Stem Cells 2005;23:240-251
www.StemCells.com
© 2005 AlphaMed Press
Stem Cell Factor Synergistically Enhances Thrombopoietin-Induced STAT5 Signaling in Megakaryocyte Progenitors through JAK2 and Src Kinase
A. Lyndsay Drayera,
Arjen-Kars Boerb,
E. Leonie Losb,
Mariet T. Esselinkb,
Edo Vellengab
a Sanquin Blood Bank, North East Region, Groningen, The Netherlands;
b Division of Hematology, Department of Medicine, University Hospital Groningen, Groningen, The Netherlands
Key Words. Synergy • Megakaryocyte • Stem cell factor • STAT5 • Src kinase
Correspondence: A. Lyndsay Drayer, Ph.D., Sanquin Blood Bank North East Region, Prof. Rankestraat 42-44, 9713 GG Groningen, The Netherlands. Telephone: 31-50-3613052; Fax: 31-50-3695556; e-mail: L.drayer{at}sanquin.nl
 |
ABSTRACT
|
|---|
Stem cell factor (SCF) has a potent synergistic effect during megakaryopoiesis when administered in combination with the major megakaryocytic cytokine, thrombopoietin (TPO). In this study we analyzed the underlying mechanisms with regard to STAT5 activity. TPO stimulation of MO7e cells resulted in STAT5 transactivation, which could be enhanced 1.6-fold by costimulation with SCF, whereas SCF alone did not induce STAT5 transcriptional activity. This costimulatory effect of SCF was reflected in an increase in TPO-induced STAT5 DNA binding and increased and prolonged STAT5 tyrosine phosphorylation in both MO7e cells and primary human megakaryocyte progenitors. In contrast, serine phosphorylation of STAT5 was constitutive and associated with an inhibitory effect on STAT5 transactivation. Signal transduction pathways that might synergize in TPO-mediated STAT5 transactivation were analyzed using specific pharmacological inhibitors and indicated an essential role for Janus-activated kinase 2 (JAK2) and a partial role for Src-family kinases. Costimulation with SCF was found to increase and prolong tyrosine phosphorylation of JAK2 and the TPO receptor c-mpl. In addition, the Src kinase inhibitor SU6656 partially downregulated the additional effect of SCF costimulation on STAT5 tyrosine phosphorylation. SCF-induced enhancement of JAK2 phosphorylation was not affected by inhibition of Src kinase, suggesting that both JAK2 and Src kinase mediate STAT5 tyrosine phosphorylation. Synergistic activation of JAK2 and Src kinase may thus contribute to the enhanced STAT5 signaling in the presence of TPO and SCF.
 |
INTRODUCTION
|
|---|
Stem cell factor (SCF) and thrombopoietin (TPO) are critical cytokines during hematopoiesis, regulating stem and progenitor cell survival and proliferation [15]. In addition, TPO is the major megakaryocytic cytokine affecting the megakaryocytic differentiation program [69]. Although SCF alone does not support megakaryocyte colony formation, it has been shown to have a potent synergistic effect during megakaryopoiesis in the presence of TPO [1012]. TPO belongs to the family of type I cytokine receptors that lacks intrinsic tyrosine kinase activity. The binding of TPO to its receptor c-mpl results in dimerization of the receptor and activation of the Janus family of protein kinases (JAKs) [13,14] This induces phosphorylation of c-mpl on tyrosine residues, thereby creating docking sites for cytoplasmic signaling molecules containing Src homology 2 domains. As a result, downstream signaling cascades are initiated, including the signal transducer and activator of transcription (STAT) pathway, the phosphatidyl inositol 3-kinase (PI3K) pathway, and the extracellular-regulated kinase (ERK) pathway [1518]. The receptor for SCF, c-kit, is a member of the tyrosine kinase family of receptors and undergoes auto-phosphorylation upon binding SCF, resulting in activation of multiple signaling proteins such as PI3K, Src kinases, Shc, Grb2, Grb7, and Ras [19,20].
Although the individual contribution of TPO to megakaryocytic development and signal transduction pathways has been extensively investigated, the molecular mechanism underlying the synergistic action with SCF is poorly understood. In the erythroid lineage, several studies have shown cooperation between erythropoietin receptor (Epo-R) signaling and c-kit. A physical association between c-kit and Epo-R has been reported, and stimulation of cells with SCF has been shown to transphosphorylate Epo-R [2123]. It has recently been demonstrated that SCF-induced activation of the Src kinase pathway plays an essential role in the synergistic action with Epo [20]. Furthermore, Kapur and Zang [24] have shown that SCF and Epo can synergistically regulate erythroid progenitor survival by a mechanism in which SCF maintains protein expression of the Epo-R, STAT5, and Bcl-XL. Finally, our previous studies have shown that SCF-induced activation of the protein kinase A (PKA)/cyclic AMP responsive element binding (CREB) pathway synergizes with Epo to mediate an increase in STAT5 transactivation [25].
In the present study, we investigated the signaling pathways involved in the synergistic activation of STAT5 by SCF and TPO in megakaryocytic cells. STAT5 has been shown to be critical for erythroid development and to play an important role in the repopulating activity of hematopoietic stem cells [2628]. In addition, STAT5 is expressed in all megakaryocytic cells, ranging from early progenitor cells (CD34+) to circulating platelets [29]. Both STAT5A and STAT5B isoforms are tyrosine phosphorylated and activated by a wide range of cytokines and growth factors [30,31] and control the expression of multiple genes, including the antiapoptotic Bcl-X protein [32,33] and the cell-cycle inhibitor p21WAF [34]. In this study we show that SCF enhances TPO-mediated STAT5 tyrosine phosphorylation by a mechanism involving JAK2 and Src-like kinase. In this way, costimulation with SCF results in enhanced STAT5 DNA binding and transcriptional activity.
 |
MATERIALS AND METHODS
|
|---|
Materials
RPMI-1640 medium (RPMI) was purchased from ICN (Amora, OH). Fetal bovine serum (FBS) was obtained from Bodinco B.V. (Alkmaar, The Netherlands). Interleukin 3 (IL-3) was obtained from R&D Systems (ITK Diagnostics, Uithoorn, The Netherlands). For TPO stimulation, human recombinant pegylated megakaryocyte growth and differentiation factor was used, which was a kind gift from Kirin Brewery Company (Tokyo). SCF was obtained from Immunex Corporation (huMGF, Seattle). Monoclonal antibody against tyrosine-phosphorylated STAT5 (
-P-Y-STAT5, Y694/699; 5A/5B) was purchased from New England Biolabs (Beverly, MA). Polyclonal antibody against STAT5 (A39,
STAT5) and phosphoserine-780 STAT5A (
P-S-STAT5, S780) were gifts from I. Beuvink (Fried-rich Miescher Institute, Basel, Switzerland). The polyclonal phosphoserine-726/731 STAT5A/B (
P-S-STAT5, S726/731) was kindly provided by H. Rui (Georgetown University, Lombardi Cancer Center, Washington, DC). The pharmacological inhibitors SU6656 (500 nM) and H89 (30 µM) were obtained from Calbiochem (La Jolla, CA), AG490 (100 µM) and AG1296 (20 µM) were from Biomol (Plymouth, PA), LY294002 (10 µM) was from Alexis (San Diego), and U0126 (10 µM) was purchased from Promega (Leiden, The Netherlands). The efficacy of the inhibitors H89, LY294002, and U0126 was determined by the effective inhibition of TPO-induced phosphorylation of the downstream targets CREB, PKB, and Erk1/2, respectively (not shown).
Plasmids
The STAT5 reporter plasmid containing a minimal promoter and three repetitive STAT5 binding sites from the ß-casein promoter (pSP72-MP-3 x STAT5-luciferase) and its control plasmid lacking the STAT5-binding sites (pSP72-MP-luciferase) were gifts from I. Matsumura (Osaka University Medical School, Osaka, Japan). The expression vectors for wild-type and mutated STAT5A and STAT5B proteins (pcDNA1-STAT5A and pcDNA1-STAT5B vectors) were donated by H. Rui (Georgetown University, Lombardi Cancer Center). Control vector pcDNA3 was obtained from Invitrogen Life Technologies (Merelbeke, Belgium).
Cell Culture
MO7e cells [35] were routinely propagated in RPMI supplemented with heat-inactivated FBS (5% vol/vol) and IL-3 (10 ng/ml). CD34+ cells were obtained from healthy donors undergoing G-CSF treatment following institutional guidelines. CD34+ cells were isolated with magnetic microbead selection using the Isolex-300 method (Baxter, Deerfield, IL) as described by the manufacturer and grown in hematopoietic progenitor growth medium supplemented with TPO and SCF. The CD61+ cell fraction was purified from primary cultures after 7 days by MoFlow sorting (Dako-Cytomation, Glustrup, Denmark). Before preparing cell extracts, cells were deprived of cytokines overnight (MO7e cells) or for 3 hours (primary cells) in RPMI with 0.5% FBS and subsequently stimulated with 20 ng/ml TPO for the indicated periods. When cells were costimulated with SCF, SCF (20 ng/ml) was added 30 minutes before TPO stimulation. In the present study, we chose to prestimulate cells with SCF instead of adding both cytokines simultaneously. In preliminary experiments, we did test the effect of simultaneous addition of SCF and TPO, but the effects were less pronounced. The inhibitors were added 30 minutes before cytokine stimulation, except for AG490, which was added 3 hours before stimulation.
Cell proliferation was assessed by [3H]-thymidine incorporation assay, as previously described [36].
Quantitative Reverse TranscriptionPolymerase Chain Reaction
For reverse transcriptionpolymerase chain reaction (RT-PCR), total RNA was extracted from 1 x 106 cells with TriZol Reagent (Invitrogen, Breda, The Netherlands) according to the manufacturers instruction. One microgram of total RNA was reverse transcribed using random hexamer priming with M-MLv reverse transcriptase (Invitrogen). The cDNA was diluted fivefold, and 2 µl of this solution was used in a 20-µl PCR reaction with the DNA Master SYBR Green1 kit (Roche, Almere, The Netherlands) and the appropriate primers using LightCycler apparatus (Roche) according to the manufacturers instructions. Serially diluted cDNA was amplified in parallel with the samples to quantitate the amount of specific cDNA present in each sample. The relative amount of cDNA was calculated using LightCycler software provided by Roche. The sequence of the primers used (5'-3') were as follows: GAPDH forward: cggagtcaacggatttg-gtcgtat, reverse: agccttctccatggtggtgaagac; p21waf forward: tcaccgagacaccactggag, reverse: cttccaggactgcaggcttc.
Transfection and Transactivation Assays
Cells were transfected by electroporation as previously described [25]. Cells were stimulated with TPO or SCF in the presence or absence of inhibitors (as indicated) for 6 hours and harvested. Cell extracts were collected and luciferase expression was measured according to the manufacturers protocol (Promega). ß-galactosidase expression was measured to correct for differences in transfection efficiency.
Preparation of Nuclear Extracts and Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared as described previously, according to the rapid Dignam method [37].Adouble-stranded synthetic oligonucleotide comprising the STAT5-binding domain from the ß-casein promoter (5'-AgATTTCTAg-gAATTCAAATCCCCCT-3') was used for electrophoretic mobility shift assay (EMSA) as previously described [25].
Western Blotting
Cell lysates were prepared as previously described [25], and sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting were performed according to standard procedures. Detection was performed according to manufacturers guidelines (ECL, Amersham, Buckinghamshire, U.K.).
 |
RESULTS
|
|---|
Costimulation with SCF Enhances Proliferation and p21waf mRNA Expression in MO7e Cells
Previous studies have established that primary human and murine progenitors respond to SCF and TPO in a synergistic manner in in vitro cultures [4, 1012]. To investigate the effects of SCF on megakaryocytic STAT5 signaling, we chose the human megakaryocytic MO7e cell line as a model, because this cell line is dependent on cytokines for cell survival and proliferation [35]. As shown in Figure 1A
, MO7e cells had a high rate of proliferation when cultured in the presence of TPO but proliferated poorly in the presence of SCF alone. When the cells were cultured in the presence of both SCF and TPO, the proliferation of MO7e cells was 1.5 ± 0.2-fold further enhanced compared with TPO-stimulated cells.

View larger version (13K):
[in this window]
[in a new window]
|
Figure 1. SCF enhances TPO-mediated proliferation and p21waf1 expression in MO7e cells. (A): Cell proliferation was assessed with the [3H]-thymidine incorporation assay and is expressed as mean disintegrations per second (d.p.s.). Cytokines were added at 20 ng/ml each. Shown is a representative experiment of two independent experiments performed in triplicate ± SE. (B): MO7e cells were deprived of cytokine and were left unstimulated or were stimulated with TPO or SCF (20 ng/ml each) for 1 hour or were stimulated with SCF for 30 minutes followed by TPO for 1 hour (SCF + TPO). Total RNA was isolated and reverse transcribed, and cDNA was used in a polymerase chain reaction using specific primers for p21waf1 or GAPDH as control. Shown are the mean values of three independent experiments ± SE. Abbreviations: SCF, stem cell factor; SE, standard error; TPO, thrombopoietin.
|
|
With respect to the expression of the STAT5-responsive gene p21waf, TPO stimulated p21waf mRNA expression 7.2-fold and was further enhanced 2.2 ± 0.65-fold when prestimulated with SCF. SCF stimulation alone did not induce p21waf induction (Fig. 1B
). These data indicate that MO7e cells, like primary megakaryocyte progenitors in vitro, are sensitive to SCF and TPO in a synergistic manner.
SCF Enhances TPO-Mediated STAT5 Transactivation
To examine whether SCF and TPO contribute to STAT5 transactivation, MO7e cells were transfected with a reporter plasmid containing STAT5-binding sites. TPO (20 ng/ml) stimulation resulted in a 3.4 ± 0.4-fold (p < .01) increase in STAT5 transactivation, which could be further enhanced (1.6 ± 0.2-fold; p < .001; n = 3) by prestimulation with SCF (20 ng/ml), whereas SCF stimulation alone barely increased STAT5 transactivation (Fig. 2
). To exclude the possibility that cells have been stimulated with suboptimal cytokine concentrations, MO7e cells were subsequently stimulated with higher cytokine concentrations (100 ng/ml). As shown in Figure 2
, stimulation with 100 ng/ml TPO resulted in similar STAT5 transactivation as stimulation with 20 ng/ml TPO. Furthermore, TPO-mediated STAT5 transactivation was similarly enhanced by both 20 and 100 ng/ml SCF, demonstrating that the synergistic effect was not attributable to suboptimal cytokine stimulation.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 2. Synergistic effect of SCF on TPO-mediated STAT5 transactivation. MO7e cells were transiently transfected with STAT5-luciferase reporter and cytokine deprived for 16 hours. Cells were left unstimulated or were stimulated with TPO or SCF for 6 hours or were prestimulated with SCF for 30 minutes followed by TPO stimulation for 6 hours (SCF + TPO). Cytokines were added at concentrations of 20 or 100 ng/ml as indicated. Luciferase activities were corrected for ß-galactosidase activities and normalized against unstimulated cells. Mean values of three independent experiments are presented ± standard error. Abbreviations: SCF, stem cell factor; TPO, thrombopoietin.
|
|
SCF Enhances TPO-Mediated STAT5 DNA Binding
To see whether increased STAT5 transactivation was also reflected by increased STAT5 DNA binding, EMSAs were performed using a radiolabeled probe containing the STAT5-binding domain from the ß-casein promoter. As shown in Figure 3
, MO7e cells demonstrated TPO-mediated STAT5 DNA binding, whereas SCF alone did not induce detectable DNA binding. When cells were prestimulated with SCF, STAT5 DNA binding was 1.5-fold enhanced compared with TPO stimulation alone, demonstrating that the increased STAT5 transactivation correlates with the enhancement of STAT5 DNA binding.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3. SCF enhances TPO-mediated STAT5 DNA binding. MO7e cells were stimulated with TPO or SCF for the indicated time periods or were prestimulated with SCF for 30 minutes followed by TPO stimulation (SCF + TPO). Subsequently, nuclear extracts were prepared and subjected to EMSA analysis using a 32P-labeled double-stranded synthetic oligonucleotide comprising the STAT5-binding domain from the ß-casein promoter. A representative autoradiogram of two independent experiments is shown. Abbreviations: EMSA, electrophoretic mobility shift assay; SCF, stem cell factor; TPO, thrombopoietin.
|
|
Costimulation with SCF Increases STAT5 Tyrosine, Not Serine, Phosphorylation
Two isoforms of STAT5 have been identified; STAT5A and STAT5B, which share 90% homology and are rapidly phosphorylated on tyrosine residues 684 (STAT5A) and 699 (STAT5B) in the transactivation domain in response to TPO [15,16]. To examine whether SCF treatment affected STAT5 transactivation at the level of tyrosine phosphorylation, Western blots were performed using an antibody specifically recognizing tyrosine-phosphorylated STAT5. TPO stimulation resulted in a strong and sustained STAT5 tyrosine phosphorylation, with maximal phosphorylation after 1530 minutes (Fig. 4A
). SCF stimulation, on the other hand, resulted in STAT5 tyrosine phosphorylation that was 10-fold less than observed for TPO-stimulated cells. However, when cells were costimulated with both SCF and TPO, STAT5 tyrosine phosphorylation was enhanced and prolonged compared with stimulation with TPO alone. Pre-stimulation with SCF resulted in a 20.5 ± 2.9% increase in tyrosine phosphorylation at 10 minutes, a 35.1 ± 12.9% increase at 30 minutes, and a 50.2 ± 15.5% increase after 1 hour compared with stimulation with TPO alone (p < .01, p = .02, and p < .01, respectively; n = 4). Costimulation with SCF did not affect STAT5 protein levels (Fig. 4A
).

View larger version (42K):
[in this window]
[in a new window]
|
Figure 4. SCF increases TPO-mediated STAT5 tyrosine, not serine, phosphorylation. (A): MO7e cells were stimulated with TPO or SCF for the indicated periods or were stimulated with SCF for 30 minutes followed by TPO stimulation (SCF + TPO). Subsequently, total cell lysates were analyzed by Western blotting using antibodies against phosphotyrosine-Y694/699 STAT5 ( -P-Y-STAT5, 694/699), phosphoserine-S726/731 ( -P-STAT5, 726/731), phosphoserine-S780 ( -P-S-STAT5, 780), or total STAT5 ( STAT5). Representative Western blots from three independent experiments are shown. (B): MO7e cells were transfected with control vector (pcDNA3) or expressing vector for the indicated wt or mutant STAT5A/STAT5B proteins. Cells were left unstimulated or were stimulated with TPO or SCF or were prestimulated with SCF for 30 minutes followed by TPO stimulation (SCF + TPO) for 6 hours. Luciferase activities were corrected for ß-galactosidase activities and normalized against unstimulated cells. The mean values ± standard error of a representative experiment of three independent experiments are presented. Abbreviations: SCF, stem cell factor; TPO, thrombopoietin; wt, wild type.
|
|
It has been shown that the transactivation domain can also be phosphorylated on serine residues 726/731(STAT5A/B) and 780 (STAT5A) [3840]. Serine phosphorylation of STAT5 has been shown to influence STAT DNA binding and transactivation in some cell types. Therefore, STAT5 serine phosphorylation in MO7e cells was examined using antibodies specifically recognizing phosphoserine-726/731 in STAT5A/B and serine-780 in STAT5A. As depicted in Figure 4A
, STAT5 was constitutively phosphorylated on serine-726/731 and serine-780 and was not modulated by stimulation with TPO or SCF. To study the role of serine phosphorylation on the transactivational activity of STAT5, MO7e cells were cotransfected with a STAT5 reporter and expression plasmids encoding wild-type or serine mutant STAT5 proteins. As depicted in Figure 4B
, overexpression of wild-type STAT5A or STAT5B significantly increased basal reporter activation; unstimulated cells showed a 5.3 ± 0.7-fold increase in STAT5 transactivation when cotransfected with an expression vector for wild-type STAT5A and a 14.9 ± 0.9-fold increase when cotransfected with a vector for wild-type STAT5B. When MO7e cells were cotransfected with expression vectors for STAT5A and STAT5B that were mutated on serine-726 (STAT5A) and serine-731 (STAT5B), basal STAT5 transactivation was significantly further increased (3.5 ± 0.5-fold and 2.3 ± 0.2-fold, respectively), indicating that phosphorylation of serine-726 in STAT5A and serine-731 in STAT5B might be involved in downregulating STAT5 transactivation. Overexpression of STAT5A that was mutated on serine-780, on the other hand, did not increase the basal STAT5 transactivation compared with overexpression of wild-type STAT5A, suggesting that phosphorylation of serine-780 has no inhibitory role in STAT5 transactivation. Because of the already high basal levels of transactivation in cells overexpressing wild-type or serine-mutated STAT5, stimulation with SCF or TPO did enhance STAT5 transactivation levels, but the increase was not significant. As expected, overexpression of mutants lacking the tyrosine phosphorylation site (tyrosine-694 in STAT5A [Y694F] and tyrosine-699 in STAT5B [Y699F]) abrogated STAT5 transactivation. Together these data demonstrate that serine-726/731 phosphorylation of STAT5 was associated with an inhibitory effect on STAT5 transactivation.
Enhanced STAT5 Tyrosine Phosphorylation by SCF Costimulation in Primary Human Megakaryocyte Progenitors
To investigate whether other megakaryocytic cells also showed synergistic STAT5 activation upon SCF costimulation, we analyzed human megakaryocyte progenitors for tyrosine phosphorylation of STAT5. CD34+ cells were cultured for 8 days to induce expansion and differentiation to CD61-expressing megakaryocytic cells. TPO stimulation induced transient STAT5 phosphorylation in CD61+ primary cells, whereas SCF stimulation alone did not induce a detectable response (Fig. 5A
). Comparable with MO7e cells, prestimulation with SCF enhanced and prolonged TPO-induced STAT5 tyrosine phosphorylation in CD61+ megakaryocyte progenitors (Fig. 5B
). These results indicate that in primary megakaryocyte progenitors and MO7e cells, TPO signaling can be enhanced by prestimulation with SCF.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 5. STAT5 tyrosine phosphorylation in primary megakaryocytes. (A): CD34+ cells were cultured in serum-free medium with TPO and SCF. Primary human CD61+ cells were isolated from day-8 cultures by flow cytometry and were cytokine deprived for 4 hours. Cells were left unstimulated (lanes 0) or were stimulated with TPO or SCF for the indicated periods or were prestimulated with SCF for 30 minutes followed by TPO stimulation (SCF + TPO). Total cell lysates were analyzed by Western blotting using antibodies against phosphotyrosine-Y694/699 STAT5 ( -P-Y-STAT5) or ERK1/2 to check for equal loading. The results of two independent experiments are presented. (B): STAT5 phosphotyrosine-Y694/699 levels were quantified by densitometry. Results represent the mean increase ± standard error of the mean of three independent experiments for CD61+ primary progenitors and four independent experiments for MO7e cells. Abbreviations: SCF, stem cell factor; TPO, thrombopoietin.
|
|
A Role for Tyrosine Kinases c-kit, JAK2, and Src in the Enhancement of STAT5 Transactivation by SCF
To understand the mechanisms involved in enhanced STAT5 activity, we analyzed signal transduction pathways that might synergize with TPO-mediated STAT5 signaling. Because JAK2, Src, PKA, ERK, and PI3K activity can be activated downstream from c-kit and have previously been implicated in regulation of STAT5 function, we investigated the role of these kinases using specific pharmacological inhibitors.
As demonstrated in Figure 6
, treatment with tyrosine kinase inhibitor AG1296 did not affect TPO-mediated STAT5 transactivation, but the synergistic effect induced by SCF was completely inhibited, indicating that the tyrosine kinase activity of c-kit is essential for the costimulatory effect of SCF in TPO-mediated STAT5 transactivation. The JAK2 inhibitor AG490, on the other hand, completely inhibited STAT5 transactivation mediated by TPO as well as TPO plus SCF, demonstrating an absolute requirement of JAK2 activity for STAT5 transactivation. In the presence of the Src kinase inhibitor SU6656, TPO-induced STAT5 transactivation was not affected. However, the synergistic effect of SCF costimulation was partly reduced from 1.50 ± 0.08-fold to 1.28 ± 0.07-fold (n = 4; p = .04) in the presence of SU6656. As further demonstrated in Figure 6
, TPO-mediated STAT5 transactivation was not inhibited by the PKA inhibitor H89, the MEK/Erk pathway inhibitor U0126, or the PI3-kinase inhibitor LY294002, whereas phosphorylation of the respective targets CREB, Erk1/2, and PKB was efficiently inhibited (not shown). In addition, inhibition of these signaling pathways did not block the synergistic effect of SCF on TPO-mediated STAT5 transactivation. Taken together, these data demonstrate a role for Src, JAK2, and c-kit tyrosine kinase activities in the SCF-induced increase of TPO-mediated STAT5 transactivation, whereas the PKA, ERK, and PI3K signaling pathways were not involved in the costimulatory effect of SCF.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6. c-Kit, JAK2, and Src kinases play a role in the costimulatory effect of SCF on STAT5 transactivation. MO7e cells were transiently transfected with STAT5-luciferase reporter and cytokine deprived for 16 hours. Cells were pretreated with medium (control) or inhibitor AG1296 (20 µM), AG490 (100 µM), SU6656 (0.5 µM), H89 (30 µM), U0126 (10 µM), or LY294002 (10 µM). Subsequently, cells were left unstimulated or were pretreated with SCF (30 minutes; SCF + TPO samples) followed by stimulation with TPO or SCF for 6 hours as indicated. Luciferase activities were corrected for ß-galactosidase activities and normalized against unstimulated cells. The mean values and standard error of two independent experiments performed in triplicate are shown. Abbreviations: SCF, stem cell factor; TPO, thrombopoietin.
|
|
Prolonged c-mpl and JAK2 Phosphorylation by SCF Costimulation
The enhancement of STAT5 transactivation by SCF was dependent on the tyrosine kinase activity of c-kit, because the AG1296 inhibitor completely blocked the additional SCF-mediated increase in STAT5 transactivation. Because c-kit has been shown to associate with other receptors upon SCF stimulation, resulting in receptor complexes with altered signaling properties [2123], we investigated whether the c-kit and c-mpl receptors interacted and whether the level of phosphorylation was altered during cytokine stimulation. C-Kit and c-mpl were immunoprecipitated and analyzed for tyrosine phosphorylation (Figs. 7A, 7B
). Stimulation with SCF alone induced a strong, transient phosphorylation of the c-kit receptor. Preincubation with SCF for 30 minutes followed by TPO stimulation did not affect phosphorylation of the c-kit receptor (Fig. 7A
). In contrast, SCF costimulation enhanced TPO-induced phosphorylation of c-mpl (Fig. 7B
). It has been shown that the c-kit and Epo receptors physically interact [21]; however, we were unable to detect proteinprotein association between c-kit and c-mpl in immunoprecipitates using reciprocal antibodies (not shown). The results indicate an enhanced activation at the c-mpl receptor level, and therefore we analyzed phosphorylation of JAK2, because JAK2 activation has been shown to be essential for STAT5 signaling. Activation of JAK2 in cell lysates was detected by immunoblotting using phosphospecific-JAK2 antibodies (Fig. 7C
). Stimulation with TPO induced phosphorylation of JAK2, whereas SCF-induced JAK2 phosphorylation was not detectable. Furthermore, as demonstrated in Figure 7C
, costimulation with SCF enhanced and prolonged TPO-induced JAK2 activation. From these data, we conclude that c-kit enhances TPO-mediated c-mpl and STAT5 phosphorylation by increasing JAK2 phosphorylation.
A Role for Src Kinase in STAT5 Tyrosine Phosphorylation in MO7e and Primary Human Megakaryocytic Cells
The enhancement of STAT5 transactivation by SCF was partly blocked by the inhibitor SU6656, indicating a role for Src kinases in megakaryocytic STAT5 activation. In MO7e cells, SCF has been reported to mainly activate Lyn kinase, whereas in primary megakaryocytes, Fyn and Lyn are the major Src family kinases regulated by TPO [41,42]. The Src family selective inhibitor SU6656 was used in the present studies, because the commonly used Src inhibitors PP1 and PP2, but not SU6656, have recently been shown to be potent inhibitors of c-kit tyrosine kinase activity [43] (and our unpublished observations). The SU6656 IC50 concentrations for Fyn and Lyn are 170 and 130 nM, respectively; whereas inhibition of other tyrosine kinases was in the micromolar range [44].
In MO7e cells, the transient STAT5 tyrosine phosphorylation induced on SCF stimulation alone was completely inhibited in the presence of the Src kinase inhibitor SU6656 at 500 nM (Fig. 8A
). This effect was specific for STAT5 activation, because phosphorylation of the mitogen-activated protein kinase/Erk pathway by SCF was not blocked by SU6656 (Fig. 8A
, middle panel). Furthermore, STAT5 phosphorylation was blocked by AG490, demonstrating a role for Src and JAK2 in SCF-induced STAT5 tyrosine phosphorylation. TPO-induced STAT5 phosphorylation, on the other hand, was to a large extent resistant to inhibition by SU6656, as depicted in Figure 8A
(right panel) and Figure 8B
. We consistently observed that SU6656 partially inhibited tyrosine phosphorylation of STAT5 at the initial stage of TPO stimulation (10 minutes) in MO7e cells but not at later time points (compare lanes marked control with SU in Fig. 8B
). This indicates a role for Src kinase during the initial activation of STAT5 by TPO but not for sustained STAT5 phosphorylation. In contrast, the costimulatory effect of SCF on TPO-induced STAT5 tyrosine phosphorylation was downregulated by SU6656 during initial and prolonged TPO stimulation (compare lanes marked SCF with SU + SCF in Fig. 8B
). These results indicate that the synergistic effect induced by SCF on STAT5 phosphorylation is mediated in part by Src kinase activation.

View larger version (45K):
[in this window]
[in a new window]
|
Figure 8. A role for Src kinase in STAT5 tyrosine phosphorylation in MO7e and primary megakaryocytic cells. (A): MO7e cells were cytokine deprived for 16 hours and pretreated with AG490 (100 µM) or SU6656 (0.5 µM) as indicated. Cells were stimulated for 10 minutes with SCF (left) or TPO (right). Total cell lysates were subjected to Western blotting using antibodies against phosphotyrosine-Y694/699 STAT5A/B ( P-STAT5), phosphorylated Erk1/2, and total STAT5. The result of SCF-stimulated P-STAT5 (left panel) was obtained after longer exposure compared with TPO-stimulated P-STAT5 (right panel). Lanes marked 0 indicate unstimulated cells. (B, C): Cytokine-deprived MO7e cells were not pretreated (control lanes), treated for 30 minutes with SU6656 (SU lanes) or SCF, or treated with SU6656 for 30 minutes followed by 30 minutes with SCF (SU + SCF lanes). Subsequently, cells were stimulated with TPO for the time points indicated. Whole-cell lysates were subjected to Western blotting and analyzed using antibodies against phosphotyrosine-Y694/699 STAT5A/B ( P-STAT5), phosphospecific JAK2 antibody ( P-Jak2), and total STAT5. (D): Purified human CD61+ cells were not pretreated (control lane), treated for 30 minutes with SU6656 (SU lanes) or SCF, or treated for 30 minutes with SU6656 followed by 30 minutes with SCF (SU + SCF lanes). Subsequently, cells were stimulated with TPO for the time points indicated. Whole-cell lysates were subjected to Western blotting and analyzed using antibodies against phosphotyrosine-Y694/699 STAT5A/B ( P-STAT5) and total STAT5. (A, B, C): A representative blot from three independent experiments is shown for MO7e cells. (D): The result of one experiment is shown for purified primary human CD61+ cells. Abbreviations: SCF, stem cell factor; TPO, thrombopoietin.
|
|
In Figure 8C
, we examined the effect of SU6656 on JAK2 tyrosine phosphorylation. TPO-mediated JAK2 phosphorylation in the presence or absence of SCF costimulation was not inhibited by SU6656. Because STAT5A Tyr 695 has been reported to be a Src phosphorylation site [45] and SU6656 does not inhibit JAK2 phosphorylation, this suggests that Src directly phosphorylates STAT5 on its activation site.
Finally, we investigated whether Src kinase plays a role in STAT5 activation in primary human megakaryocytic cells. In CD61+-isolated cells we observed partial inhibition of TPO-induced STAT5 tyrosine phosphorylation in the presence of SU6656 at the initial stage of TPO stimulation (10 minutes) but not after prolonged stimulation (compare lanes marked control with SU in Fig. 8D
). The costimulatory effect of SCF on TPO-induced STAT5 phosphorylation was inhibited by SU6656 at both early and later time points (compare lanes marked SCF with SU + SCF in Fig. 8D
). Therefore, we can conclude that in primary megakaryocyte progenitors, similar to MO7e cells, Src kinase plays a role in the initial activation of STAT5 phosphorylation induced by TPO and that Src kinase is required for the synergistic action between SCF and TPO signaling.
 |
DISCUSSION
|
|---|
Progenitor cells and their maturing progeny coexpress receptors for multiple cytokines, which can act in synergy when certain combinations of growth factors are used. The present study demonstrates that SCF synergizes with TPO signaling in enhancing the STAT5 response in megakaryocyte progenitors. Regulation of the cellular response is strongly dependent on the sequence of events in which growth factors or additional factors are presented to the cell. This has especially been demonstrated for granulocytes, in which priming by GM-CSF results in a more pronounced effect [46]. Similarly, prostaglandins might affect the Epo response in erythroid progenitors [47]. In this line, we studied the effects of SCF in conjunction with Epo signaling [25] and in the present study with TPO signaling. TPO is a potent stimulator of STAT5 tyrosine phosphorylation and transactivation, whereas SCF stimulation alone induces a transient phosphorylation in MO7e cells that does not result in STAT5 transactivation. In primary cells, SCF stimulation alone did not activate STAT5. The difference might be caused by aberrant c-kit signaling in the MO7e cells or be attributable to technical limitations, because detection of SCF-induced STAT5 tyrosine phosphorylation required prolonged exposure times. In primary megakaryocytic progenitors as well as megakaryoblastic MO7e cells, prestimulation with SCF increased and prolonged TPO-induced STAT5 tyrosine phosphorylation. This increase in phosphorylation was reflected in enhanced STAT5 DNA-binding and STAT5 transactivation. In addition, the STAT5A/B serine-726/731 and -780 phosphorylation sites were found to be constitutively phosphorylated in MO7e cells, and a negative regulatory effect on STAT5 transactivation by serine-726/731 phosphorylation was observed. Regulation of the STAT5 transcriptional response by serine phosphorylation has been reported for nonhematopoietic cell types [3840]. We have recently demonstrated that the serine-726/731 sites of STAT5A/B in erythroid cells were involved in down-regulating Epo-induced STAT5 transactivation [47]. In the mammary gland, STAT5A serine-726 and -780 phosphorylation sites were shown to inhibit the prolactin-stimulated transcriptional response in the absence of glucocorticoid receptor costimulation [39].
The enhancement of STAT5 transactivation by SCF was fully dependent on the tyrosine kinase activity of c-kit. c-Kit has been shown to associate with other receptors upon SCF stimulation, and Epo-R is increasingly phosphorylated upon association with activated c-kit [2123]. An increased c-mpl phosphorylation was observed upon SCF costimulation, but no association between the c-kit and c-mpl receptors was detected. Instead, SCF costimulation resulted in enhanced JAK2 phosphorylation, which could mediate the increase in c-mpl phosphorylation. Alternatively, c-kit might affect STAT5 transactivation by inhibition of proteins that negatively regulate the JAK/STAT pathway, including the protein inhibitors of activated STATs, the suppressors of cytokine signaling, and the SH2-containing phosphatases [48]. Reactive oxygen species formation induced by cytokines, including SCF and TPO, inactivates protein tyrosine phosphatases that are highly sensitive to oxidation [49]. However, in the presence of the antioxidant N-acetyl-cysteine, we still observed upregulation of STAT5 tyrosine phosphorylation by SCF (unpublished observations), suggesting that down-regulation of phosphatase activity is not the main cause for the enhanced tyrosine phosphorylation level.
Although the PI3K-, PKA-, and ERK-signaling pathways have been implicated in the regulation of STAT5 signaling in a variety of cell types, these pathways were not involved in the synergy between SCF and TPO in megakaryocytic cells. Recently we have found that SCF also modulates STAT5 transactivation in erythroid cells [25]. However, the underlying molecular mechanism differs from the synergistic cooperation described in the present study. In erythroid cells, SCF enhances Epo-mediated STAT5 transactivation without affecting STAT5 tyrosine phosphorylation or STAT5 DNA binding. Instead, erythroid STAT5 transactivation is increased by PKA-mediated CREB phosphorylation. Although cytokine-mediated CREB phosphorylation could be downregulated by specific inhibitors in MO7e cells, we did not observe an effect on STAT5 transactivation. Possible lineage-specific differences underlie the differential effects of SCF in synergy with Epo or TPO in erythroid and megakaryocytic cells, respectively.
Kinetic analysis of cell lysates using the specific Src inhibitor SU6656 revealed a role for Src kinases in megakaryocytic STAT5 tyrosine phosphorylation and transactivation. SU6656 inhibited the initial stage of TPO-mediated STAT5 tyrosine phosphorylation but not the sustained STAT5 phosphorylation, which is linked to transcriptional activity. Indeed, inhibition of Src kinase increases STAT5 tyrosine phosphorylation at later time points in MO7e cells and CD61+ cells. Recently it was reported that inhibition of Src kinases increased Erk activation at later time points in BaF3/Mpl cells [50]. In contrast, the synergistic effect of SCF on early and sustained TPO-induced STAT5 tyrosine phosphorylation was inhibited by SU6656, resulting in downregulation of the STAT5 transcriptional response. Although there is always concern of nonspecific inhibition using chemical inhibitors, the SU6656 compound is highly specific for Src family kinases [44] and does not inhibit c-kit or JAK2 activity. Because tyrosine-694 is a known substrate for phosphorylation by Src kinase [45,51], it is likely that Src kinase is directly responsible for phosphorylation of STAT5 in our studies.
In the present study, we have investigated the synergistic effect of two cytokines important for megakaryopoiesis at the molecular level. Our results demonstrate that costimulation with SCF enhances TPO-induced STAT5 signaling in megakaryocyte progenitors. This synergistic response is mediated by JAK2 and Src kinases, which lead to an enhanced and prolonged STAT5 tyrosine phosphorylation and an increase in STAT5-dependent transactivation. Identifying signaling pathways involved in the synergistic activation by multiple cytokines and determining their functions during self-renewal, proliferation, apoptosis, and differentiation should help our understanding and provide means to control cell fate.
 |
ACKNOWLEDGMENTS
|
|---|
We appreciate the gifts of reagents provided by Drs. I. Beuvink (Friedrich Miescher Institute), H. Rui (Georgetown University), I. Matsumura (Osaka Medical School), and Kirin (Kirin Brewery).
 |
REFERENCES
|
|---|
- Broudy VC. Stem cell factor and hematopoiesis. Blood 1997;90:13451364.[Free Full Text]
- Solar GP, Kerr WG, Zeigler FC et al. Role of c-mpl in early hematopoiesis. Blood 1998;92:410.[Abstract/Free Full Text]
- Sitnicka E, Lin N, Priestley GV et al. The effect of thrombopoietin on the proliferation and differentiation of murine hematopoietic stem cells. Blood 1996;87:49985005.[Abstract/Free Full Text]
- Ramsfjell V, Borge OJ, Veiby OP et al. Thrombopoietin, but not erythropoietin, directly stimulates multilineage growth of primitive murine bone marrow progenitor cells in synergy with early acting cytokines: distinct interactions with the ligands for c-kit and FLT3. Blood 1996;88:44814492.[Abstract/Free Full Text]
- Chui DHK, Liao SK, Walker K. Fetal erythropoiesis in steel mutant mice, 3: defect in differentiation from Bfu-e to Cfu-e during early development. Blood 1978;51:539547.[Abstract/Free Full Text]
- de Sauvage FJ, Hass PE, Spencer SD et al. Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature 1994;369:533538.[CrossRef][Medline]
- Lok S, Kaushansky K, Holly RD et al. Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature 1994;369:565568.[CrossRef][Medline]
- Wendling F, Maraskovsky E, Debili N et al. cMpl ligand is a humoral regulator of megakaryocytopoiesis. Nature 1994;369:571574.[CrossRef][Medline]
- Kaushansky K, Lok S, Holly RD et al. Promotion of megakaryocyte progenitor expansion and differentiation by the c-Mpl ligand thrombopoietin. Nature 1994;369:568571.[CrossRef][Medline]
- Broudy VC, Lin NL, Kaushansky K. Thrombopoietin (c-mpl ligand) acts synergistically with erythropoietin, stem cell factor, and interleukin-11 to enhance murine megakaryocyte colony growth and increases megakaryocyte ploidy in vitro. Blood 1995;85:17191726.[Abstract/Free Full Text]
- Williams JL, Pipia GG, Datta NS et al. Thrombopoietin requires additional megakaryocyte-active cytokines for optimal ex vivo expansion of megakaryocyte precursor cells. Blood 1998;91:41184126.[Abstract/Free Full Text]
- Bertolini F, Battaglia M, Pedrazzoli P et al. Megakaryocytic progenitors can be generated ex vivo and safely administered to autologous peripheral blood progenitor cell transplant recipients. Blood 1997;89:26792688.[Abstract/Free Full Text]
- Drachman JG, Millett KM, Kaushansky K. Thrombopoietin signal transduction requires functional JAK2, not TYK2. J Biol Chem 1999;274:1348013484.[Abstract/Free Full Text]
- Sattler M, Durstin MA, Frank DA et al. The thrombopoietin receptor C-Mpl activates Jak2 and Tyk2 tyrosine kinases. Exp Hematol 1995;23:10401048.[Medline]
- Bacon CM, Tortolani PJ, Shimosaka A et al. Thrombopoietin (Tpo) induces tyrosine phosphorylation and activation of Stat5 and Stat3. FEBS Lett 1995;370:6368.[CrossRef][Medline]
- Miyakawa Y, Oda A, Druker BJ et al. Thrombopoietin induces tyrosine phosphorylation of Stat3 and Stat5 in human blood platelets. Blood 1996;87:439446.[Abstract/Free Full Text]
- Geddis AE, Fox NE, Kaushansky K. Phosphatidylinositol 3-kinase is necessary but not sufficient for thrombopoietin-induced proliferation in engineered Mpl-bearing cell lines as well as in primary megakaryocytic progenitors. J Biol Chem 2001;276:3447334479.[Abstract/Free Full Text]
- Rojnuckarin P, Drachman JG, Kaushansky K. Thrombopoietin-induced activation of the mitogen-activated protein kinase (MAPK) pathway in normal megakaryocytes: role in endomitosis. Blood 1999;94:12731282.[Abstract/Free Full Text]
- Linnekin D. Early signaling pathways activated by c-Kit in hematopoietic cells. Int J Biochem Cell Biol 1999;31:10531074.[CrossRef][Medline]
- Tan BL, Hong L, Munugalavadla V et al. Functional and biochemical consequences of abrogating the activation of multiple diverse early signaling pathways in Kit: role for Src kinase pathway in Kit-induced cooperation with erythropoietin receptor. J Biol Chem 2003;278:1168611695.[Abstract/Free Full Text]
- Wu H, Klingmuller U, Besmer P, Lodish HF. Interaction of the erythropoietin and stem-cell-factor receptors. Nature 1995;377:242246.[CrossRef][Medline]
- Wu H, Klingmuller U, Acurio A et al. Functional interaction of erythropoietin and stem cell factor receptors is essential for erythroid colony formation. Proc Natl Acad Sci U S A 1997;94:18061810.[Abstract/Free Full Text]
- JacobsHelber SM, Penta K, Sun ZH et al. Distinct signaling from stem cell factor and erythropoietin in HCD57 cells. J Biol Chem 1997;272:68506853.[Abstract/Free Full Text]
- Kapur R, Zhang L. A novel mechanism of cooperation between c-Kit and erythropoietin receptor: stem cell factor induces the expression of Stat5 and erythropoietin receptor, resulting in efficient proliferation and survival by erythropoietin. J Biol Chem 2001;276:10991106.[Abstract/Free Full Text]
- Boer AK, Drayer AL, Vellenga E. Stem cell factor enhances erythropoietin-mediated transactivation of signal transducer and activator of transcription 5 (STAT5) via the PKA/CREB pathway. Exp Hematol 2003;31:512520.[CrossRef][Medline]
- Socolovsky M, Nam H, Fleming MD et al. Ineffective erythropoiesis in Stat5a/ 5b/ mice due to decreased survival of early erythroblasts. Blood 2001;98:32613273.[Abstract/Free Full Text]
- Snow JW, Abraham N, Ma MC et al. STAT5 promotes multilineage hematolymphoid development in vivo through effects on early hematopoietic progenitor cells. Blood 2002;99:95101.[Abstract/Free Full Text]
- Bunting KD, Bradley HL, Hawley TS et al. Reduced lymphomyeloid repopulating activity from adult bone marrow and fetal liver of mice lacking expression of STAT5. Blood 2002;99:479487.[Abstract/Free Full Text]
- Majka M, Ratajczak J, Villaire G et al. Thrombopoietin, but not cytokines binding to gp 130 protein-coupled receptors, activates MAPKp42/44, AKT, and STAT proteins in normal human CD34+ cells, megakaryocytes, and platelets. Exp Hematol 2002;30:751760.[CrossRef][Medline]
- Ihle JN, Nosaka T, Thierfelder W et al. Jaks and Stats in cytokine signaling. STEM CELLS 1997;1 (suppl15):105111.
- Nosaka T, Kawashima T, Misawa K et al. STAT5 as a molecular regulator of proliferation, differentiation and apoptosis in hematopoietic cells. EMBO J 1999;18:47544765.[CrossRef][Medline]
- Socolovsky M, Fallon AE, Wang S, Brugnara C, Lodish HF. Fetal anemia and apoptosis of red cell progenitors in Stat5a/5b/ mice: a direct role for Stat5 in Bcl-X(L) induction. Cell 1999;98:181191.[CrossRef][Medline]
- Kirito K, Watanabe T, Sawada K et al. Thrombopoietin regulates Bcl-xL gene expression through Stat5 and phosphatidylinositol 3-kinase activation pathways. J Biol Chem 2002;277:83298337.[Abstract/Free Full Text]
- Matsumura I, Ishikawa J, Nakajima K et al. Thrombopoietin-induced differentiation of a human megakaryoblastic leukemia cell line, CMK, involves transcriptional activation of p21(WAF1/Cip1) by STAT5. Mol Cell Biol 1997;17:29332943.[Abstract]
- Avanzi GC, Brizzi MF, Giannotti J et al. M-07e human leukemic factor-dependent cell line provides a rapid and sensitive bioassay for the human cytokines GM-CSF and IL-3. J Cell Physiol 1990;145:458464.[CrossRef][Medline]
- Boer AK, Drayer AL, Vellenga E. Effects of overexpression of the SH2-containing inositol phosphatase SHIP on proliferation and apoptosis of erythroid AS-E2 cells. Leukemia 2001;15:17501757.[Medline]
- Schreiber E, Matthias P, Muller MM et al. Rapid detection of octamer binding-proteins with mini-extracts, prepared from a small number of cells. Nucleic Acids Res 1989;17:6419.[Free Full Text]
- Yamashita H, Xu J, Erwin RA et al. Differential control of the phosphorylation state of proline-juxtaposed serine residues Ser725 of Stat5a and Ser730 of Stat5b in prolactin-sensitive cells. J Biol Chem 1998;273:3021830224.[Abstract/Free Full Text]
- Yamashita H, Nevalainen MT, Xu J et al. Role of serine phosphorylation of Stat5a in prolactin-stimulated beta-casein gene expression. Mol Cell Endocrinol 2001;183:151163.[CrossRef][Medline]
- Beuvink I, Hess D, Flotow H et al. Stat5a serine phosphorylation. Serine 779 is constitutively phosphorylated in the mammary gland, and serine 725 phosphorylation influences prolactin-stimulated in vitro DNA binding activity. J Biol Chem 2000;275:102470255.[Abstract/Free Full Text]
- Price DJ, Rivnay B, Avraham H. CHK down-regulates SCF/KL-activated Lyn kinase activity in Mo7e megakaryocytic cells. Biochem Biophys Res Commun 1999;259:611616.[CrossRef][Medline]
- Lannutti BJ, Shim MH, Blake N et al. Identification and activation of Src family kinases in primary megakaryocytes. Exp Hematol 2003;31:12681274.[CrossRef][Medline]
- Tatton L, Morley GM, Chopra R et al. The Src-selective kinase inhibitor PP1 also inhibits Kit and Bcr-Abl tyrosine kinases. J Biol Chem 2003;278:48474853.[Abstract/Free Full Text]
- Blake RA, Broome MA, Liu XD et al. SU6656, a selective Src family kinase inhibitor, used to probe growth factor signaling. Mol Cell Biol 2000;20:90189027.[Abstract/Free Full Text]
- Okutani Y, Kitanaka A, Tanaka T et al. Src directly tyrosine-phosphorylates STAT5 on its activation site and is involved in erythropoietin-induced signaling pathway. Oncogene 2001;20:66436650.[CrossRef][Medline]
- Fuhler GM, Drayer AL, Vellenga E. Decreased phosphorylation of protein kinase B and extracellular signal-regulated kinase in neutrophils from patients with myelodysplasia. Blood 2003;101:11721180.[Abstract/Free Full Text]
- Boer AK, Drayer AL, Rui H et al. Prostaglandin-E2 enhances EPO-mediated STAT5 transcriptional activity by serine phosphorylation of CREB. Blood 2002;100:467473.[Abstract/Free Full Text]
- Wormald S, Hilton DJ. Inhibitors of cytokine signal transduction. J Biol Chem 2004;279:821824.[Abstract/Free Full Text]
- Sattler M, Winkler T, Verma S et al. Hematopoietic growth factors signal through the formation of reactive oxygen species. Blood 1999;93:29282935.[Abstract/Free Full Text]
- Lannutti BJ, Drachmann JG. Lyn tyrosine kinase regulates thrombopoietin-induced proliferation of hematopoietic cell lines and primary megakaryocytic progenitors. Blood 2004;103:37363743.[Abstract/Free Full Text]
- Rane SG, Reddy EP. JAKs, STATs and Src kinases in hematopoiesis. Oncogene 2002;21:33343358.[CrossRef][Medline]
Received July 8, 2004;
accepted for publication October 4, 2004.
This article has been cited by other articles:

|
 |

|
 |
 
V. G. Karur, C. A. Lowell, P. Besmer, V. Agosti, and D. M. Wojchowski
Lyn kinase promotes erythroblast expansion and late-stage development
Blood,
September 1, 2006;
108(5):
1524 - 1532.
[Abstract]
[Full Text]
[PDF]
|
 |
|
