith AG. Embryo-derived stem cells: of mice and men. Annu Rev Cell Dev Biol 2001;17:435–462.[CrossRef][Medline]

2. Boeuf H, Hauss C, Graeve FD et al. Leukemia inhibitory factor-dependent transcriptional activation in embryonic stem cells. J Cell Biol 1997;138:1207–1217.[Abstract/Free Full Text]

3. Matsuda T, Nakamura T, Nakao K et al. STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J 1999;18:4261–4269.[CrossRef][Medline]

4. Niwa H, Burdon T, Chambers I etal. Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 1998;12:2048–2060.[Abstract/Free Full Text]

5. Raz R, Lee CK, Cannizzaro LA et al. Essential role of STAT3 for embryonic stem cell pluripotency. Proc Natl Acad Sci U S A 1999;96:2846–2851.[Abstract/Free Full Text]

6. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 2000;24:372–376.[CrossRef][Medline]

7. Chambers I, Colby D, Robertson M et al. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643–655.[CrossRef][Medline]

8. Mitsui K, Tokuzawa Y, Itoh H et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 2003;113:631–642.[CrossRef][Medline]

9. Ying QL, Nichols J, Chambers I et al. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 2003;115:281–292.[CrossRef][Medline]

10. Kennedy M, Firpo M, Choi K et al. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature 1997;386:488–493.[CrossRef][Medline]

11. Boyd KE, Wells J, Gutman J et al. c-Myc target gene specificity is determined by a post-DNA-binding mechanism. Proc Natl Acad Sci U S A 1998;95:13887–13892.[Abstract/Free Full Text]

12. Bromberg JF, Wrzeszczynska MH, Devgan G et al. Stat3 as an oncogene. Cell 1999;98:295–303.[CrossRef][Medline]

13. Fujikura J, Yamato E, Yonemura S et al. Differentiation of embryonic stem cells is induced by GATA factors. Genes Dev 2002;16:784–789.[Abstract/Free Full Text]

14. Keller G, Kennedy M, Papayannopoulou T et al. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol 1993;13:473–486.[Abstract/Free Full Text]

15. Oka M, Tagoku K, Russell TL et al. CD9 is associated with leukemia inhibitory factor-mediated maintenance of embryonic stem cells. Mol Biol Cell 2002;13:1274–1281.[Abstract/Free Full Text]

16. Albano RM, Groome N, Smith JC. Activins are expressed in preimplantation mouse embryos and in ES and EC cells and are regulated on their differentiation. Development 1993;117:711–723.[Abstract]

17. Tanaka TS, Kunath T, Kimber WL et al. Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity. Genome Res 2002;12:1921–1928.[Abstract/Free Full Text]

18. Duval D, Reinhardt B, Kedinger C et al. Role of suppressors of cytokine signaling (Socs) in leukemia inhibitory factor (LIF)-dependent embryonic stem cell survival. FASEB J 2000;14:1577–1584.[Abstract/Free Full Text]

19. Ichiba M, Nakajima K, Yamanaka Y et al. Autoregulation of the Stat3 gene through cooperation with a cAMP-responsive element-binding protein. J Biol Chem 1998;273:6132–6138.[Abstract/Free Full Text]

20. Auernhammer CJ, Bousquet C, Melmed S. Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci U S A 1999;96:6964–6969.[Abstract/Free Full Text]

21. Kielman MF, Rindapaa M, Gaspar C et al. Apc modulates embryonic stem-cell differentiation by controlling the dosage of betacatenin signaling. Nat Genet 2002;32:594–605.[CrossRef][Medline]

22. Sato N, Meijer L, Skaltsounis L et al. Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat Med 2004;10:55–63.[CrossRef][Medline]

23. Brantjes H, Roose J, van De Wetering M et al. All Tcf HMG box transcription factors interact with Groucho-related co-repressors. Nucleic Acids Res 2001;29:1410–1419.[Abstract/Free Full Text]

24. Burdon T, Stracey C, Chambers I et al. Suppression of SHP-2 and ERK signalling promotes self-renewal of mouse embryonic stem cells. Dev Biol 1999;210:30–43.[CrossRef][Medline]

25. Ehret GB, Reichenbach P, Schindler U et al. DNA binding specificity of different STAT proteins: comparison of in vitro specificity with natural target sites. J Biol Chem 2001;276:6675–6688.[Abstract/Free Full Text]

26. Kelly DL, Rizzino A. DNA microarray analyses of genes regulated during the differentiation of embryonic stem cells. Mol Reprod Dev 2000;56:113–123.[CrossRef][Medline]

27. Loring JF, Porter JG, Seilhammer J et al. A gene expression profile of embryonic stem cells and embryonic stem cell-derived neurons. Restor Neurol Neurosci 2001;18:81–88.[Medline]

28. Chen C, Shen MM. Two modes by which Lefty proteins inhibit nodal signaling. Curr Biol 2004;14:618–624.[CrossRef][Medline]

29. Cheng SK, Olale F, Brivanlou AH et al. Lefty blocks a subset of TGFß signals by antagonizing EGF-CFC coreceptors. PLoS Biol 2004;2:E30.[CrossRef][Medline]

30. Ulloa L, Tabibzadeh S. Lefty inhibits receptor-regulated Smad phosphorylation induced by the activated transforming growth factor-beta receptor. J Biol Chem 2001;276:21397–21404.[Abstract/Free Full Text]

31. Meno C, Shimono A, Saijoh Y et al. lefty-1 is required for left-right determination as a regulator of lefty-2 and nodal. Cell 1998;94:287–297.[CrossRef][Medline]

32. Meno C, Ito Y, Saijoh Y et al. Two closely-related left-right asymmetrically expressed genes, lefty-1 and lefty-2: their distinct expression domains, chromosomal linkage and direct neuralizing activity in Xenopus embryos. Genes Cells 1997;2:513–524.[Abstract]

33. Branford WW, Yost HJ. Lefty-dependent inhibition of Nodal- and Wnt-responsive organizer gene expression is essential for normal gastrulation. Curr Biol 2002;12:2136–2141.[CrossRef][Medline]

34. Ulloa L, Creemers JW, Roy S et al. Lefty proteins exhibit unique processing and activate the MAPK pathway. J Biol Chem 2001;276:21387–21396.[Abstract/Free Full Text]

35. Oulad-Abdelghani M, Chazaud C, Bouillet P et al. Stra3/lefty, a retinoic acid-inducible novel member of the transforming growth factor-beta superfamily. Int J Dev Biol 1998;42:23–32.[Medline]

36. Watanabe K, Kamiya D, Nishiyama A et al. Directed differentiation of telencephalic precursors from embryonic stem cells. Nat Neurosci 2005;8:288–296.[CrossRef][Medline]

37. James D, Levine AJ, Besser D et al. TGFß/activin/nodal signaling is necessary for the maintenance of pluripotency in human embryonic stem cells. Development 2005;132:1273–1282.[Abstract/Free Full Text]

38. Hollnagel A, Oehlmann V, Heymer J et al. Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. J Biol Chem 1999;274:19838–19845.[Abstract/Free Full Text]

39. Reya T, Duncan AW, Ailles L et al. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 2003;423:409–414.[CrossRef][Medline]

40. Willert K, Brown JD, Danenberg E et al. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 2003;423:448–452.[CrossRef][Medline]

41. Murdoch B, Chadwick K, Martin M et al. Wnt-5A augments repopulating capacity and primitive hematopoietic development of human blood stem cells in vivo. Proc Natl Acad Sci U S A 2003;100:3422–3427.[Abstract/Free Full Text]

42. Roose J, Molenaar M, Peterson J et al. The Xenopus Wnt effector XTcf-3 interacts with Groucho-related transcriptional repressors. Nature 1998;395:608–612.[CrossRef][Medline]

43. Swingler TE, Bess KL, Yao J et al. The proline-rich homeodomain protein recruits members of the Groucho/Transducin-like enhancer of split protein family to co-repress transcription in hematopoietic cells. J Biol Chem 2004;279:34938–34947.[Abstract/Free Full Text]

44. Mallo M, Gendron-Maguire M, Harbison ML et al. Protein characterization and targeted disruption of Grg, a mouse gene related to the groucho transcript of the Drosophila enhancer of split complex. Dev Dyn 1995;204:338–347.[Medline]

45. Wang WF, Wang YG, Reginato AM et al. Growth defect in Grg5 null mice is associated with reduced Ihh signaling in growth plates. Dev Dyn 2002;224:79–89.[CrossRef][Medline]

46. Takeda K, Noguchi K, Shi W et al. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci U S A 1997;94:3801–3804.[Abstract/Free Full Text]

47. Leon C, Lobe CG. Grg3, a murine Groucho-related gene, is expressed in the developing nervous system and in mesenchyme-induced epithelial structures. Dev Dyn 1997;208:11–24.[CrossRef][Medline]

48. Lepourcelet M, Shivdasani RA. Characterization of a novel mammalian Groucho isoform and its role in transcriptional regulation. J Biol Chem 2002;277:47732–47740.[Abstract/Free Full Text]

49. Wang W, Wang YG, Reginato AM et al. Groucho homologue Grg5 interacts with the transcription factor Runx2-Cbfa1 and modulates its activity during postnatal growth in mice. Dev Biol 2004;270:364–381.[CrossRef][Medline]

This article has been cited by other articles:

				S J Kimber, S F Sneddon, D J Bloor, A M El-Bareg, J A Hawkhead, A D Metcalfe, F D Houghton, H J Leese, A Rutherford, B A Lieberman, et al. Expression of genes involved in early cell fate decisions in human embryos and their regulation by growth factors Reproduction, May 1, 2008; 135(5): 635 - 647. [Abstract] [Full Text] [PDF]

				M. Snyder, X.-Y. Huang, and J. J. Zhang Identification of Novel Direct Stat3 Target Genes for Control of Growth and Differentiation J. Biol. Chem., February 15, 2008; 283(7): 3791 - 3798. [Abstract] [Full Text] [PDF]

				D. Wegmuller, I. Raineri, B. Gross, E. J. Oakeley, and C. Moroni A Cassette System to Study Embryonic Stem Cell Differentiation by Inducible RNA Interference Stem Cells, May 1, 2007; 25(5): 1178 - 1185. [Abstract] [Full Text] [PDF]

				S. Tabibzadeh and A. Hemmati-Brivanlou Lefty at the Crossroads of "Stemness" and Differentiative Events Stem Cells, September 1, 2006; 24(9): 1998 - 2006. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 2005-0182v1 23/10/1634    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sekkaï, D. Articles by Bennaceur-Griscelli, A. Search for Related Content PubMed PubMed Citation Articles by Sekkaï, D. Articles by Bennaceur-Griscelli, A.