Stem Cells http://www.stemcellsportal.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, M.
Right arrow Articles by Leffert, H. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, M.
Right arrow Articles by Leffert, H. L.

Stem Cells 2005;23:186-199 www.StemCells.com
© 2005 AlphaMed Press

Embryonic Mouse STO Cell–Derived Xenografts Express Hepatocytic Functions in the Livers of Nonimmunosuppressed Adult Rats

Mingjun Zhanga,c, Brigid Josephe, Sanjeev Guptae, I. Guestc, Meng Xuc, Stewart Sellc,d, Kyung-Hwa Sona, Katherine S. Kocha, Hyam L. Lefferta,b

a Department of Pharmacology and
b Center for Molecular Genetics, University of California, San Diego, California;
c Ordway Research Institute and
d New York State Health Department, Albany, New York;
e Marion Bessin Liver Research Center, Albert Einstein College of Medicine, Bronx, New York, USA

Key Words. Mouse STO progenitor cells • Xenotransplantation • Nonimmunosuppressed rats

Correspondence: K.S. Koch, and H.L. Leffert, Department of Pharmacology and Center for Molecular Genetics, University of California, San Diego, La Jolla, California, 92093-0636 USA. Telephone: 858-534-2354; Fax: 858-822-4184; e-mail: kkoch{at}ucsd.edu and hleffert{at}ucsd.edu


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells derived from embryonic mouse STO cell lines differentiate into hepatocytes when transplanted into the livers of nonimmunosuppressed dipeptidylpeptidase IV (DPPIV)–negative F344 rats. Within 1 day after intrasplenic injection, donor cells moved rapidly into the liver and were found in intravascular and perivascular sites; by 1 month, they were intrasinusoidal and also integrated into hepatic plates with approximately 2% efficiency and formed conjoint bile canaliculi. Neither donor cell proliferation nor host inflammatory responses were observed during this time. Detection of intrahepatic mouse COX1 mitochondrial DNA and mouse albumin mRNA in recipient rats indicated survival and differentiation of donor cells for at least 3 months. Mouse COX1 targets were also detected intrahepatically 4–9 weeks after STO cell injection into nonimmunosuppressed wild-type rats. In contrast to STO-transplanted rats, mouse DNA or RNA was not detectable in untreated or mock-transplanted rats or in rats injected with donor cell DNA. In cultured STO donor cells, DPPIV and glucose-6-phosphatase activities were observed in small clusters; in contrast, mouse major histocompatibility complex class I H-2Kq, H-2Dq, and H-2Lq and class II I-Aq markers were undetectable in vitro before or after interferon gamma treatment. Together with H-2K allele typing, which confirmed the Swiss mouse origin of the donor cells, these observations indicate that mouse-derived STO cell lines can differentiate along hepatocytic lineage and engraft into rat liver across major histocompatibility barriers.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Embryonic stem cells undergo self-renewal coupled with differentiation into mature parenchymal cells of mesodermal, ectodermal, and endodermal origin [1, 2]. In the developing embryo, tissue progenitor cells may have less potential than embryonic cells but also have the capacity to give rise to different mature cells types [1, 2]. Such cells are variously unrestricted in their biological potential, and it is these properties that provide and hold so much promise for therapeutic transplantation regimens [3]. However, unless transplantation is accompanied by immunosuppression, engraftment of stem or progenitor cells across strain or species difference fails as a result of expression of major histocompatibility markers by the progeny of the stem cells and graft rejection [4–8].

The development of stem or progenitor cell lines with capacities for differentiation and unrestricted transplantation might resolve these immunological problems [9]. Recent transplantation studies with stromal stem cells and progenitor cells of bone marrow [10] and neural origin [11] and attenuated major histocompatibility complex (MHC) expression in these and similar cells [12–14] suggest this may be possible. In this report, evidence is presented that shows that embryonic mouse STO cell lines [15, 16] behave like liver progenitor cells in nonimmunosuppressed rats. These findings are provocative for their biological implications to liver stem cell biology and gene therapy [17] and also because mouse STO cells have been, and continue to be, widely used as feeder layers to support culture and development of embryoid bodies [18], embryonic stem cells [19], and liver progenitor cells [13, 20].


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Dipeptidylpeptidase IV–negative (DPPIV–) or wild-type DPPIV+ F344 rats (180–200 g) were bred at the Albert Einstein College of Medicine or supplied by Simonsen Labs (Gilroy, CA). DBA/1 mice were supplied by Harlan Labs (Indianapolis); C57BL/6J and C57BL/6-SvJ were obtained from Jackson Labs (Bar Harbor, ME); and Swiss mice were purchased from Taconic Farm (Germantown, NY). All animals were fed and housed under standard conditions on 12-hour light/dark cycles.

Cell Lines and Cell Culture
Rat 7777 (American Type Culture Collection [ATCC] CRL-1601) and mouse Hepa 1–6 (ATCC CRL-1830), Swiss NIH3T3, STO (ATCC CRL-1503), and STO-derived 3(8)21 and 3(8)21-enhanced green fluorescent protein (EGFP) [16] cells were cloned and cultured by standard procedures [16].

Xenotransplantation
Donor cells were obtained from confluent cultures of either 3(8)21-EGFP or STO cells. In each instance, to eliminate potential and unforeseen problems of cell contamination or mix up, chain of custody, subculture history, and passage logs were maintained, and routine measurements of mouse markers were made as described elsewhere [16]. The cells were harvested at passage 23 in Ca2+/Mg2+/HCO3–-free Hanks’ buffered saline supplemented with 0.05% trypsin and 0.53 mM EDTA; viability was >99% [16]. Ten million washed cells in 0.2–0.5 ml were injected intrasplenically [21] without immunosuppression.

Liver Isolation, Histochemistry, and Morphometry
Livers were flash frozen and stored in liquid N2. Fixed 5-µm tissue sections were stained for glycogen, DPPIV (an hepatobiliary marker in transplanted cells), glucose-6-phosphatase (G-6-Pase) (an hepatocyte marker), ATPase (a biliary marker in native cells), and {gamma}-glutamyl-transpeptidase (GGT) (a bile duct marker) [21–23]. Conjoint bile canaliculi were detected by expression of ATPase in bile canaliculi shared by recipient and DPPIV+ cells [21]. Engrafted DPPIV+ cells per liver were quantified morphometrically; to minimize sampling errors, morphometric analyses were performed in at least 30 random tissue sections sampled among different liver lobes. The number of transplanted cells per liver was determined by estimating the number of DPPIV+ cells per unit of liver volume. DPPIV+ cells were counted in individual sections by mounting paper disks containing a central hole of 7-mm diameter (0.19 mm3 after taking into account 5-µm thickness of sections). These data were used to calculate the number of transplanted cells per rat liver, the volume of which was taken as 9 cm3 [24]. The number of transplanted cells identified in tissues was represented as a percent of the total cell number transplanted (1 x 107 cells = 100%). Statistical analyses were performed by Student’s t-tests.

Immunohistochemistry and Cytochemistry
Formalin-fixed livers were embedded in paraffin and processed by standard procedures. Tissue sections were incubated for 16 hours at 4°C with goat anti-GFP antibody (Rockland, Gilbertsville, PA), washed, incubated for 1 hour at 20°C with biotinylated swine anti-rat/anti-mouse/anti-goat antibody (Dako, Carpinteria, CA), and developed with extravidin-peroxidase and diaminobenzidine (Sigma, St. Louis). Washed cell cultures were fixed for 10 minutes in 100% ethanol and stained [21–23].

Polymerase Chain Reaction and Restriction Digest Analyses
DNA was isolated from cultured cells or liver samples [16] or from whole livers homogenized with a Brinkmann Polytron using DNeasy Tissue Kits (Qiagen, Valencia, CA). Polymerase chain reaction (PCR) products were purified using Qiagen MinElute PCR Purification Kits and characterized on agarose minigels [25] using 100-bp DNA ladders (Promega, Madison, WI). Mouse and rat mitochondrial COX1 and ß-actin targets were amplified by standard procedures [16].

Purified PCR products were incubated overnight at 37°C with PleI (+) or PleI-buffer (–) (New England Biolabs, Beverly, MA) and heated for 20 minutes at 65°C before further analysis. Reaction products were detected by ethidium bromide (EtBr) staining on agarose gels or probed by hybridization on Southern blots using a labeled mouse COX1-specific 17-mer, a probe specific for the 165-bp 3' end fragment of the mouse COX1 product [16], as described below.

Mouse H-2K genotyping was determined by PCR for the microsatellite marker target D17Mit28 (http://www.informatics.jax.org/searches/accession_report.cgi?id=MGI:702821) using genomic DNA isolated from C57BL/6J and Swiss mouse peripheral blood cells (PBC) and cultured STO and 3(8)#21-EGFP cells. Forward and reverse oligodeoxynucleotide primer sequences were 5'-ACTCAGGACTCAGAATGAAGATCC-3' and 5'-ATTCCTAGATGAAAAGTCTGTGGC-3'. Total cellular DNA was purified with a Wizard genomic DNA purification kit (Promega) using the supplier’s protocol. PCR was performed using a PCR core system (Promega). PCRs were run with 100 ng of genomic DNA and 25 pmol of each primer in 50-µl reaction volumes containing 1.5 mM MgCl2 for 35 cycles with an annealing temperature of 58°C. EtBr-stained PCR products were analyzed by 4% agarose gel electrophoresis.

Reverse Transcriptase–Coupled PCR
Total RNA and poly_A+ RNA were isolated and purified from cultured cells and liver samples [16] or from whole homogenized livers using Qiagen RNeasy MiniKits. RNA quality was characterized on formaldehyde-agarose gels [25]. ß-actin mRNA was detected as described elsewhere [16].

Reverse transcription (RT)–PCR assays for mouse albumin and DPPIV mRNA were performed in two stages essentially as previously described [16]. The first-stage reaction used poly_A+ RNA purified from total RNA with a Qiagen Oligotex mRNA Mini Kit (Valencia, CA). In the second stage, nested PCR was performed using a MiniCycler (MJ Research, Boston). First and nested second-stage albumin primers(Tm=62°C)were GACGTGTGTTGCCGATGAGTC (sense), CAGCCTCTGGCCTTTCAAATG (antisense) and CGATGAGTCTGCCGCCAACT (sense), TTTCAAATGGTGGCAGGCTG (antisense), respectively; the sizes of the predicted first- and second-stage albumin mRNA products were 209 and 185 bp, respectively. First-stage (Tm = 60°C) and nested second-stage DPPIV primers (Tm = 62°C) were CTCATCCTCTAGTGCGGCTC (sense), CAGTCTTTCTTATCTTTCGGG (antisense) and GGCTCCCATCCAAATCCCTG (sense), AACATGCTGCTGCTCGGATG (antisense), respectively; the sizes of the predicted first- and second-stage DPPIV mRNA products were 351 and 193 bp, respectively. Reaction mixtures (50 µl) contained 1 µl first-stage RT-PCR product, 25 pmol second-stage primers, 2 mM MgCl2, 0.2 mM nucleotide mix, and 2.5 units DNA Taq Polymerase (Promega). PCR conditions were as follows: denaturation for 5 minutes at 95°C, 40 cycles (30 seconds at 95°C, 30 seconds at 62°C, 30 seconds at 72°C), final extension for 5 minutes at 72°C, hold at 4°C. The amplified products were stored at –20°C and analyzed by electrophoresis in 1.5% agarose minigels containing 0.5 µg EtBr/ml. Gel bands were visualized by UV light and photographed with a Polaroid camera. Specific products were undetectable in the absence of DNA substrates or reverse transcriptase.

DNA Sequencing
Mouse albumin and DPPIV RT-PCR products were electrophoresed on 1.5% agarose gels, extracted, and purified with Qiagen QIAEX II Gel Extraction Kits. Both strands were sequenced with an ABI PRISM 3100 Gene Analyzer in the University of California, San Diego Cancer Center Core Lab. Oligodeoxynucleotide primers (GenBase, La Jolla, CA) were designed, and sequence alignments were performed with VectorNTI v.8 (Informax, Frederick, MD). H-2K PCR products were purified with a High Pure PCR Product Purification kit (Roche Diagnostics GmbH, Penzberg, Germany), and the positive strands were sequenced by the Genomics Institute at the Wadsworth Center. Published albumin GenBank accession numbers are NM_134326 [GenBank] for rat and AJ457860 [GenBank] for mouse. Published DPPIV GenBank accession numbers are NM_012789 [GenBank] for rat and NM_010074 [GenBank] for mouse.

Southern Blots
DNA samples were electrophoresed on 1.5% agarose gels for 6 hours at 180 V. Gel-separated molecules were denatured and neutralized by standard procedures, transferred by capillary action (6 x standard saline citrate [SSC] for 24 hours at 21°C) onto Hybond membranes (Amersham, Piscataway, NJ), air dried for 30 minutes, and crosslinked by UV irradiation [25].

Mouse COX1 PCR products (untreated or treated with PleI) were detected with a mouse-specific 17-mer (5'-AGGAGCATCAGTAGACC-3') labeled with [{gamma}-32P]ATP (MP Biochemicals, Irvine, CA) at its 5' end (Roche). The probe was purified through a Microspin G-25 column (Amersham) and stored at –70°C. Blots were prehybridized for 1–2 hours at 55°C, hybridized for 3–4 hours at 55°C, washed under optimized conditions, air dried for 30 minutes, and autoradiographed at –70°C using Hyperfilm (Amersham) and Dupont intensifying screens.

DPPIV RT-PCR products were detected with a mouse-specific 193-bp probe. The probe was amplified from mouse liver RNA as described above, labeled with [{alpha}-32P]dCTP (MP Biomedicals) using a Rediprime II Kit (Amersham), column purified, and denatured for 5 minutes at 100°C before hybridization at 68°C. Blots were washed for 5 minutes at 21°C with 2 x SSC/0.5% sodium dodecyl sulfate (SDS) and 15 minutes at 21°C with 2 x SSC/0.1% SDS, transferred into 0.1 x SSC/0.1% SDS, incubated 0.5–4 hours at 68°C, washed two times with 0.1 x SSC, air dried for 20–30 minutes, and autoradiographed.

Immunofluorescence
Trypsinized cultured cells and DBA/1 splenocytes [26] were washed two times with 10 ml phosphate-buffered saline (PBS) at 4°C, resuspended (106 cells/100 µl), and distributed into round-bottom Falcon tubes on ice. Monoclonal antibodies (MAbs) and affinity-purified antibodies were purchased from BDPharmingen (SanDiego). Cellswereincubatedfor30 minutes in darkness with buffer (plus secondary MAb for the H-2Dq/H-2Lq group) or isotype MAbs (fluorescein isothiocyanate [FITC]–conjugated mouse IgG2a,{kappa} [#553456], purified mouse IgG2a, {kappa} [#553454], or phycoerythrin [PE]–conjugated rat IgG2b, {kappa} [#555848]) or with FITC-conjugated mouse anti-mouse H-2Kq (#553597), purified mouse anti-mouse H-2Dq/H-2Lq (#558968), or PE-conjugated rat anti-mouse I-Aq/I-E (#557000; 1 µg MAb/106 cells). Washed samples were centrifuged and resuspended in PBS at 4°C. Anti-H-2Dq/H-2Lq–treated samples were incubated with FITC-conjugated rat anti-mouse IgG2a, {kappa} secondary MAb (#553390) at 4°C, washed, and resuspended. Mouse FITC-conjugated anti-rat class I MHC MAbs RT1Aa,b,l (RT1Alv1; #559996) and RT1A (OX-18; #554919) and their respective FITC-conjugated MAb anti-rat IgM, {kappa} (#553942) and IgG1, {kappa} (#550616) isotype controls were processed similarly. Viable cells were analyzed with a BD FACSCalibur flow cytometer. H-2K, H-2D/H-2L, and I-A/I-E data files were processed with CellQuest Pro (BD Biosciences, San Jose, CA) and WinMDI v2.8 software (http://facs.scripps.edu), respectively.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Mouse STO Cell Lines Can Be Xenotransplanted into Nonimmunosuppressed DPPIV– Rats
To investigate differentiation potential of a putative rat liver progenitor cell line, 3(8)21-EGFP cells [27] were injected into spontaneously mutated DPPIV– rats [21, 28]. The DPPIV gene is naturally mutated in DPPIV– rats with lack of cell surface expression and enzyme activity. This readily permits identification of transplanted cells with DPPIV enzyme activity, e.g., hepatocytes, which abundantly express DPPIV in bile canalicular domains. Similarly, stem or progenitor cells lacking DPPIV activity at the outset can be identified in the liver of DPPIV– recipients after cell differentiation along appropriate lineages [21–23]. As previously described, 3(8)21-EGFP cells were clonally derived specifically from cocultures of putative 3(8)21 rat liver progenitor cells and STO cells that had been retrovirally transduced with EGFP and neomycin resistance (neoR) genes [27]. Thus, because 3(8)21-EGFP cells were thought to be derived from the rat liver progenitor cells, they were assumed to be syngeneic with DPPIV– rats and to express properties of adult hepatocytes or biliary cells [27].

EGFP+ cells were seen inside spleens and livers soon after injection (Fig. 1Go). Four weeks later, DPPIV+ cells were detected in liver plates, mainly in portal spaces or periportal and midzonal sinusoids and occasionally in perivenous areas (Fig. 2AGo). Mitotic figures and host inflammatory responses were undetectable. DPPIV+ cells coexpressed glycogen and G-6-Pase and hepatocyte-like conjoint patterns of linear DPPIV and ATPase bile canalicular staining, which varied from 10%–80% of transplanted cells at 1–2 and 4–12 weeks. The numbers of DPPIV+ cells per liver comprised approximately 2.0%, 1.7%, and 2.1% of injected cells at 1, 2, and 4 weeks (p < .05) or approximately 2 to 3 donor cells/104 recipient hepatocytes; a single rat liver contains approximately 8 x 108 hepatocytes [29]. The fraction of DPPIV+ cells in vascular areas declined with time; approximately 30% of them remained in portal or sinusoidal areas at 12 weeks. Virtually all wild-type DPPIV+ hepatocytes and bile canalicular domains were stained red in positive control wild-type liver tissue samples (Fig. 2AGo, panel i), whereas neither red nor background staining reactions were observed in DPPIV– control liver tissues incubated with substrate (glycyl-L-proline-4-methoxy-2-naphthylamide) plus fast Blue B salt (for color development) in PBS, pH 7.4 (Fig. 2AGo, panel j). Under similar transplantation conditions, grafts of syngeneic rat hepatocytes survive through 3 months, whereas hepatocytes from outbred rats, hamsters, and human fetuses and cell lines die within 72 hours [17, 21].



View larger version (117K):
[in this window]
[in a new window]
  		Figure 1. Detection of donor 3(8)21-EGFP cells in the vascular spaces of recipient dipeptidylpeptidase IV–negative rat spleen and liver 1 hour after intrasplenic injection: immunohistochemical staining of EGFP. (A): Spleen (x40). Arrows show collections of stained EGFP+ (dark brown) donor cells in red pulp. No staining was observed in control tissue sections incubated without primary antibody. (B): Spleen (x200). (C, D): Liver (x200). Stained cells are observed in the portal vein. (E, F): Liver (x400). Stained cells are observed in sinusoids (E) and partially in a portal venule and sinusoid (F). Abbreviation: EGFP, enhanced green fluorescent protein.

 


View larger version (53K):
[in this window]
[in a new window]
  		Figure 2. Xenoengraftment of 3(8)21-EGFP cells in DPPIV– rats. (A): Histochemistry reveals DPPIV+ donor cells (red) in vascular spaces (a, c, e) or parenchyma (b, d, f) of recipient livers 4 weeks after intrasplenic injections. DPPIV+ cells in portal areas: a, x100; b, inset in a (x400). Costaining of DPPIV/glycogen (magenta cytoplasm) (c, d) and DPPIV/G-6-P (brown cytoplasm) (e, f). Donor cells in Pa or sinusoids show less glycogen or G-6-P (c, e) compared with parenchymal donor cells (d, f); the latter show linear DPPIV staining (arrows: b, d, f, h) and conjoint bile canaliculi (g, h) with DPPIV (donor cells, arrow) and ATPase (dark brown, native hepatocytes, arrowheads) activities. Toluidine blue (a–d) or methyl green counterstains (g, h). Positive and negative control liver tissues (x200) are from histochemical staining of wild-type DPPIV+ F344 liver (i) and recipient DPPIV– liver (j). Both tissues were subjected to DPPIV staining with incorporation of the substrate; all wild-type hepatocytes and bile canaliculi are stained (i), whereas there is no background staining in DPPIV– liver (j). (B): Recipient rat livers contain mouse COX1 products. Polymerase chain reaction assays were performed as described in Materials and Methods (lanes 2 through 20). Experimental and control (mock-transplanted and harvested at 3 months) results from separate rats are shown in lanes 5 through 16 and 17 through 19, respectively; results from cultured donor cells and from normal mouse and rat livers are shown in lanes 3 and 4, 2, and 20, respectively. DNA quality and loading were monitored by ß-actin determinations (bottom row: lanes 2–4, 240-bp mouse product; lanes 5–20, 270-bp rat product). Abbreviations: Cv, central vein; DPPIV, dipeptidylpeptidase IV; EGFP, enhanced green fluorescent protein; G-6-P, glucose-6-phosphate; Pa, portal area.

 
While these investigations were ongoing, one of us (K.S.K.) observed, from studies of Giemsa-stained chromosome spreads, that cloned 3(8)21-EGFP cells and the parental line of transduced 3(8)21 cells originated not from rat liver progenitor cells but, rather, from the aneuploid {gamma}-irradiated mouse STO cells that had been used as feeder layers to isolate the so-called rat liver progenitor cell lines (details are given in [16, 27]). These observations suggested that xenogeneic engraftment of a genetically engineered embryonic ‘fibro-blast’ cell line, derived from E15-E17 mouse embryos [15, 16, 18], had occurred in nonimmunosuppressed rats. This was confirmed by findings of 354-bp mouse COX1 products in livers of 11 of 12 rats between 1 and 12 weeks (Fig. 2BGo). In contrast, mouse COX1 was undetectable in untreated and mock-transplanted rats or in rat livers 4 weeks after intrasplenic injection of 107 cell equivalents (~15 µg) of 3(8)21-EGFP DNA (not shown). Assay fidelity and DNA quality were validated by exclusive detection of 258-bp rat COX1 in samples of rat origin and ubiquitous detection of ß-actin.

To augment sensitivity of detection of mouse COX1 in 3(8)21-EGFP engrafted livers, COX1 PCR products were analyzed by Southern blots before and after treatment with PleI, which recognizes specifically 354-bp mouse COX1 products with 80%–90% cutting efficiency [25, 30]. As shown in validation studies (Fig. 3AGo), PleI cut specifically the mouse COX1 primer-generated mouse liver COX1 PCR product into 189-bp and 165-bp fragments; rat COX1 products generated by rat-specific primers were uncut (top row). COX1-sized PCR products were undetectable using rat or mouse PCR primers in control samples containing mouse or rat liver DNA substrates, respectively (top row), yet DNA quality was intact (bottom row). No hybridization signals were seen on Southern blots of untreated or PleI-treated rat-specific 258-bp COX1 products (middle row). In contrast, specific signals were seen on blots of untreated 354-bp mouse liver products; after PleI treatment, although two digestion products were insufficiently resolved, authentic mouse products were cut into fragments of predicted size (middle row). The positive hybridization signal at the higher position (middle row) likely reflected uncut mouse COX1 products (top row).



View larger version (39K):
[in this window]
[in a new window]
  		Figure 3. Specific detection of mouse COX1 DNA in xenoen-grafted livers from DPPIV–rats. (A): Validation of PleI-specific digestion and Southern blot detection of mouse COX1 PCR products. PCR and restriction digest reactions were performed with normal mouse or rat liver DNA samples using ß-actin, rat, or mouse COX1 primers as described in Materials and Methods. Reaction products are shown in EtBr-stained agarose gels (top and bottom rows) or after hybridization on Southern blots using a labeled mouse COX1-specific 17-mer (middle row). Control and experimental autoradiograms were exposed for 1 and 2.5 days, respectively. (B): Identification of mouse COX1 DNA in recipient rat livers by PleI-coupled Southern blots. Control (mock-transplanted) and experimental livers were obtained from DPPIV– rats 4 weeks after intrasplenic injections of mouse 3(8)21-EGFP or STO cells. PCR products were analyzed on EtBr-stained agarose gels (row one). Undigested (PleI–, row two) or PleI-digested PCR products (PleI+, row three) were hybridized on Southern blots to a labeled mouse COX1-specific 17-mer. Control and experimental autoradiograms were exposed for 1 and 2.5 days, respectively. Internal controls for rat COX1 and ß-actin PCR products on EtBr-stained agarose gels (rows four and five, respectively). Abbreviations: DPPIV, dipeptidylpeptidase IV; EGFP, enhanced green fluorescent protein; EtBr, ethidium bromide; PCR, polymerase chain reaction.

 
Although PleI-coupled Southern analyses were applied to xenografts of 3(8)21-EGFP cells harvested at 4 weeks (Fig. 3BGo) and mouse COX1 products were detected by EtBr staining in only one of three rats (top row), PleI-sensitive mouse COX1 hybridization products were detected in all three (rows two and three). In contrast, hybridization signals were undetectable in untreated and mock-transplanted rats or in rat livers 4 weeks after intrasplenic injection of 3(8)21-EGFP DNA (not shown). PleI-sensitive 220-bp hybridization signals arose from differences between normal tissues and donor cell lines, because these signals were generated by donor cells (not shown) but not mouse livers (Figs. 3A, 3BGo).

To exclude immune privilege that might have been conferred artifactually by {gamma}-irradiation (used initially to prepare STO feeder layers as described elsewhere [16, 27]) or by transduced DNA or EGFP and neoR expression associated with transduced 3(8)21-EGFP cells (as mentioned above), untreated parental STO cells were similarly transplanted. DPPIV+ STO cells were detected at 1, 2, and 4 weeks (Fig. 4AGo) at frequencies of approximately 2% of injected cells. STO cell differentiation into hepatocytes was revealed by colocalized DPPIV and glycogen staining and by integration of donor cells into liver plates as shown by linear and colocalized DPPIV and ATPase canalicular staining. Mouse COX1 products were detected on EtBr-stained gels in two of three rats at 2 weeks (Fig. 4BGo, top row) and on PleI-coupled Southern blots of undigested samples from 11 of 12 rats between 1 and 12 weeks (Fig. 4BGo, row two). Mouse COX1 165-bp PleI-digestion products were detected in roughly half of the PleI-treated samples (row three). Incomplete digestion (Fig. 3AGo) and dilute and low abundance of specific targets are likely to have accounted for failure to detect specific restriction fragments in the remaining samples, because more efficient detection of specific 165-bp fragments in PleI-treated samples was observed on similar PleI-coupled Southern blots in an independent experiment (Fig.3BGo, lanes six through eight). Mouse COX1 products were undetectable in untreated and mock-transplanted rats or in rat livers 1 month after intrasplenic injection of 107 cell equivalents (~15 µg) of STO cell DNA (not shown).



View larger version (69K):
[in this window]
[in a new window]
  		Figure 4. Xenoengraftment of STO cells in DPPIV– rats. (A): Histochemistry reveals intrahepatic donor cells (x400) that express hepatocytic markers 1 (a, b), 2 (c, d), and 4 weeks (e, f) after intrasplenic injections. DPPIV+ cells (arrows in a–f) are costained for glycogen (arrows in b, d, f) or counterstained with toluidine blue (a, c, e). DPPIV+ staining is seen in perivascular cells (c, e; inset in f); linear DPPIV+ staining (b, d, f) is seen in cells costained for ATPase (arrowheads, insets in d and f). (B): Recipient rat livers contain mouse COX1 products. Polymerase chain reaction assays (rows 1, 4, 5) and Southern blots (rows 2, 3) were performed as described in Materials and Methods (lanes 2–17). Autoradiograms were exposed for 1 day (control samples) or 2.5 days (experimental samples). Abbreviation: DPPIV, dipeptidylpeptidase IV; Pa, portal area.

 
STO Cells and 3(8)#21-EGFP Cells Are Derived from Swiss Mice
To be certain of the Swiss mouse origin of STO cells and 3(8)#21-EGFP cells that were used for xenotransplantation, MHC H-2K allele typing was performed on both of the donor cell lines by PCR analysis using standard D17Mit28 primers, followed by determination of the microsatellite DNA sequences expected in the PCR products. The results are summarized in Table 1Go. The size of the C57BL/6J PCR product was approximately 120 bp; the product contained a (CA)24 dinucleotide repeat interrupted by 5 nucleotides between its sixth and seventh repeat. In contrast, the PCR products from Swiss mouse, STO, and 3(8)#21-EGFP cells were smaller but similar in size (~100 bp); all contained shorter, continuous, and essentially identical elements of (CA)17 or (CA)17–18 dinucleotide repeats.


View this table:
[in this window]
[in a new window]
  		Table 1. Determination of H-2K allele types by PCR and DNA sequencing
 
Mouse STO Cell Lines Can Be Xenotransplanted into Nonimmunosuppressed DPPIV+ Rats
DPPIV– rats display normal immunity [31], yet DPPIV is also a lymphocyte surface protein designated CD26 (GenBank #AAH22183), and mutated CD26 might alter T-cell function [32, 33]. Thus, 3(8)21-EGFP or STO xenografts might be tolerated by DPPIV– rats but rejected in wild-type recipients. This possibility was tested by injecting either 3(8)21-EGFP or normal STO donor cells into wild-type DPPIV+ rats. Whereas EtBr-stained mouse COX1 products were undetectable in 3(8)21-EGFP and STO xenografts, Southern blot analyses revealed mouse COX1 products in three of four 3(8)21-EGFP xenografts at 8–9 weeks (two of which yielded PleI-sensitive 165-bp fragments) and in 8 of 12 STO xenografts between 1 and 12 weeks (six of which yielded PleI-sensitive 165-bp fragments). Mouse COX1 products were undetectable in untreated and mock-transplanted rats or in rat livers 1 month after intrasplenic injection of donor cell DNA (not shown).

Hepatocyte-Specific Molecules Are Expressed in Cultured STO Cell Lines
In log-phase cultures at low cell densities, neither hepatocyte nor bile duct markers were observed cytochemically. In contrast, in confluent cultures at high densities (Fig. 5AGo), clusters of DPPIV+ cells were observed frequently in 3(8)21-EGFP and occasionally in STO cultures; GGT staining was undetectable. 3(8)21-EGFP cells formed interspersed clusters with intenseG-6-Pase activity; STO cells were largely negative, but many showed faint precipitates. 3(8)21-EGFP cells showed intense glycogen staining with dark multilayered areas; STO cells stained relatively weakly.



View larger version (67K):
[in this window]
[in a new window]
  		Figure 5. Mouse STO cell lines express hepatocyte-specific properties in culture and in xenografts.(A):Cytochemicalstains (x400) in cultures of 3(8)21-EGFP (a, c, e, g) or STO cells (b, d, f, h). (a, b): DPPIV+ cell clusters, dark and faint orange brown. (c, d): GGT– cells. (e, f): G-6-Pase+, intense and faint brown. (g, h): Glycogen+, intense and weak magenta. Toluidine blue counter-stains (a–h). (B): Mouse albumin and DPPIV mRNA expression in cultured donor cells and 3(8)21-EGFP xenografts. Reverse transcription–polymerase chain reaction assays (rows 1, 2, and 3) and Southern blots (row 4) were performed as described in Materials and Methods. Autoradiograms were exposed for 1 day (control samples) or 7 days (experimental samples). Cultured STO (lane 3) and 3(8)21-EGFP cells (lane 4). Abbreviations: DPPIV, dipeptidylpeptidase IV; EGFP, enhanced green fluorescent protein; G-6-P, glucose-6-phosphate; GGT, {gamma}-glutamyl-transpeptidase; ND, not determined.

 
DPPIV expression was confirmed independently in confluent cultures by nested RT-PCR (Fig. 5BGo) with primers specific for mouse DPPIV (exons 10–14, first-stage 351-bp product [upper band]; exons 10–12, nested 193-bp product [lower band]). Both exon products were detected in each culture system; differences in band intensities of first-stage products (3(8)21-EGFP > STO) were consistent with cytochemical findings. Species and mRNA specificities of RT-PCR products were validated by DNA sequencing, which revealed identical mouse DPPIV sequences (exons 10–12) in mouse liver tissue and both culture systems (not shown).

Albumin synthesis was undetectable in donor cell cultures after immunoprecipitation of [35S]-methionine-labeled proteins or Western blot analyses (not shown). However, albumin mRNA was detected with equivalent intensity in both culture systems by nested RT-PCR (Fig. 5BGo) using primers specific for mouse albumin (exons 3 and 4). Species and mRNA specificities of nested 185-bp RT-PCR products were validated by DNA sequencing, which revealed identical mouse albumin sequences (exons 3 and 4) in control mouse liver tissue and both culture systems (not shown). Albumin mRNA expression was donor cell–specific, being undetectable in cultured Swiss mouse NIH3T3 cells (not shown).

Xenografts of STO Cell Lines Express Albumin and DPPIV mRNAs in DPPIV– Rats
Mouse albumin mRNA was detected with increasing frequency in 3(8)21-EGFP xenografts between 1 and 12 weeks (Fig. 5BGo). Similar results were obtained in a second set of rats injected with 3(8)21-EGFP or STO cells (not shown). In contrast, mouse albumin mRNA was undetectable in untreated and mock-transplanted rats or in recipient livers 1 month after intrasplenic injection of 3(8)21-EGFP DNA (as above). The nested RT-PCR product (Fig. 5BGo, top row, lane 15) from a 3(8)21-EGFP xenograft at 12 weeks was sequenced, and the albumin sequence obtained from the xenograft was identical to those of control mouse liver and STO and 3(8)21-EGFP cells (not shown).

Mouse DPPIV mRNA exons 10 through 12 were undetectable in 3(8)21-EGFP xenografts using unlabeled (Fig. 5BGo) or end-labeled (not shown) primers. This was possibly the result of low abundance and dilution, because mouse DPPIV mRNAs were seen on Southern blots with a 193-bp probe that specifically hybridized to nested approximately 200-bp products from mouse liver and donor cells (Fig. 5BGo, bottom row, lane 2 and lanes 3 and 4, respectively) and one of three xenografts at 12 weeks (Fig. 5BGo, bottom row, lane 15). The slightly higher position of the DPPIV band in the xenograft is due to the presence of two incompletely resolved bands: a more-intense nonspecific higher-Mr band and a less-intense specific approximately 193-bp lower-Mr band (owing to the dilution of target molecules). This conclusion is suggested by the presence of two bands of similar sizes in the sample of normal mouse liver, in which the specific band is more intense than the nonspecific one (Fig. 5BGo, lane 2). Notably, the nonspecific bands are absent or very faint in both donor cell samples (Fig. 5BGo, lanes 3 and 4); this difference may reflect differences between tissues and cultured cell samples. No hybridization signals were observed in control rats before (Fig. 5BGo) or after intrasplenic injection of 3(8)21-EGFP DNA (not shown).

MHC Plasma Membrane Markers Are Neither Expressed Nor Interferon-{gamma}-Inducible in Cultured Swiss Mouse–Derived STO Cell Lines
Consistent with their mouse origin, neither 3(8)21-EGFP nor STO cells expressed rat MHC class I RT-1Alv1 or RT1A (OX-18) determinants by flow cytometry, whereas low levels of expression were observed on 7777 cells, a well-characterized rat cell line (Fig. 6Go).



View larger version (45K):
[in this window]
[in a new window]
  		Figure 6. Cultured donor cells do not express rat major histo-compatibility complex class I markers. Cells were plated (2 x 105/10-cm dish per 10 ml medium), and cell suspensions were analyzed by flow cytometry as described in Materials and Methods. Three treatment groups consisted of incubations with PBS (A, D, G, J) or fluorescein isothiocyanate–conjugated RT1Alv1 (B, E, H, K) or OX-18 (C, F, I, L) MAbs. (A–C): Swiss NIH3T3 mouse cells (negative control). (D–F): Rat 7777 cells (positive control). (G–I): Mouse 3(8)21 cells. (J–L): Mouse STO cells. Fluorescence curves of cells incubated without PBS were identical to the curves obtained with isotype MAb controls. Abbreviations: MAb, monoclonal antibody; PBS, phosphate-buffered saline.

 
However, because donor cell lines reportedly originated from inbred Swiss mice, they should constitutively express mouse MHC molecules of q-haplotype; such expression should be induced or augmented by interferon (IFN)-{gamma} [4]. Unexpectedly, after flow cytometry, neitherclassIH-2Kq, H-2Dq, and H-2Lq nor class II I-Aq determinants were observed before (Fig. 7Go) or after (Fig. 8Go) IFN-{gamma} treatment in vitro. The isotype control and experimental fluorescence curves produced by 3(8)21-EGFP cells were identical (consistent with no detectable MHC-specific fluorescence); but, compared with STO cells (Figs. 7C, 7H, 7MGo, 8B, 8E, 8HGo), the curves were right-shifted and split (Figs. 7D, 7I, 7NGo, 8JGo). These artifacts were caused by endogenous green epifluorescence interference with FITC and PE fluorophores and nonspecific green fluorescence in a cohort of dead epifluorescent cells, as seen by analysis of parental 3(8)21 cells, which showed unimodal fluorescence profiles and no MHC determinants (Fig. 7Go).



View larger version (33K):
[in this window]
[in a new window]
  		Figure 7. Cultured donor cells do not express mouse major histocompatibility complex class I and class II markers. Cells were plated (2 x 105/10-cm dish per 10 ml medium), and cell suspensions were analyzed by flow cytometry as described in Materials and Methods. H-2Kq: top group: shaded, isotype control; unshaded, anti-H-2Kq; H-2Dq/H-2Lq: middle group: unshaded upper panels, isotype control; shaded lower panels, anti-H-2Dq/H-2Lq; I-A: bottom group: unshaded upper panels, isotype control; shaded lower panels, anti-I-A. (A, F, K): q-Haplotype controls: Swiss mouse NIH3T3 (top); DBA/1 splenocytes (middle and bottom). (B, G, L): b-Haplotype control: mouse Hepa 1–6. (C, H, M): STO. (D, I, N): 3(8)21-EGFP. (E, J, O): 3(8)21. Fluorescence curves of cells incubated with or without phosphate-buffered saline were identical to the curves obtained with isotype and secondary monoclonal antibody controls. Abbreviation: EGFP, enhanced green fluorescent protein.

 


View larger version (33K):
[in this window]
[in a new window]
  		Figure 8. IFN-{gamma} does not induce mouse major histocompatibility complex class I or class II expression in cultured STO cells and STO cell derivatives. Cells were plated (2 x 105/10-cm dish per 10 ml medium) as described in Materials and Methods. IFN-{gamma} was purchased from MP Biomedicals. Vehicle (PBS supplemented with 0.1% bovine serum albumin; unshaded upper panels of each group) or IFN-{gamma} (33 ng/ml; shaded bottom panels of each group) were added 24 hours later. On day 5, attached cells were recovered, and flow cytometry assays were performed as described in Materials and Methods. H-2Kq: top group, anti-H-2Kq MAb; H-2Dq/H-2Lq: middle group, anti-H-2Dq/H-2Lq MAb; I-A: bottom group, anti-I-A MAb. (A, D, G): Positive control: Swiss mouse NIH3T3. (B, E, H): STO. (C, F, I): 3(8)21. (J): 3(8)21-EGFP. Fluorescence curves of cells incubated without PBS were identical to the curves obtained with isotype and secondary MAb controls. Abbreviations: EGFP, enhanced green fluorescent protein; IFN, interferon; MAb, monoclonal antibody; PBS, phosphate-buffered saline.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Xenoengraftment, hepatocytic differentiation, and long-term survival of embryonic mouse STO cell lines in the livers of nonimmuno suppressed rats suggest that these cells—authentic STO cells and the derivative line, 3(8)21-EGFP—display both immune privilege and progenitor cell potential.

STO cell lines and their derivatives were characterized recently by molecular, genetic, and karyotypic analyses; 3(8)21-EGFP cells were shown definitively to be derived from the parental STO cell line [16]. However, because of the unusual and unexpected findings, special care was taken to document the chain of custody, origin, and nature of the 3(8)#21-EGFP and STO cell lines described here. The STO cells that were xenotransplanted at the Albert Einstein College of Medicine and at University of California, San Diego were purchased directly from ATCC. Each clonal cell line—3(8)21-EGFP and STO—was processed and cultured alone before recovery for transplantation studies, and cell line passage logs were maintained, monitoring subculture history and solitary sojourn of each line in culture. As expected, rat MHC class I markers were not expressed by either cell line, as determined by flow cytometry with well-characterized and widely used anti-rat MHC MAbs, and H-2Kq allele typing using D17Mit28 primers suggested that both donor cell lines used for xenotransplantation studies could have been derived from q-haplotype Swiss mice.

Transplantation is dependent on recipient immunity and graft antigenicity. The tolerogenizing effect of delivery of antigen to a fetus [34, 35] or to host liver [36–39] is exemplary of recipient privilege. Even foreign grafts of parenchymal cells such as liver and brain [40–42], privileged by low MHC class I expression, necessitate impaired host immunity for survival. For example, hepatocyte xenografts in rabbits and rodents die rapidly without immunosuppression [43–45], and the survival of ovarian xenografts in adult rats requires nude hosts [46]. In comparison, little is known about the immunogenicity of differentiation-competent progenitor cells. Recent reports suggest that freshly isolated class I+/II– mouse bone marrow stromal stem cells survive in rat myocardium [10]; cultured class I– mouse neural progenitor cells survive under allogeneic mouse renal capsules [11]; and cultured class I+/II– GFP+ human embryonic stem cell lines survive 48 hours after injection into the quadricep muscles of immunocompetent mice [47]. The biological status of such xenogeneic and allogeneic survivors is questionable, however, because potential artifacts caused by donor cell fusion with recipient cells [48], genomically integrated vectors and reporter genes, or transfection of recipient cells by naked DNA released from dying donor cells were not eliminated in any of these studies.

Four sets of observations support the conclusion that STO cell lines may be immunologically privileged. First, under conditions in which allogeneic or xenogeneic hepatocytes are rejected, xenografts of either parental or genetically modified STO cell lines evaded rejection for 1–3 months in either DPPIV– or DPPIV+ rats. Thus, xenograft survival was not facilitated by integrated reporter genes, nor by CD26–DPPIV– rats, the cellular and humoral immunity of which is reportedly normal [31].

Second, although donor cell immunogenicity was not directly determined, STO cell lines did not display MHC class I (H-2Kq H-2Dq H-2Lq) or class II (I-Aq) markers in vitro in the absence or presence of IFN-{gamma}. Such properties are similar but not identical to the MHC phenotypes of normal stem and progenitor cells from various sources: HLA-I expression is low in some but not all [47] cultured human embryonic stem cell lines and is augmented by IFN-{gamma} [12]; RT1Alv1– OX-18LOW phenotypes in embryonic rat liver progenitor cells are converted to RT1Alv1+ OX-18+ after induction of differentiation in vitro [13]; adult murine bone marrow–derived pluripotent progenitor cells are class I–/II–[14]. The absence of both MHC class I/II display by STO cell lines and inflammatory responses in recipient livers suggests that immunological ignorance rather than T-cell anergy [49] facilitates xenoengraftment. Further analysis of the genetic and functional status of the H-2 complex in STO cell lines and screens for production of tolerogenizing costimulatory factors or immunoregulatory ligands [4] will help to define the roles of class I–/II– phenotypes in STO cell line immune privilege.

Third, adventitious transfection of host hepatocytes by DNA released from dying donor cells seems excluded, because mouse histochemical and molecular markers were undetectable after injection of donor cell DNA into recipient rats.

Fourth, fusion between donor cells and recipient hepatocytes was not directly excluded. However, the available evidence in this report suggests it is unlikely; in cell culture, DPPIV expression (an hepatocyte marker) was detected in small numbers of donor cells, obviously in the absence of liver cells; and, in xenoengrafted livers, DPPIV and G-6-Pase costained donor cells were found outside parenchymal structures, lodged in and around blood vessels, and dispersed within sinusoids (i.e., sites not directly in contact with parenchymal hepatocytes). Donor and recipient cell fusion controversy has clouded the interpretation of many liver stem cell transplantation studies since the initial reports of cell suspensions of transplanted bone marrow precursors giving rise to hepatocytes [50–53]. The possibility that bone marrow stem cells might fuse with recipient liver cells in vivo was first raised when sex-mismatched syngeneic bone marrow cells were reported to have fused with recipient liver cells during restoration of chronically damaged liver in fumarylacetoacetate hydrolase (FAH) knockout mice [54, 55]. However, there is remarkable chronic liver damage and proliferation with polyploidy of recipient cells in FAH mice, raising doubts about the origin of the fused cells in the FAH model. In addition, there are conflicting reports on the significance of fusion in normal replacement of liver cells. For example, two recent reports suggest that human cord blood mononuclear cells give rise to human hepatocytes in recipient immune-deficient non-obese diabetic/severe combined immunodeficiency mice, with no evidence of fusion [56, 57]; whereas using Cre-lox donor recipient models, both positive [58] and negative [59] fusion results have been obtained. Further experiments are needed to support our tentative conclusion.

In contrast to syngeneic adult hepatocytes, which are all DPPIV+ and which engraft in DPPIV– rats at frequencies of 30% of injected cells [21], and despite extended periods of observation and different methods of recipient liver tissue and DNA sampling, only 2% of cells from STO cell lines were competent of xenoengraftment and integration into liver parenchyma as judged by DPPIV staining. This percentage probably reflects a lower limit of engraftment, because only DPPIV+ cells would have been detected and, consistent with progenitor cell–like behavior, only a small fraction of donor cells cytochemically displayed DPPIV activity before xenotransplantation. The differentiation response might be attributed to in vivo selection by the liver microenvironment or to predetermined properties of the donor clones. Because the available evidence favors some immune privilege of donor clones, it seems that either sub-populations of predetermined cells or stochastic events govern engraftment behavior observed in these rats. That there is predetermination and progenitor cell–like behavior is supported by in vitro observations of the spontaneous development of clusters of hepatocyte-like DPPIV+ and G-6-Pase+ cells. Yet how hepatic microenvironments and culture conditions qualitatively or quantitatively regulate the formation of DPPIV+ cells and clusters remains to be determined; fluctuation analysis will facilitate distinciton between these possibilities [60].

STO cell lines may have acquired properties of immune privilege and hepatocytic progenitor cell potential through mutation and aneuploidy generated by many years of subculture. For example, the original fibroblast lines were isolated from trypsinized E15-E17 embryos from an inbred congenic mouse strain highly susceptible to Friend leukemia virus infection [15]; parental lines were selected subsequently for resistance to ouabain and 6-thioguanine [18]. Alternatively, these properties may have been constitutively expressed by normal mouse E15-E17 cells before derivation and selection [15]. Clonal variation between parental STO and 3(8)21-EGFP would not be unexpected, solely as a result of {gamma}-irradiation and genetic engineering of the latter line, and is consistent with observations of enhanced in vitro expression of DPPIV, G-6-Pase, and glycogen in the 3(8)21-EGFP line. Further studies are needed to assess the discordant yet cell-specific expression of albumin mRNA in the absence of albumin synthesis and the full extent of donor cell progenitor potential.

The clinical promises of progenitor cells might be fulfilled and the restrictions imposed by transplantation barriers resolved were it possible to isolate, identify, or genetically engineer animal cells with dual properties of progenitor cells and universal engraftment. STO cell lines will provide convenient sources to analyze progenitor cell differentiation and mechanisms of graft tolerance, but their capacity to meet such clinical requirements remains to be determined.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This work was supported by the American Cancer Society, NIH (DK46592, DK41296, DK57619, and ES10337), and University of California, San Diego (UCSD) Academic Senate (RE466-H). We thank P. Castiglioni, D. Young and M. Zanetti (UCSD), and H. Crissman (LANL) for help with flow cytometry and helpful discussion; B. Ju and S. Maeda (UCSD) for NIH3T3 cells and mouse liver; and Bruce Herron (Wadsworth Genomics Institute) and Stephanie Ostrowski for their assistance in the mouse MHC sequencing.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Till JE, McCulloch EA, Siminovitch L. A stochastic model of stem cell proliferation based on the growth of spleen colony-forming cells. Proc Natl Acad Sci U S A 1963;51:29–36.

  2. Sell S, ed. Stem Cells Handbook. Totowa, NJ: Humana Press, 2004:1–509.

  3. Down JD, White-Scharf ME. Reprogramming immune responses: enabling cellular therapies and regenerative medicine. STEM CELLS 2003;21:21–32.[Abstract/Free Full Text]

  4. Abbas AK, Lichtman AH. Basic Immunology: Functions and Disorders of the Immune System. Philadelphia: WB Saunders, 2001:1–309.

  5. Auchincloss H Jr. In search of the elusive Holy Grail: the mechanisms and prospects for achieving clinical transplantation tolerance. Am J Transplant 2001;1:6–12.[CrossRef][Medline]

  6. Kamradt T, Mitchison NA. Tolerance and autoimmunity. N Engl J Med 2001;344:655–664.[Free Full Text]

  7. Anderson CC, Matzinger P. Immunity or tolerance: opposite outcomes of microchimerism from skin grafts. Nature Med 2001;7:80–87.[CrossRef][Medline]

  8. Sykes M. Mixed chimerism and transplant tolerance. Immunity 2001;14:417–424.[CrossRef][Medline]

  9. Fairchild PJ, Cartland S, Nolan KF et al. Embryonic stem cells and the challenge of transplantation tolerance. Trends Immunol 2004;25:465–470.[CrossRef][Medline]

  10. Saito T, Kuang JQ, Bittira B et al. Xenotransplant cardiac chimera: immune tolerance of adult stem cells. Ann Thorac Surg 2002;74:19–24.[Abstract/Free Full Text]

  11. Hori J, Ng TF, Shatos M et al. Neural progenitor cells lack immunogenicity and resist destruction as allografts. STEM CELLS 2003;21:405–416.[Abstract/Free Full Text]

  12. Drukker M, Katz G, Urbach A et al. Characterization of the expression of MHC proteins in human embryonic stem cells. Proc Natl Acad Sci U S A 2002;99:9864–9869.[Abstract/Free Full Text]

  13. Kubota H, Reid LM. Clonogenic hepatoblasts, common precursors for hepatocytic and biliary lineages, are lacking classical major histocompatibility complex class I antigen. Proc Natl Acad Sci U S A 2000;97:12132–12137.[Abstract/Free Full Text]

  14. Jiang Y, Jahagirdar BN, Reinhardt RL et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41–49.[CrossRef][Medline]

  15. Ware LM, Axelrad AA. Inherited resistance to N- and B-tropic murine leukemia viruses in vitro: evidence that congenic mouse strains SIM and SIM.R differ at the Fv-1 locus. Virology 1972;50:339–348.[CrossRef][Medline]

  16. Zhang M, Sell S, Leffert HL. Hepatic progenitor cell lines from allyl alcohol-treated adult rats are derived from {gamma}-irradiated mouse STO cells. STEM CELLS 2003;21:449–458.[Abstract/Free Full Text]

  17. Gupta S, Cho J-J. Transplantation of hepatic stem cells and potential applications for cell therapy. In: Sell S, ed. Stem Cells Handbook. Totowa, NJ: Humana Press, 2004:409–416.

  18. Martin GR, Evans MJ. Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro. Proc Natl Acad Sci U S A 1975;72:1441–1445.[Abstract/Free Full Text]

  19. Talbot NC, Powell AM, Garrett WM. Spontaneous differentiation of porcine and bovine embryonic stem cells (epiblast) into astrocytes or neurons. In Vitro Cell Dev Biol 2002;38:191–197.

  20. Rogler LE. Selective bipotential differentiation of mouse embryonic hepatoblasts in vitro. Am J Pathol 1997;150:591–602.[Abstract]

  21. Gupta S, Rajvanshi P, Lee CD. Integration of transplanted hepatocytes in host liver plates demonstrated with dipeptidyl peptidase IV deficient rats. Proc Natl Acad Sci U S A 1995;92:5860–5864.[Abstract/Free Full Text]

  22. Rajvanshi P, Kerr A, Bhargava KK et al. Efficacy and safety of repeated hepatocyte transplantation for significant liver repopulation in rodents. Gastroenterology 1996;111:1092–1102.[CrossRef][Medline]

  23. Sokhi RP, Rajvanshi P, Gupta S. Transplanted reporter cells help in defining onset of hepatocyte proliferation during the life of F344 rats. Am J Physiol Gastroint Liver Physiol 2000;279:G631–G640.[Abstract/Free Full Text]

  24. Ott M, Rajvanshi P, Sokhi R et al. Differentiation-specific regulation of transgene expression in a diploid epithelial cell line derived from the normal F344 rat liver. J Pathol 1999;187:365–373.[CrossRef][Medline]

  25. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001.

  26. Pan L, Sato S, Frederick JP et al. Impaired immune responses and B-cell proliferation in mice lacking the Id3 gene. Mol Cell Biol 1999;19:5969–5980.[Abstract/Free Full Text]

  27. Yin L, Sun M, Ilic Z et al. Derivation, characterization and phenotypic variation of hepatic progenitor cell lines isolated from adult rats. Hepatology 2002;35:315–324.[CrossRef][Medline]

  28. Thompson NL, Hixson DC, Callanan H et al. A Fischer rat substrain deficient in dipeptidyl peptidase IV activity makes normal steady-state RNA levels and an altered protein: use as a liver-cell transplantation model. Biochem J 1991;273:497–502.

  29. Leffert HL, Koch KS, Sell S et al. Biochemistry and biology of N-acetyl-2-aminofluorene in primary cultures of adult rat hepatocytes. USEPA Environ Sci Res 1983;29:119–133.

  30. Ausubel FM, Brent R, Kingston RE et al., eds. Current Protocols in Molecular Biology. New York: Greene Publishing & Wiley Interscience Press, 1987.

  31. Coburn MC, Hixson DC, Reichner JS. In vitro immune responsiveness of rats lacking active dipeptidylpeptidase IV. Cell Immunol 1994;158:269–280.[CrossRef][Medline]

  32. Iwata S, Morimoto C. CD26/Dipeptidyl peptidase IV in context: the different roles of a multifunctional ectoenzyme in malignant transformation. J Exp Med 1999;190:301–305.[Free Full Text]

  33. Boonacker EP, Wierenga EA, Smits HH et al. CD26/DPPIV signal transduction function, but not proteolytic activity, is directly related to its expression level on human Th1 and Th2 cell lines as detected with living cell cytochemistry. J Histochem Cytochem 2002;50:1169–1177.[Abstract/Free Full Text]

  34. Billingham RE, Brent L, Medawar PB. "Actively acquired tolerance" of foreign cells. Nature 1953;172:603–606.[CrossRef][Medline]

  35. Liechty KW, MacKenzie TC, Shaaban AF et al. Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation in sheep. Nature Med 2000;6:1282–1286.[CrossRef][Medline]

  36. Calne RY, Sells RA, Pena JR et al. Induction of immunological tolerance by porcine liver allografts. Nature 1969;223:472–476.[CrossRef][Medline]

  37. Starzl TE, Murase N, Abu-Elmagd K et al. Tolerogenic immunosuppression for organ transplantation. Lancet 2003;361:1502–1510.[CrossRef][Medline]

  38. Crispe IN. Hepatic T cells and liver tolerance. Nat Rev Immunol 2003;3:51–62.[CrossRef][Medline]

  39. Nagata H, Ito M, Cai J et al. Treatment of cirrhosis and liver failure in rats by hepatocyte xenotransplantation. Gastroenterology 2003;124:422–431.[CrossRef][Medline]

  40. Lafferty KJ, Prowse SJ, Simeonovic CJ. Immunobiology of tissue transplantation: a return to the passenger leukocyte concept. Annu Rev Immunol 1983;1:143–173.[CrossRef][Medline]

  41. Halloran PF, Wadgymar A, Autenreid P. The regulation of expression of major histocompatibility products. Transplantation 1986;41:413–420.[Medline]

  42. Harris HW, Gill TJ. Expression of class I transplantation antigens. Transplantation 1986;42:109–117.[Medline]

  43. Gunsalus JR, Brady DA, Coulter SM et al. Reduction of serum cholesterol in Watanabe rabbits by xenogeneic hepato-cellular transplantation. Nature Med 1997;3:48–53.[CrossRef][Medline]

  44. Kobayashi N, Fujiwara T, Westerman KA et al. Prevention of acute liver failure in rats with reversibly immortalized human hepatocytes. Science 2000;287:1258–1262.[Abstract/Free Full Text]

  45. Nishitai R, Plummer TB, Platt JL. Detection of albumin synthesis in transplanted porcine hepatocytes in mice. Liver Transplant 2002;18:972–974.[CrossRef]

  46. Snow M, Cox SL, Jenkin G et al. Generation of live young from xenografted mouse ovaries. Science 2002;297:2227.[Free Full Text]

  47. Li L, Baroja ML, Majumdar A et al. Human embryonic stem cells possess immune-privileged properties. STEM CELLS 2004;22:448–456.[Abstract/Free Full Text]

  48. Grompe M. The importance of knowing your identity: sources of confusion in stem cell biology. Hepatology 2004;39:35–37.[CrossRef][Medline]

  49. Schwartz RH. A cell culture model for T lymphocyte clonal anergy. Science 1990;248:1349–1356.[Abstract/Free Full Text]

  50. Petersen BE, Bowen WC, Patrene KD et al. Bone marrow as a potential source of hepatic oval cells. Science 1999;284:1168–1170.[Abstract/Free Full Text]

  51. Theise ND, Badve S, Saxena R et al. Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology 2000;31:235–240.[CrossRef][Medline]

  52. Krause DS, Theise ND, Collector MI et al. Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 2001;105:369–377.[CrossRef][Medline]

  53. Lagasse E, Conners H, Al-Shalimy M et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med 2000;6:1229–1234.[CrossRef][Medline]

  54. Wang X, Willenbring H, Akkari Y et al. Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature 2003;422:897–901.[CrossRef][Medline]

  55. Vassilopoulos G, Wang P-R, Russell DW. Transplanted bone marrow regenerates liver by cell fusion. Nature 2003;422:901–904.[CrossRef][Medline]

  56. Newsome PN, Johannessen I, Boyle S et al. Human cord blood-derived cells can differentiate into hepatocytes in the mouse liver with no evidence of fusion. Gastroenterology 2003;124:1891–1900.[CrossRef][Medline]

  57. Ishikawa F, Drake CJ, Yang S et al. Transplanted human cord blood cells give rise to hepatocytes in engrafted mice. Ann N Y Acad Sci 2003;996:174–185.[Abstract/Free Full Text]

  58. Alvarez-Dolando NA, Pardal R, Garcia-Verdungo JM et al. Fusion of bone marrow-derived cells with Purkinje neurons, cardiomyocytes and hepatocytes. Nature 2003;425:968–973.[CrossRef][Medline]

  59. Ianus A, Holz GG, Theise ND et al. In vivo derivation of glucose-competent pancreatic endocrine cells from bone marrow with no evidence of cell fusion. J Clin Invest 2003;111:843–850.[CrossRef][Medline]

  60. Fidler IJ, Kripke ML. Metastasis results from preexisting variant cells within a malignant tumor. Science 1977;197:893–895.[Abstract/Free Full Text]

Received June 7, 2004; accepted for publication October 13, 2004.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited