Stem Cells http://www.epitomics.com
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Y.
Right arrow Articles by Deng, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Y.
Right arrow Articles by Deng, H.

Stem Cells 2005;23:656-662 www.StemCells.com
© 2005 AlphaMed Press

Inducing Embryonic Stem Cells to Differentiate into Pancreatic ß Cells by a Novel Three-Step Approach with Activin A and All-Trans Retinoic Acid

Yan Shia, Lingling Houa,b, Fuchou Tanga, Wei Jianga, Peigang Wanga, Mingxiao Dinga, Hongkui Denga

a Department of Cell Biology and Genetics, College of Life Sciences, Peking University, Beijing, China;
b Institute of Biological Science and Technology, College of Science, Beijing Jiaotong University, Beijing, China

Key Words. Embryonic stem cells • Pancreatic ß cells • Differentiation • All-trans retinoic acid • Activin A

Correspondence: Hongkui Deng, Ph.D., Department of Cell Biology and Genetics, College of Life Sciences, Peking University, Beijing, 100871, P. R. China. Telephone: 86-10-6275-6954; Fax: 86-10-6275-6954; e-mail: hongkui_deng{at}pku.edu.cn; and Mingxiao Ding, M.S., Department of Cell Biology and Genetics, College of Life Sciences, Peking University, Beijing, 100871, P. R. China. Telephone: 86-10-6275-6954; Fax: 86-10-6275-6954; e-mail: dingmx01{at}pku.edu.cn


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental induction of embryonic stem cells (ESCs) to become pancreatic ß cells can potentially provide ample resource for cell transplantation therapy of type I diabetes mellitus. Most of the previously reported induction strategies were long and complicated, and some required genetic manipulation. Moreover, it has been indicated that the insulin staining of ESC progeny was insulin uptake from the culture medium. Here we show that a simple three-step experimental approach based on the combination induction by activin A, all-trans retinoic acid, and other mature factors is able to induce murine ESCs to differentiate into insulin-producing cells in 2 weeks, and that insulin release of these induced cells is regulated by the glucose concentration. Our insulin-enhanced green fluorescent green protein reporter system excludes the possibility of insulin uptake. Transplantation of these ESC-derived insulin-positive cells can normalize blood glucose levels and rescue the survival of streptozocin-induced diabetic mice. The findings reported here offer a novel in vitro model to study the differentiation mechanism of pancreatic ß cells and a potential source of insulin-producing cells for transplantation therapy of type I diabetes mellitus.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Diabetes mellitus affects 4%–5% of the world’s population and is the most common metabolic disorder in humans. The number of people with diabetes is predicted to exceed 350 million by 2010. Type I diabetes mellitus results from the autoimmune destruction of the ß cells in pancreatic islets. Many research groups are therefore exploring ways to replace these destroyed insulin-producing cells. Until now, pancreatic islet cell transplantation is the only effective approach to cure type I diabetes instead of insulin injection [1]. However, this therapy is not widely used because of the severe shortage of transplantable donor islets.

One attractive approach is the generation of functional ß cells from embryonic stem cells (ESCs). ESCs have been shown to be able to differentiate into pancreatic islet–like clusters, especially pancreatic ß cells [2 4]. First, Soria et al. [2] successfully induced ESCs to differentiate into pancreatic ß cells by a cell-trapping system. However, this is a complicated process with genetic manipulation. Then Lumelsky et al. [3] designed a five-stage protocol to induce ESCs to differentiate into insulin-producing islet-like structures without genetic modification. Hori et al. [5] and Blyszczuk et al. [6] improved Lumelsky’s five-stage induction protocol by adding growth inhibitor LY294002 or overexpression of the pax4 gene. However, all these induction approaches are somewhat complicated and take a long period of time. Later Hansson et al. [7] used the five-stage induction protocol and found that ESC-derived insulin-positive cells absorbed insulin from the culture medium instead of producing it themselves. Therefore, it is necessary to find the specific induction factors that can induce ESCs to differentiate into pancreatic ß cells more simply and rapidly.

It has been suggested that some factors are able to promote definitive endoderm differentiation. Activin A, a member of the transforming growth factor–beta (TGF-ß) superfamily, is critical for mesoderm and endoderm formation during gastrulation. When used at a high concentration, it primarily induces endoderm formation [8, 9]. All-trans retinoic acid (RA) is a well-characterized signaling molecule that acts in anteroposterior patterning of neuroectoderm and mesoderm in vertebrates [10]. Recent evidence indicates that RA is also involved in the regulation of the embryonic endoderm differentiation pattern, especially the early pancreas bud formation, and it is able to improve insulin expression in pancreatic ß cells and the INS-1 cell line [11, 12]. It has been demonstrated that the combination of activin A and RA was able to induce the Xenopus presumptive ectoderm region of the blastula to differentiate into pancreatic insulin-positive cells [13].

We report here a novel three-step approach based on combination of activin A, RA, and other factors that mature pancreatic ß cells. This three-step protocol can induce ESCs to differentiate into insulin-producing cells within only 2 weeks. These insulin-positive cells express characteristic pancreatic ß-cell marker genes such as insulinI, pdx1, glut2, hnf3ß, and is11. Moreover, we use insulin promoter–enhanced green fluorescent protein (EGFP)–marked ESCs to further demonstrate that this strategy can indeed induce ESCs to differentiate into insulin-producing cells instead of uptaking insulin. Finally, we provide evidence that insulin-producing cells are able to fully rescue the streptozocin (STZ)–induced diabetic mice when they are transplanted under their renal capsules.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ESC Culture and Differentiation Conditions
An ESC line, R1 [14], was cultured in Dulbecco’s modified Eagle medium (DMEM) with 20% fetal bovine serum (FBS) and 1,000 U/ml leukemia inhibitory factor (LIF; all from Gibco-BRL, Rockville, MD, http://www.invitrogen.com). The protocol of ESCs differentiated into ß cells was as follows.

Step 1: To induce embryonic body (EB) formation, ESCs were dissociated with trypsin and suspended into Petri dishes (Alpha Medical Instrument Corp., Qingdao, China) with 10% FBS/DMEM without LIF. After 24–48 hours, EBs were collected and replated into 10% FBS/DMEM without LIF in 1% Matrigel-coated dishes (BD Biosciences, Bedford, MA, http://www.bdbioscience.com). Two hours later, EBs began to spread onto the dishes and were cultured in 10% FBS/DMEM with 100 ng/ml activin A (Sigma Chemical Corp., St. Louis, http://www.sigma-aldrich.com) for 24 hours. Then EBs were switched to 10% FBS/DMEM for 6–8 hours as an interval. After this interval, the differentiated EBs were cultured in 10% FBS/DMEM with 10–6 M RA (Sigma) for another 24 hours.

Step 2: To expand insulin-producing precursors, the differentiated EB cells were cultured in 10% FBS/DMEM with 10 ng/ml basic fibroblast growth factor (bFGF; Sigma) for 3–5 days.

Step 3: To mature the insulin-producing cells, the expanded cells in step 2 were switched to DMEM/F12 with N2 supplement, B27 supplement (all from Gibco-BRL), 1 µg/ml laminin (Sigma), 10 ng/ml bFGF, and 10 mM nicotinamide (Sigma) and cultured for 3–5 days. The morphology of cells was observed under a Nikon phase-contrast microscope (TS-100).

Reverse Transcription Polymerase Chain Reaction (RT-PCR) Analysis of Gene Expression in Differentiated Cells
Total RNA was extracted using the Catrimox-14 kit (Takara Bio, Otsu, Shiga, Japan, http://www.takara-bio.co.jp/english/index.htm) from the cells in step 2 or step 3, which were induced with and without both activin A and RA or with only one of them. Then RNA was reverse-transcribed into cDNA by Moloney murine leukemia virus reverse transcriptase (Promega Corp., Madison, WI, http://promega.com). PCR was performed with Ex Taq polymerase (Takara Bio) in PCR buffer. Cycle conditions were as follows: 94°C for 5 minutes; followed by 35 cycles of 94°C denaturation for 50 seconds, 56°C to 58°C annealing for 30 seconds, and 72°C elongation for 40 seconds; with a final incubation at 72°C for 4 minutes. PCR primers of pdx1, glut2, is11, and ß-actin were designed with Prime Premier 5.0. InsulinI and hnf3ß primers were as cited from [3]. The sequences for the PCR primers (sense and antisense, respectively) are:

insulinI: TAGTGACCAGCTATAATCAGAG and ACGC-CAAGGTCTGAAGGTCC (288 bp)

hnf3ß: ACCTGAGTCCGAGTCTGACC and GGCACCTT-GAGAAAGCAGTC (345 bp)

pdx1: CTTAGCGTGTCGCCACAGCCCTCCA and TCCAA-CAGCCGCCTTTCGTTATTCT (472 bp)

glut2: GGATAAATTCGCCTGGATGA and TTCCTTTG-GTTTCTGGAACT (299 bp)

is11: ATTTGCCACCTAGCCACAGCACC and CGCATTT-GATCCCGTACAACCTG (335 bp)

ß-actin: CCTGAACCCTAAGGCCAACCGTGAA and ATACCCAAGAAGGAAGGCTGGAAAA (480 bp)

hnf4{alpha}: ACACGTCCCCATCTGAAG and CTTCCTTCTTCAT-GCCAG (269 bp)

EGFP Reporter Construction and ESC Transfection
A human-insulin promoter-EGFP vector was constructed. A 0.4-kb XbaI and HindIII fragment containing human-insulin promoter from pFOXCAT-362 hIns (kindly provided by Dr. M.S. German, Hormone Research Institute, University of California, San Francisco) was ligated to the pCMV-EGFPN3 (BD Biosciences) whose cytomegalovirus promoter was removed by AseI-HindIII digestion. This vector with neomycin resistance was transfected into the ESC R1 line by electroporation, and positive ESC clones were selected with 250 µg/ml G418 (Gibco-BRL). Selected cells were induced by the three-step method described above.

Immunohistochemistry Assay
Induced cells in step 3 were fixed in 4% paraformaldehyde and washed three times by phosphate-buffered solution (PBS), then incubated with 10% normal goat serum for 20 minutes at room temperature. Goat serum was removed, and the cells were incubated with primary antibody to insulin (rabbit polyclonal immunoglobulin G [IgG], 1:200; Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.com) or to C-peptide (Linco Research, St.Charles, MO, http://www.lincoresearch.com) overnight at 4 °C, and further incubated with secondary antibody rhodamine-conjugated goat anti-rabbit IgG, fluorescein isothiocyanate–conjugated rabbit anti-goat IgG (1:200; Santa Cruz), or biotin-conjugated IgG (work solution; Santa Cruz). DAB (3,3'-diaminobenzidine) was used as the reaction substrate when biotin-conjugated IgG was the secondary antibody. Images were captured with an Olympus phase contrast microscope (Olympus IX-71).

DTZ (dithizone) stock solution (Merck & Co., Whitehouse Station, NY, http://www.merck.com) was prepared with 50 mg of DTZ in 5 ml of dimethyl sulfoxide. To prepare a DTZ working solution, DTZ stock solution was diluted at 1:100 with PBS. Induced cells were washed with PBS three times and stained with DTZ working solution at 37°C for 30 minutes.

Insulin Release Test by Enzyme-Linked Immunosorbent Assay (ELISA)
To further test whether the insulin release of induced cells was glucose-dependent, two glucose concentrations (5.5 mM and 27.7 mM) were used. The cells were preincubated with Krebs-Ringer buffer containing 2.5 mM glucose at 37°C for 90 minutes. To induce insulin release, the cells were incubated with Krebs-Ringer buffer containing 27.7 mM glucose for 15 minutes at 37°C. The control was incubated with 5.5 mM glucose for 15 minutes. Then the conditioned medium was collected. The two medium samples were tested for insulin release content using the Rat/Mouse Insulin ELISA Kit (Crystal Chem. Inc., Downers Grove, IL, http://www.crystalchem.com). The total cell protein content was tested using the BCA [Bicinchoninic Acid] Protein Assay Kit (Pierce Biotechnology, Rockford, IL, http://www.piercenet.com).

Transplantation of Insulin-Producing Cells Under Renal Subcapsule
The Institutional Animal Care and Use Committee of Peking University approved all animal procedures. To induce experimental diabetes before cell or PBS transplantation, STZ was injected intraperitoneally for 5 days at 50 mg/kg into 129 male mice, 6–8 weeks old. When the blood glucose of STZ-treated mice was above 13.9 mM, 1 x 106 insulin-producing cells were transplanted into the left renal capsule. PBS treatment was the control. Blood glucose was measured by GlucoTREND2 (Roche, Indianapolis, http://www.roche-applied-science.com) from snipped tails. Cryostat sections of the operated kidneys were prepared, and insulin expression of transplanted cells in the renal capsule was tested by immunohistochemistry.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inducing ESCs to Insulin-Positive Cells by Activin A and RA
We designed a novel three-step induction strategy based on activin A and RA (Fig. 1AGo). First, ESCs (Fig. 1BGo) were suspended for EB formation. Then EBs were placed into 1% Matrigel-coated dishes and induced by activin A and RA sequentially. Second, the cells were switched to a medium containing 10% FBS/DMEM and bFGF, then cultured for another 3 days, which improved the proliferation of pancreatic progenitor cells derived from EBs. During this stage, most of the remaining cells were epithelial-like (Fig. 1CGo). Some new clusters appeared from large, spreading EBs. Third, the cells were cultured in DMEM/F12 medium with N2 supplement, B27 supplement, laminin, bFGF, and nicotinamide, which appeared to promote pancreatic ß cells to maturation [3]. At this stage, many small cell clusters appeared (Fig. 1D, EGo).



View larger version (55K):
[in this window]
[in a new window]
 
Figure 1. Protocol of embryonic stem (ES) cell differentiation and cell morphology change during induction. (A): The three-step protocol induced ES cells to differentiate into insulin-positive cells. Cell morphology changed in different induction steps (x200). (B): In step 1, the ES cell R1 cluster was cultured in 20% fetal bovine serum/Dulbecco’s modified Eagle medium (FBS/DMEM) with 1,000 U/ml leukemia inhibitory factor. (C): In step 2, after activin A and retinoic acid (RA) interval induction, embryoid bodies spread, and most of the living cells were epithelial-like when cultured in 10% FBS/DMEM with 10 ng/ml basic fibroblast growth factor (bFGF). (D, E): In step 3, after culturing in DMEM/F12 with N2, B27, nicotinamide, bFGF, and laminin, the cells formed small cluster-like constructions.

 
To test whether these factors promote the ESCs to differentiate into pancreatic endocrine cells, we detected the expression of several marker genes in induced cells by RT-PCR. We found that the induced cells expressed many characteristic pancreatic ß-cell marker genes, such as pdx-1, insulinI, glut2, is11, and hnf3ß at the third step of our protocol. The epithelial-like cells induced by activin A or RA alone expressed hnf3ß or pdx-1 at the end of the second step (Fig. 2AGo). In the second step, the differentiated epithelial-like cells expressed pancreatic progenitor markers such as hnf3ß, hnf4{alpha}, and pdx1 (Fig. 2BGo). If induced by the three-step protocol with both activin A and RA, the differentiated cells strongly expressed pdx1, hnf3ß, insulinI, glut2, and is11 (Fig. 2CGo, lane 3). These cells did not express markers of other islet endocrine cells (non-ß cell) such as glucagon or somatostatin (data not shown). This result suggests that TGF-ß and RA signalings may be specific for pancreatic ß-cell development and maturation. We found this induction was strictly dependent on activin A and RA, as absence of both of them resulted in almost no small cluster formation and the induced cells did not express or only weakly expressed pdx1, hnf3ß, insulinI, glut2, and is11 (Fig. 2CGo, lane 2). Moreover, we found that if the dishes were coated with laminin or gelatin, instead of Matrigel, no cell clusters formed in the third step.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 2. Reverse transcription polymerase chain reaction (RT-PCR) analysis of gene expression of differentiated cells at the end of step 2 and step 3. (A): The top panel shows that hnf3ß and pdx-1 were expressed when treated with activin A alone; the bottom panel shows that only hnf3ß was expressed when treated with retinoic acid (RA) alone. (B): Gene expression of the cells after the induction in step 2. (C): Analysis of gene expression of cells induced by the three-step protocol. Lane 1 (pancreas), adult mouse pancreas sample as the positive control; lane 2 (– –), gene expression of cells induced by the three-step protocol without activin A and RA; lane 3 (+), gene expression of cells induced by the three-step protocol with activin A and RA. Lane 4 (RT) is the same sample of lane 3, but PCR was performed without reverse transcriptase.

 
To determine whether there were insulin-positive and C-peptide–positive cells, we performed immunohistochemistry staining to detect insulin and C-peptide expression in the induced cells. The results showed that ESC-derived cell clusters expressed both insulin and C-peptide (Fig. 3A, BGo). If cultured without activin A and RA, the cells did not express insulin (Fig. 3C, DGo). In addition, we also used DTZ to detect the induced cells [15] and found that some clusters in the third step appeared crimson red after DTZ staining (data not shown). This proved that, within those clusters, there were cells that had the same characteristics as pancreatic ß cells.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 3. Analysis of insulin expression and insulin release of induced cells. (A): The cells induced by the three-step protocol stained with primary antibody to insulin were insulin-positive. (B): The cells induced by the three-step protocol stained with primary antibody to C-peptide were C-peptide–positive. (C): The cells without activin A and retinoic acid induction did not express insulin (x200). (D): The cells induced by the three-step protocol stained with primary antibody to insulin were insulin positive (x200). (E, G): The cells derived from the enhanced green fluorescent protein (EGFP) reporter–marked embryonic stem cells induced by the three-step protocol were EGFP positive (x200). (F, H): Those EGFP+ cells stained by primary antibody to insulin were also insulin-positive (x200). (I): Insulin release detection by enzyme-linked immunosorbent assay. Insulin level after treatment with 27.7 mM glucose medium (column a) was nearly six times higher than the insulin level in the 5.5-mM glucose medium (column b).

 
There is evidence showing that ESC progeny could take up the insulin from the culture medium and then stained positive by insulin antibody [5]. To confirm whether the insulin was generated by the induced clusters, we also used an EGFP-reporter system to detect the insulin expression. We transfected the R1 ESCs with an EGFP-reporter vector, in which a green fluorescent protein cDNA was driven by an insulin promoter. ESCs that have incorporated this vector were selected by G418 and induced with activin A and RA. In the third step, EGFP expression was observed within the small cluster cells (Fig. 3E, GGo), and their expression pattern matched that of insulin detected by immunohistochemistry (Fig. 3F, HGo). These data indicated that activin A and RA, combining with other mature factors, could indeed induce ESCs to differentiate into insulin-producing cells.

To analyze whether insulin secretion from those differentiated ESCs could be regulated by glucose, we treated about 106 induced cells with Krebs-Ringer buffer containing either low (5.5 mM) or high (27.7 mM) concentration of glucose and then analyzed the insulin release level in the culture medium by ELISA. We found that the insulin release in the high-glucose medium was nearly six times higher than that in the low-glucose medium (Fig. 3IGo). This result suggested that the ESC-derived insulin-positive cells secreted insulin in a glucose-dependent manner, as do normal pancreatic ß cells.

Transplantation of ESC-Derived Insulin-Positive Cells
To investigate whether the ESC-derived insulin-producing cells could rescue mice with diabetes, we transplanted the induced cells into the left renal capsules of STZ-treated diabetic mice (n = 9). After transplantation, the survival probability of cell-transplanted mice was about three times higher than that of PBS sham-operated control mice (n = 12) (Fig. 4AGo). The survival mice continued to gain weight. Two weeks later, the blood glucose of cell-treated mice reduced to a normal level (less than 13.9 mM). In contrast, the blood glucose of the PBS sham-operated control mice was still above 16 mM (Fig. 4BGo). In addition, after removal of the left kidney transplanted with ESC-derived cells, the blood glucose level of STZ-treated mice reversed back to over 13.9 mM within 3 days, and these mice could survive for nearly 1 week. The recrudescent diabetes and weak body may be the main reasons for their death. Cryostat sections of the operated kidneys were prepared, and insulin-positive cells could be visualized only in the differentiated cell–treated kidneys by immunohistochemistry (Fig. 5A, BGo). These results showed that the ESC-derived insulin-producing cells, when transplanted into the renal capsule, could improve glucose control and functionally rescue the STZ-treated mice with diabetes.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Transplantation of embryonic stem cell–derived insulin-positive cells into diabetic mice left renal capsule ameliorates the diabetic symptom. (A): Differentiated cell–treated diabetic mice (n = 9, dashed line) survived longer, and the survival probability reached 70%, while the survival probability of phosphate-buffered solution (PBS)–transplanted diabetic mice (n = 12, solid line) was 25%. (B): Blood glucose level analysis of induced cell- (n = 5) and PBS- (n = 3) transplanted streptozocin-diabetic mice. Blood glucose levels of cell-transplanted diabetic mice recovered to normal (<13.9 mM) after 2 weeks (black triangles). After the cell-transplanted left kidney was removed, the blood glucose level increased up to 14 mM (dashed line). The PBS-treated diabetic mice still retained high blood glucose (>13.9 mM) (white circle).

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Analysis of insulin expression in transplanted kidney of 129 diabetic mice. (A): Insulin-positive cells were not detected in phosphate-buffered solution–injected left kidney with primary antibody to insulin (x200). (B): Insulin-positive cells could be detected only in the differentiated cell–treated kidney of streptozocin-diabetic mice (x200).

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies showed that ESCs could be specifically induced to differentiate into pancreatic ß cells [27]. However, most of the induction strategies took about 1 month to obtain insulin-positive cells. In the study reported here, we developed a novel three-step protocol based on a combination of activin A, RA, and other maturation factors. At the end of the third step of our protocol, these induced cells form small islet-like clusters and express pancreatic ß-cell markers, including insulinI, pdx-1, glut2, is11, and hnf3ß, and, upon transplantation, can also rescue STZ-treated diabetic mice.

Activin A and RA have important roles in our experimental induction of pancreatic ß cells. Activin A is important for early definitive endoderm development, and it is a disulfide-stabilized protein that belongs to the TGF-ß superfamily. Its binding to the cell surface receptor can induce the expression of many genes, including mix11 and goosecoid, which is important for early endoderm development [8, 9]. Kubo et al. [16] reported that activin A could induce ESCs to differentiate into definitive endoderm cells. In addition, activin A can improve insulin secretion in cultured human pancreatic islets [17] and regulate differentiation of pancreatic ß cells during development and regeneration of ß cells in diabetic neonatal rats [18]. A combination of these functions of activin A may explain how the activin A works in our induction system.

We then used RA to further promote pancreatic lineage differentiation. It has recently been demonstrated that RA is an important signaling molecule in the development of the early embryonic pancreas besides functions on induction of ectoderm and mesoderm development [10]. During zebrafish development, increased RA signaling can induce remarkable anterior expansion of the pancreas and liver endoderm. Conversely, inhibition of RA signaling by BMS493 inhibits early pancreas differentiation from embryonic endoderm [11]. Micallef et al. [19] reported that RA could induce pdx1+ endoderm formation when added at the fourth day of mouse ESC differentiation. Therefore, it is clear that RA can facilitate the development of pancreatic precursor cells. The unique feature of our induction strategy is to use the combination of activin A and RA to activate specifically pancreatic ß differentiation from ESCs. We discovered that after activin A and RA induction, differentiated ESCs expressed pancreatic progenitor markers such as pdx1, hnf3ß, and hnf4{alpha}. We also found that induction with both activin A and RA was more efficient than with activin A or RA alone.

Matrigel also has an important role in our induction strategy. It has been demonstrated that Matrigel, a mixture of extracellular matrix, including laminin and growth factors such as fibroblast growth factor and TGF-ß, is essential for pancreatic progenitor cell migration, the three-dimensional cystic structures formation and protrusion of islet bud [20]. If human pancreatic ductal epithelial cells were cultured on the Matrigel, they could form insulin-positive islet-like clusters [21]. It has also been reported that laminin, one of the major components of Matrigel, was involved in mouse embryonic pancreatic duct lineage selection [22, 23]. In our study, we found that Matrigel was necessary for small islet-like cluster formation during induction. If ESCs were cultured on the laminin or gelatin matrix alone, cell clusters could not form well. And the differentiated cells seemed to grow better on Matrigel than on laminin or gelatin. Because laminin is a component of Matrigel, our data suggested that other matrix and growth factors in Matrigel may be also useful for pancreatic endocrine cell maturation.

Transplantation of ESC-derived insulin-producing cells was sufficient to normalize the blood glucose levels of diabetic mice in our experiment. However, we observed tumor formation in the kidney of some mice transplanted with induced cells. In fact, until now, most reported that insulin-producing cells derived from ESCs developed tumors when transplanted into recipient mice [5, 6]. Because of tumorigenesis, our strategy may not be sufficient to induce all treated ESCs into terminal-differentiated pancreatic ß cells. In our future work, we will test many other maturation factors, such as GLP-1 [24], to further improve pancreatic ß-cell terminal differentiation. Alternatively, more effort should be made to overcome ESC tumorigenesis problems. For example, it may be useful to block PI3K signaling [5] or to reduce Eras gene expression [25] to prevent ESC tumorigenesis.

In summary, we have demonstrated that a novel three-step protocol with a combination of activin A, RA, and other mature factors can induce ESCs to differentiate into functional insulin-producing cells in a short period. The results indicate that TGF-ß and RA signals are critical for pancreatic ß–cell development and maturation. The induction system described here offers a new in vitro induction model for studying the mechanism of pancreatic ß–cell formation and differentiation, and it provides a potential source of insulin-producing cells for transplantation therapy of type I diabetes mellitus.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This research was supported by grants from the Ministry of Science and Technology (no. 2001CB510106) and the Science and Technology Plan of Beijing Municipal Government (no. H020220050290); an award from the National Nature Science Foundation of China for Outstanding Young Scientists (no. 30125022) to H.D.; and a grant from the Ministry of Science and Technology (no. 1999053900) to M. D.

We thank Dr. M.S. German for kindly providing the insulin promoter vector. We also thank Dr. Tung-Tien Sun for critical reading of the manuscript. In addition, we acknowledge other colleagues in our lab for advice during experiments. Y.S., L.H., and F.T. contributed equally to this article.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Serup P, Madsen OD, Mandrup-Poulsen T. Islet and stem cell transplantation for treating diabetes. Br Med J 2001;322:29–32.[Free Full Text]

  2. Soria B, Roche E, Berna G et al. Insulin-secreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes 2000;49:157–162.[Abstract]

  3. Lumelsky N, Blondel O, Laeng P et al. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 2001;292:1389–1394.[Abstract/Free Full Text]

  4. Assady S, Maor G, Amit M et al. Insulin production by human embryonic stem cells. Diabetes 2001;50:1691–1697.[Abstract/Free Full Text]

  5. Hori Y, Rulifson IC, Tsai BC et al. Growth inhibitors promote differentiation of insulin-producing tissue from embryonic stem cells. Proc Natl Acad Sci U S A 2002;99:16105–16110.[Abstract/Free Full Text]

  6. Blyszczuk P, Czyz J, Kania G et al. Expression of Pax4 in embryonic stem cells promotes differentiation of nestin-positive progenitor and insulin-producing cells. Proc Natl Acad Sci U S A 2003;100:998–1003.[Abstract/Free Full Text]

  7. Hansson M, Tonning A, Frandsen U et al. Artifactual insulin release from differentiated embryonic stem cells. Diabetes 2004;53:2603–2609.[Abstract/Free Full Text]

  8. Kumar M, Jordan N, Melton D et al. Signals from lateral plate mesoderm instruct endoderm toward a pancreatic fate. Dev Biol 2003;259:109–122.[CrossRef][Medline]

  9. Hill CS. TGF-ß signalling pathways in early Xenopus development. Curr Opin Genet Dev 2001;11:533–540.[CrossRef][Medline]

  10. Maden M. Role and distribution of retinoic acid during CNS development. Int Rev Cytol 2001;209:1–77.[Medline]

  11. Stafford D, Prince VE. Retinoic acid signaling is required for a critical early step in Zebrafish pancreatic development. Curr Biol 2002;12:1215–1220.[CrossRef][Medline]

  12. Blumentrath J, Neye H, Verspohl EJ. Effects of retinoids and thiazolidinediones on proliferation, insulin release, insulin mRNA, GLUT2 transporter protein and mRNA of INS-1 cells. Cell Biochem Funct 2001;19:159–169.[Medline]

  13. Moriya N, Komazaki S, Takahashi S et al. In vitro pancreas formation from Xenopus ectoderm treated with activin and retinoic acid. Dev Growth Differ 2000;42:593–602.[CrossRef][Medline]

  14. Nagy A, Rossant J, Nagy R et al. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci U S A 1993;90:8424–8428.[Abstract/Free Full Text]

  15. Shiroi A, Yoshikawa M, Yokota H et al. Identification of insulin-producing cells derived from embryonic stem cells by zinc-chelating dithizone. STEM CELLS 2002;20:284–292.[Abstract/Free Full Text]

  16. Kubo A, Shinozaki K, Shannon JM et al. Development of definitive endoderm from embryonic stem cells in culture. Development 2004;131:1651–1662.[Abstract/Free Full Text]

  17. Florio P, Luisi S, Marchetti P et al. Activin A stimulates insulin secretion in cultured human pancreatic islets. J Endocrinol Invest 2000;23:231–234.[Medline]

  18. Li L, Yi Z, Seno M et al. Activin A and betacellulin: effect on regeneration of pancreatic beta-cells in neonatal streptozotocin-treated rats. Diabetes 2004;53:608–615.[Abstract/Free Full Text]

  19. Micallef SJ, Janes ME, Knezevic K et al. Retinoic acid induces pdx1-positive endoderm in differentiating mouse embryonic stem cells. Diabetes 2005;54:301–305.[Abstract/Free Full Text]

  20. Gao R, Ustinov J, Pulkkinen MA et al. Characterization of endocrine progenitor cells and critical factors for their differentiation in human adult pancreatic cell culture. Diabetes 2003;52:2007–2015.[Abstract/Free Full Text]

  21. Bonner-Weir S, Taneja M, Weir GC et al. In vitro cultivation of human islets from expanded ductal tissue. Proc Natl Acad Sci U S A 2000;97:7999–8004.[Abstract/Free Full Text]

  22. Jiang FX, Cram DS, DeAizpurua HJ et al. Laminin-1 promotes differentiation of fetal mouse pancreatic beta-cells. Diabetes 1999;48:722–730.[Abstract]

  23. Crisera CA, Kadison AS, Breslow GD et al. Expression and role of laminin-1 in mouse pancreatic organogenesis. Diabetes 2000;49:936–944.[Abstract]

  24. Abraham EJ, Leech CA, Lin JC et al. Insulinotropic hormone glucagons-likepeptide-1differentiationofhumanpancreaticislet-derivedprogenitor cells into insulin-producing cells. Endocrinology 2002;143:3152–3161.[Abstract/Free Full Text]

  25. Takahashi K, Mitsui K, Yamanaka S. Role of ERas in promoting tumour-like properties in mouse embryonic stem cells. Nature 2003;423:541–545.[CrossRef][Medline]

Received September 16, 2004; accepted for publication January 11, 2005.



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Bertolino, R. Holmberg, E. Reissmann, O. Andersson, P.-O. Berggren, and C. F. Ibanez
Activin B receptor ALK7 is a negative regulator of pancreatic {beta}-cell function
PNAS, May 20, 2008; 105(20): 7246 - 7251.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. C. Robson, D. J. Phillips, T. McAlpine, A. Shin, S. Svobodova, T. Toy, V. Pillay, N. Kirkpatrick, D. Zanker, K. Wilson, et al.
Activin-A: a novel dendritic cell-derived cytokine that potently attenuates CD40 ligand-specific cytokine and chemokine production
Blood, March 1, 2008; 111(5): 2733 - 2743.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Qin, T. Yu, T. Qing, Y. Liu, Y. Zhao, J. Cai, J. Li, Z. Song, X. Qu, P. Zhou, et al.
Regulation of Apoptosis and Differentiation by p53 in Human Embryonic Stem Cells
J. Biol. Chem., February 23, 2007; 282(8): 5842 - 5852.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
Y.-G. Chen, Q. Wang, S.-L. Lin, C. D. Chang, J. Chung, and S.-Y. Ying
Activin Signaling and Its Role in Regulation of Cell Proliferation, Apoptosis, and Carcinogenesis.
Experimental Biology and Medicine, May 1, 2006; 231(5): 534 - 544.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
H. J. Rippon, J. M. Polak, M. Qin, and A. E. Bishop
Derivation of Distal Lung Epithelial Progenitors from Murine Embryonic Stem Cells Using a Novel Three-Step Differentiation Protocol
Stem Cells, May 1, 2006; 24(5): 1389 - 1398.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
D. Stafford, R. J. White, M. D. Kinkel, A. Linville, T. F. Schilling, and V. E. Prince
Retinoids signal directly to zebrafish endoderm to specify insulin-expressing {beta}-cells
Development, March 1, 2006; 133(5): 949 - 956.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
S. P. Raikwar, T. Mueller, and N. Zavazava
Strategies for Developing Therapeutic Application of Human Embryonic Stem Cells
Physiology, February 1, 2006; 21(1): 19 - 28.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, Y.
Right arrow Articles by Deng, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shi, Y.
Right arrow Articles by Deng, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS
http://www.peprotech.com/