Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Stem Cells Vol. 23 No. 7 August 2005, pp. 903 -913
doi:10.1634/stemcells.2004-0295; www.StemCells.com
© 2005 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogawa, S.
Right arrow Articles by Miyagawa, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogawa, S.
Right arrow Articles by Miyagawa, S.

Crucial Roles of Mesodermal Cell Lineages in a Murine Embryonic Stem Cell–Derived In Vitro Liver Organogenesis System

Shinichiro Ogawaa,b, Yoh-ichi Tagawaa, Akiko Kamiyoshia, Akihiro Suzukia, Jun Nakayamac, Yasuhiko Hashikurab, Shinichi Miyagawab

a Division of Laboratory Animal Research, Research Center for Human and Environmental Sciences, Shinshu University;
b Department of Surgery, Shinshu University School of Medicine;
c Department of Pathology, Shinshu University School of Medicine, Shinshu, Japan

Key Words. Embryonic stem cell • Liver • Organogenesis • Cardiomyocyte • Endothelial cell • In vitro system

Correspondence: Yoh-ichi Tagawa, Ph.D., Department of Biomolecular Engineering, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, B-51 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa, 226-8501 Japan. Telephone: 81-45-924-5791; Fax: 81-45-924-5815; e-mail: ytagawa{at}bio.titech.ac.jp


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recent studies in the field of regenerative medicine have exploited the pluripotency of embryonic stem (ES) cells to generate a variety of cell lineages. However, the target has always been only a single lineage, which was isolated from other differentiated cell populations. In the present study, we selected sublines with a high capability for differentiation to contracting cardiomyocytes and also produced germ-line chimeric mice from a parent ES line. We also succeed in establishing embryoid bodies prepared from the ES cells that differentiated into not only hepatocytes but also at least two mesodermal lineages: cardiomyocytes that supported liver development and endothelial cells corresponding to sinusoids. This allowed the development of an in vitro system using murine ES cells that approximated the events of liver development in vivo. The expression of albumin was significantly higher in cardiomyocytes that had arisen in differentiated ES cells than in those that had not. Our in vitro system for liver organogenesis consists of a blood/sinusoid vascular-like network and hepatocyte layers and shows higher levels of hepatic function, such as albumin production and ammonia degradation, than hepatic cell lines and primary cultures of murine adult hepatocytes. This innovative system will lead to the development of second-generation regenerative medicine techniques using ES cells and is expected to be useful for the development of bioartificial liver systems and drug-metabolism assays.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The liver develops from the ventral foregut in vertebrates, receiving multiple stimuli in the form of growth factors, cytokines, and hormonal factors, as well as intercellular and matrix cellular interactions [1–5]. In particular, the precardiac mesoderm produces factors that trigger hepatic development [6, 7], that is, cardiomyocytes support liver organogenesis (Fig. 7A). The signaling of fibroblast growth factor (FGF), produced in the cardiac mesoderm, induces the initial step of hepatogenesis in the ventral endoderm at E8.5–9.5 of mouse development, resulting in the activation of albumin and {alpha}-fetoprotein expressions [4, 6, 8]. As the hepatic precursor cells migrate into the septum transversum to form a liver bud [9], endothelial progenitor cells arise there simultaneously in close association with early developing hepatoblasts and hepatogenesis [10]. These endothelial cells develop a fenestrated morphology to form the hepatic sinusoids [11–13], and then finally the liver is completed, with its multiple and specific functions.

In the field of regenerative medicine, the pluripotency of embryonic stem (ES) cells has been applied to obtain a variety of cell lineages. However, the targets of these systems have always been limited to only a single lineage, which was isolated from other differentiated cell populations. There have been a few reports on the differentiation of murine ES cells to hepatocyte-like or albumin-producing cells [14–19]. However, these studies focused only on hepatocytes as a single-cell lineage and did not refer to liver organogenesis. It also has been reported that hepatocyte-like cells spontaneously differentiate from human ES cells [20], as well as previous studies using murine ES cells. In particular, there has been no description about the roles of cardiomyocytes and endothelial cells in hepatocyte differentiation, although one previous study has detected albumin-positive cells adjacent to cardiomyocytes in teratoma-derived human ES cells in severe combined immunodeficiency mice [20]. Cardiac mesoderm has a strong capacity to induce liver organogenesis [4, 6, 8]. These cell lineages can also be obtained from ES cells. Therefore, we considered that emergence of cardiomyocytes would be necessary for liver morphogenesis from ES cells in vitro. Our purpose in the present study was to establish a system for in vitro hepatic morphogenesis consisting of not only hepatocytes but also cell lineages supporting hepatic differentiation, such as cardiomyocytes and endothelial cells, which correspond to those involved in liver organogenesis in vivo, from murine ES cells. We exploited the pluripotency of ES cells for differentiation of these cell lineages, which included hepatocytes, cardiomyocytes, and endothelial cells, and succeeded in establishing a novel system of hepatic morphogenesis from murine ES cells based on naturally occurring embryological events, that is, with contributions from cardiac mesoderm and endothelial cell lineages.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell Culture
E14-1 ES cells derived from 129/Ola were grown on mitomycin C–treated mouse embryonic fibroblast feeder layers to maintain them in an undifferentiated state in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Tokyo, http://www.invitrogen.com) containing 20% fetal bovine serum (FBS) (Hyclone, Logan, UT, http://www.hyclone.com), 1 mM sodium pyruvate (Invitrogen), 100 µM nonessential amino acids (Invitrogen), 100 µM 2-mercaptoethanol (Sigma, St. Louis, http://www.sigmaaldrich.com), and 103 U/ml leukemia inhibitory factor (LIF) (Chemicon, CA, http://www.chemicon.com). The cells were dissociated with 0.25% trypsin, 1% chicken serum (Invitrogen), and 1 mM EDTA in phosphate-buffered saline (PBS) and resuspended in Iscove’s modified Dulbecco’s medium (IMDM) (Invitrogen) containing 20% FBS, 1 mM sodium pyruvate, 100 µM nonessential amino acids, and 100 µM 2-mercaptoethanol without LIF and then formed into a hanging drop at a concentration of 1,000 cells per 50-µl drop. The hanging drop was cultured in an atmosphere of 5% CO2 at 37°C for 5 days. An individual 5-day-old embryoid body (EB) was plated in each well of a gelatin-coated 96-well plate, and the growth factor was added to the culture medium. The day when the 5-day-old EBs were plated in the dish was denoted day 0 (A0). Human recombinant acidic fibroblast growth factor (aFGF) (Invitrogen) was added to the differentiation medium at a concentration of 100 ng/ml 2 days after plating of the 5-day-old EBs (A2), and 20 ng/ml human recombinant hepatocyte growth factor (HGF) (Genzyme/Techne, Minneapolis, http://www.g-tonline.com) was added at A4. Then, at A6, 10 ng/ml mouse recombinant oncostatin M (Genzyme/Techne), 100 nM dexamethasone (MP Biomedicals, Irvine, CA, http://www.mpbio.com), ITS (insulin 10 µg/ml, transferrin 5 µg/ml, selenium 5 ng/ml; Invitrogen), and 10 mM nicotinamide (Nakalai tesque, Kyoto, Japan, http://www.nacalai.co.jp) were added. The emergence frequency of contracting cells in the EB outgrowths, indicating cardiac muscle differentiation, was monitored daily. Emergence frequency was expressed as a percentage, where 100% meant detection of a contractile area in all wells containing EB outgrowths. Twenty recloned 5-day-old EBs were plated on a 6-cm dish coated with gelatin as a semi–large-scale culture.

To obtain fetal hepatocytes, mouse liver at E15 was minced and dissociated with collagenase II (Sigma) in Hanks’ buffer (Invitrogen). The cells were seeded on a gelatin-coated dish in DMEM supplemented with 10% FBS, 100 µM nonessential amino acids, and 100 U/ml penicillin-100 µg/ml streptomycin-292 µg/ml glutamine for a few hours and washed once with the same medium. The medium was replaced every day.

Primary adult hepatocytes were isolated from male 129/SvJ mice by the two-step collagenase perfusion method. The hepatocytes were separated from the resulting cell suspension by centrifugation and then by centrifugation through a 50% Percoll (Sigma) gradient. Isolated hepatocytes were plated onto gelatin-coated dishes.

Production of Chimeric Mice
Chimeric mice were produced by the modified aggregation method [21]. This involved aggregation of 10 to 15 ES cells with two (BDF1 x C57BL) F1 eight-cell-stage embryos, from which the zona pellucida had been removed with Tyrode’s solution (Sigma), were placed in a hole on a plastic dish and cultured overnight. The ES cells and eight-cell-stage embryos became a single blastocyst, and the blastocysts were then transferred to the uterus of pseudo-pregnant female ICR mice. Male chimeric mice were then bred with C57BL/6 female mice, and germ-line transmission of the ES cells was checked by the agouti coat color of the offspring.

RNA Extraction and Reverse Transcription–Polymerase Chain Reaction Analysis
Total RNA was extracted from the outgrowths of the EBs using a MagEXtractor mRNA kit (Toyobo, Tokyo, http://www.toyobo.co.jp/e). Briefly, 2-µg aliquots of total RNA were reverse transcribed to cDNAs using a Superscript II first-strand synthesis system with an oligo dT primer (Invitrogen). Semiquantitative reverse transcription–polymerase chain reaction (RT-PCR) was performed using Ex Taq DNA polymerase (Takara, Tokyo, http://www.takara-bio.com) with the following primer sets. For each experiment, a housekeeping gene, hypoxanthine phosphoribosyltransferase, was amplified with 25 cycles to normalize the expressions of other genes in the sample. The forward and reverse primers were located at different exons to discriminate the product from the targeted mRNA or its genomic DNA. The PCR primers used were as follows: albumin, GCTACGGCACAGTGCTTG and CAGGATTGCAGACAGATAGTC (product size, 265 bp; annealing temperature, 65°C); {alpha}-fetoprotein, TCGTATTCCAACAGGAGG and AGGCTTTTGCTTCACCAG (product size, 173 bp; annealing temperature, 65°C); transthyretin, CTCACCACAGATGAGAAG and GGCTGAGTCTCTCAATTC (product size, 223 bp; annealing temperature, 56°C); {alpha}1–antitrypsin, AATGGAAGAAGCCATTCGAT and AAGACTGTAGCTGCTGCAGC (product size, 483 bp; annealing temperature, 50°C); Oct3/4, AGCACGAGTGGAAAGCACT and CTCATTGTTGTCGGCTTCCT (product size, 339 bp; annealing temperature, 60°C); tyrosine aminotransferase, ACCTTCAATCCCATCCGA and TCCCGACTGGATAGGTAG (product size, 205 bp; annealing temperature, 66°C); tryptophan 2,3-deoxygenase, TGCGCAAGAACTTCAGAGTGA and TGCGCAAGAACTTCAGAGTGA (product size, 419 bp; annealing temperature, 62°C); liver-specific organic anion transporter-1, TGCGCAAGAACTTCAGAGTGA and TGAGTTGGACCCCTTTTCAC (product size, 226 bp; annealing temperature, 65°C); asialoglycoprotein receptor-1, GCTGGAAAAACAGCAGAAGG and CTGTTCCATCCACCCATTTC (product size, 358 bp; annealing temperature, 65°C); asialoglycoprotein receptor-2, CGGACCCTGAAAGAAACCTT and ATGAAACTGGCTCCTGTGCT (product size, 410 bp; annealing temperature, 66°C); HGF, AGACACCACACCGGCACAGT and ATAGGGCAATAATCCCAAGG (product size, 484 bp; annealing temperature, 65°C); FGF-1, ACCGAGAGGTTCAACCTGCC and GCCATAGTGAGTCCGAGGACC (product size, 386 bp; annealing temperature, 66°C); vascular endothelial growth factor (VEGF), CAGGCTGCTGTAACGATGAA and AATGCTTTCTCCGCTCTGAA (product size, 206 bp; annealing temperature, 65°C); VEGFR1, TGTGGAGAAACTTGGTGACCT and TGGAGAACAGCAGGACTCCTT (product size, 504 bp; annealing temperature, 65°C); VEGFR2, TCTGTGGTTCTGCGTGGAGA and GTATCATTTCCAACCACCC (product size, 269 bp; annealing temperature, 55°C); platelet-endothelial cell adhesion molecule-1 (PECAM-1), GTCATGGCCATGGTCGAGTA and AGCAGGACAGGTCCAACAAC (product size, 168 bp; annealing temperature, 65°C); atrial natriuretic peptide, ATGGGCTCCTTCTCCCATCAC and TGTTGCAGCCTAGTCCACTC (product size, 541 bp; annealing temperature, 65°C); and hypoxanthine phosphoribosyltransferase, GTTGGATACAGGCCAGACTTTGTTG and GAGGGTAGGCTGGCCTATAGGCT (product size, 269 bp; annealing temperature, 65°C).

Immunohistochemical Analysis
Twenty EBs were cultured on gelatin-coated glass coverslips in a six-well plate. EB outgrowths on the coverslips were fixed with 4% paraformaldehyde/PBS for 20 minutes and then permeabilized with 0.1% Triton X for 10 minutes at room temperature. The fixed samples were incubated in blocking buffer containing 4% donkey serum (Jackson Immunoresearch, Baltimore, http://www.jacksonimmuno.com) for 10 minutes at room temperature. They were then incubated with the primary antibody overnight at 4°C and with the secondary antibody for 1 hour in a humidified chamber. The following antibodies were used: rabbit immunoglobulin (IgG) against mouse albumin (1:250; MP Biomedicals), goat IgG against mouse PECAM-1 (1:250; Santa Cruz Biotech, CA, http://www.scbt.com), tetramethylrhodamine isothiocyanate–conjugated swine anti-rabbit immunoglobulin (1:60; DakoCytomation A/S, Glostrup, Denmark, http://www.dakocytomation.com), and fluorescein-conjugated donkey anti-goat IgG (1:100; Jackson Immunoresearch, West Grove, PA). For nuclear staining, the cells were incubated for 5 minutes at room temperature with DAPI (4,6 diamidino-2-phenylindole). The samples were mounted in Dako-Cytomation fluorescent mounting medium and observed using a fluorescence microscope (BX 60; Olympus, Tokyo, http://www.olympus-global.com/en/global) and a confocal laser microscope (TCS SP2; Leica, Manheim, Germany, http://www.leica.com/index.html).

Western Blotting Analysis
ES cells and EBs were homogenized in buffer containing 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 1% sodium deoxycholate, 2 mM EDTA, 1 mM phenylmethyl-sulfonyl fluoride, 2 µg/ml aprotinin, 10 µg/ml leupeptin, and 5 µg/ml pepstatin, centrifuged at 12,000 rpm for 10 minutes at 4°C, and the supernatants were collected. Protein concentration was measured with a bicinchoninic acid protein assay (BCA protein assay kit; Pierce, Rockford, IL, http://www.piercenet.com). The same amounts (10 µg each lane) of proteins from cell homogenates were electrophoresed on 8% polyacrylamide gels. Proteins were transferred onto polyvinylidene difluoride membranes by electro blotting. The membranes were blocked for 1 hour at room temperature with 5% nonfat dried milk and 0.1% bovine serum albumin in tris-buffered saline (TBS) containing 0.1% (vol/vol) Tween 20 (TBS-T) and incubated for 1 hour with peroxidase-conjugated sheep anti-rabbit antibody (GE Healthcare, Piscataway, NJ, http://www.gehealthcare.com) diluted in TBS-T containing 5% FBS. After washing with TBS-T, the blots were developed by enhanced chemiluminescence (GE Healthcare) and exposed to x-ray film (RX-U; Fuji, Kawasaki, Japan, http://home.fujifilm.com).

Treatment with Thalidomide or CBO-P11
Thalidomide (N-[2,6-dioxo-3-piperidinyl] phthalimide; Tocris Cookson, Ellisville, MO, http://www.tocris.com) was dissolved in dimethyl sulfoxide and added to the medium at the indicated concentration. CBO-P11 (cyclo-VEGI) (DFPQIM-RIKPHQGQHIGE) (Calbiochem, San Diego, http://www.emdbiosciences.com/html/CBC/home.html), a cyclopeptidic vascular endothelial growth inhibitor, was dissolved in water and added to the medium at a concentration of 10 µM. These chemicals were added to the medium after 20 five-day-old EBs had been plated on the dish (A0). The medium was replaced every day.

Ammonia Modification Function Assay
To examine cellular ammonia degradation activity, 2 mM NH4Cl was added to the serum-free culture medium of 30 or 50 EBs at days 10 and 18 after plating and further incubated for 24 hours. The concentration of NH4Cl remaining in the medium was measured at various time points by a modified indophenol method using a commercial kit (Ammonia-test Wako; Wako, Osaka, Japan, http://www.wako-chem.co.jp).


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Roles of Embryonic Stem Cell–Derived Cardiomyocytes in Hepatic Differentiation from Murine Embryonic Stem Cells
As is the case in in vivo development, the emergence of cardiomyocytes is necessary for liver organogenesis in an in vitro differentiation system using ES cells. As an initial approach for inducing murine ES cells to undergo hepatic morphogenesis, we established a system for spontaneous differentiation to contracting cardiomyocytes with a high frequency of emergence. A single 5-day-old EB comprised of dissociated murine ES cells was plated onto gelatin-coated plates and allowed to adhere to the bottom of the plate. The EB outgrowths began to contract spontaneously within 5 days after plating. These ES cell–derived contracting cells were considered to be cardiomyocytes based on specific gene expression (Fig. 1BGo) and pharmacological responses. The outgrowths of EBs were cultured in the differentiation medium for 18 days (A18) after adhesion to the well bottom. The expression of albumin was compared in groups of EBs in which cardiomyocytes had and had not arisen at A10; the levels of albumin expression were significantly higher in those with outgrowths of contracting cardiomyocytes than in those without (Fig. 1BGo), suggesting that the ability to differentiate to cardiomyocytes in the ES cell population and the emergence of cardiomyocytes in the EB outgrowths are important for endodermal and hepatocyte differentiation.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 1. Establishment of a system for allowing differentiation of ES cells to cardiomyocytes at a frequency of almost 100% for hepatic differentiation. (A): Comparison of the time courses of the frequency of emergence contractile cells from outgrowths of EBs prepared from the parental line of E14-1 ES cells ({bullet}), subline My-1 ({circ}), Ab-3 ({blacksquare}), and My-5 ({blacktriangleup}). (B): Expression of albumin as a representative hepatic marker and of ANP as an atrial marker was determined by reverse transcription–PCR during differentiation of EBs. PCR amplication of ANP and albumin was carried out for 30 cycles. Human recombinant aFGF was added to the differentiation medium at a concentration of 100 ng/ml 2 days after plating of the 5-day-old EBs on the dish (A2), and then 20 ng/ml human recombinant HGF was added at A4. Then with 10 ng/ml mouse recombinant OSM, 100 nM dexamethasone, ITS (insulin 10 µg/ml, transferrin 5 µg/ml, selenium 5 ng/ml), and 10 mM nicotinamide (Nacalai) were added at A6. Arrowhead indicates the expected band of ANP. Abbreviations: aFGF, acidic fibroblast growth factor; AL, mouse adult liver; ANP, atrial natriuretic peptide; EB, embryoid body; ES, embryonic stem; GF, growth factor; FH, mouse fetal heart at E15; FL, mouse fetal liver at E15; HGF, hepatocyte growth factor; OSM, oncostatin M; PCR, polymerase chain reaction.

 
To increase the efficiency of liver organogenesis from ES cells, it was considered important to increase the frequency of cardiomyocyte emergence in the EB outgrowths. The frequency of cardiomyocyte emergence at Ab-3 was less than 30% using the parental line of the E14-1 ES cells at passages 14 through 18, whereas the frequency was almost 100% using some sublines (My-1 and Ab-3) other than My-5, which were recloned from the parental line E14-1 (Fig. 1AGo). Ability for the production of chimeric mice was also compared in the parental line and these E14-1 sublines. The chimera-forming ability of the parental E14-1 was 2 germ-line/17 chimeric mice from 171 ES-aggregated embryos, whereas that of a subline Ab-3 was 4 germ-line/18 chimeric mice from 155 ES-aggregated embryos. It is very important that undifferentiated and pluripotent ES cells should be present in these cultures for differentiation not only to cardiomyocytes but also to albumin-producing hepatocytes and endothelial cells corresponding to the developmental stages of the liver. For the following experiments, we used the selected subline, Ab-3, which showed high capability for differentiation to cardiomyocytes and also for production of germ-line chimeric mice, within six passages.

Expression and Function of Liver-Specific Gene Expressions and Functions in Murine Embryonic Stem Cell–Derived Hepatic Morphogenesis
Twenty 5-day-old EBs were placed together on gelatin-coated dishes in differentiation medium as a semi–large-scale system, because the absolute numbers of cells would be needed for hepatic development. Contracting cardiomyocytes emerged in the central area of EB outgrowth. A heterologous population was considered important for in vitro hepatic morphogenesis using murine ES cells. The expressions of endodermal/hepatocyte-specific genes, such as transthyretin, {alpha}-fetoprotein, {alpha}1-antitrypsin, and albumin, at the various stages of EB differentiation were examined (Fig. 2AGo). The levels of expression of these genes increased markedly as differentiation of the EBs proceeded, whereas that of Oct-3/4, a marker of undifferentiated ES cells, decreased. The levels of expression of liver-specific genes and Oct-3/4 in the presence of growth factor were the same as those in the absence of growth factor, suggesting that cardiomyocytes were not induced in the presence of growth factor. We also confirmed that albumin protein was detectable in the differentiated outgrowths of EBs at A4 and increased gradually throughout differentiation (Fig. 2BGo), corresponding to the changes in mRNA levels (Fig. 2AGo).



View larger version (37K):
[in this window]
[in a new window]
  		Figure 2. Expression by ES cell–derived hepatocytes of a variety of liver-specific genes, production of albumin protein, and ammonia modification function. (A): The expression of endodermal-specific genes was examined in the outgrowths of EBs from before plating (3- and 5-day-old EBs) to 8 days after plating (A8) by RT-PCR. PCR amplification of Oct-3/4, TTR, AFP, AAT, and albumin was carried out for 30 cycles. Five-day-old EBs were plated on gelatin-coated dishes and cultured in the absence of any growth factors. (B): The level of albumin protein was quantified by Western blotting analysis during hepatic differentiation of EBs. EBs were cultured in the absence of any growth factors for 18 days. (C, D): Expression of albumin and mature hepatocyte-specific genes expression was detected in the EB outgrowths at A10 (C) and A18 (D). Comparison of cultures in the presence or absence of additional growth factors. PCR amplification of albumin was carried out for 25 cycles. Amplification of TAT, ASGR-1, ASGR-2, and LST-1 was carried out for 40 cycles. Amplification of TO was carried out for 30 cycles. (E): Expression of CYP family genes, such as Cyp2A5, 2B10, and 3A16, was detected by RT-PCR (40 cycles, respectively) in the EB outgrowths at A10 and A18 cultured in the absence of additional growth factors. (G): Ammonia modification function was measured in EB outgrowths at A18. The amounts of residual ammonia in 100 cells are indicated, which were calculated from the quantity of prepared genomic DNA. {square}, primary adult mouse hepatocyte culture; {blacksquare}, outgrowth of 50 EBs at A18; {circ}, 30 EBs at A18; {bullet}, 30 EBs at A10; {blacktriangledown}, mouse hepatoma cell line, HePa1–6; {blacktriangleup}, ES E14-1. (F): Endogenous aFGF and HGF gene expression was detected by RT-PCR (40 cycles, respectively) in the EB outgrowths during differentiation in the absence of these additional growth factors by RT-PCR. Arrow head indicates the expected band of ANP. Abbreviations: aFGF, acidic fibroblast growth factor; AL, mouse adult liver; EB, embryoid body; ES, embryonic stem; GF, growth factor; FL, mouse fetal liver at E15; HGF, hepatocyte growth factor; RT-PCR, reverse transcription–polymerase chain reaction ; TAT, tyrosine aminotransferase.

 
As a second approach for inducing hepatic morphogenesis from ES cells, aFGF, HGF, and oncostatin M were added to the cultures to investigate the effects of growth factors. The levels of expression of albumin, tyrosine aminotransferase (TAT), and tryptophan oxygenase (TO) were significantly higher in the presence than in the absence of additional growth factors at A10, corresponding to the early differentiation stage of EBs. This suggests that the addition of growth factors artificially induces the expression of mature hepatocyte-specific genes or accelerates differentiation in the system at an early stage (Fig. 2CGo). On the other hand, at A18, corresponding to the late differentiation stage, the levels of expression of albumin, TAT, TO, and asialo glycoprotein receptors (ASGR1, ASGR2) in the EB were almost the same levels under conditions with and without additional growth factors. Furthermore, liver-specific transporter (LST-1) mRNA was detected only in the absence of any growth factor (Fig. 2DGo), suggesting that these additional factors were not essential for hepatic differentiation and maturation from ES cells in our system. The expressions of some CYP genes were also detectable under conditions without growth factors (Fig. 2EGo).

To investigate whether the outgrowths of EBs could supply these growth factors themselves, the expressions of these genes were analyzed in EBs without these growth factors. Endogenous aFGF and HGF expression was detected in the outgrowths in the absence of the additional growth factors (Fig. 2FGo), suggesting that addition of these growth factors is not necessary for hepatic differentiation of EBs, as they are produced endogenously.

Assay of ammonia degradation, a representative hepatic function, was also carried out. Interestingly, the level of ammonia degradation was markedly higher in the differentiated EB outgrowths than in the hepatocyte cell line, HePa1-6, and in primary cultures of murine hepatocytes (Fig. 2EGo).

To investigate the distribution of albumin-positive cells in the EB outgrowths at A10 and A18, we performed immunohistochemical analyses using anti-mouse albumin antibody. The albumin-positive cells were visualized adjacent to the contracting cardiomyocytes, around the central area of the outgrowths, at A10 (Fig. 3AGo). These albumin-positive cells formed clusters and showed an islet-like morphology in the outgrowths (Figs. 3A, 3BGo). At A18, corresponding to the late stage of hepatic differentiation, these colonies had grown and were strongly detected, as can be seen in Figure 3CGo, suggesting that these cells were proliferating and expanding.



View larger version (66K):
[in this window]
[in a new window]
  		Figure 3. Albumin-positive cells observed as expanding colonies in the outgrowths of EBs. (A): Photomicrograph showing the contracting region and albumin-positive areas in the outgrowths of differentiated EBs at A10 in the absence of any growth factors. The shaded square is magnified in (B). (B–D): Immunohistochemical analysis of the EB outgrowths at (B) A10 and (C, D) A18 using anti-albumin (red). White arrow heads indicate the binuclear cells in the outgrowths of the EB. These cultures were also carried out in the absence of any growth factors. Abbreviations: CA, contracting cardiomyocyte area; EB, embryoid body.

 
Morphology of Murine Embryonic Stem Cell–Derived Hepatocytes
Murine hepatocytes contained two morphologically distinct populations, a mononuclear population and a binuclear population. Hepatocytes in the resting liver consist predominantly of binuclear hepatocytes, whereas those in the regenerating liver are mainly mononuclear hepatocytes [22]. Some of these albumin-positive cells were binuclear, which is a characteristic of mature hepatocytes in mice (Fig. 3DGo). Thus, these cells were confirmed to be murine hepatocytes on the basis of morphology as well as by hepatic function and gene expression analysis. In addition to hepatic function and expression in our cultures, morphological evidence also suggested that the albumin-producing cells derived from ES cells in our system were hepatocytes.

Vasculogenesis in the System to Induce Murine Embryonic Stem Cells to Hepatic Morphogenesis
The contribution of the nonparenchymal hepatic cell population is necessary for hepatic in vitro morphogenesis from ES cells. Expression of VEGF, VEGFR1, and VEGFR2 was detected from the EB in the period from before plating to the late stage of differentiated EB, and CD31/PECAM-1, a definitive endothelial cell–specific marker, began to be expressed at the stage of EB formation and continued to be detectable until the late stage of differentiation of the EB outgrowths (Fig. 4AGo), suggesting that vasculogenesis had been activated in this system. Indeed, CD31/PECAM-1–positive cells were shown to form network structures (Fig. 4CGo), indicating that CD31/PECAM-1–positive cells organized the formation of vascular networks in the EB outgrowths. In the presence of additional growth factors, few CD31/PECAM-1–positive cells were seen to be organizing capillary networks, which were twisted and slender (Fig. 4DGo), compared with those in the absence of additional growth factors.



View larger version (58K):
[in this window]
[in a new window]
  		Figure 4. Hepatic morphogenesis derived from outgrowths of EBs consisting of albumin-positive hepatocytes and CD31/PECAM-1–positive endothelial cells expanding into vessel-network structures. (A): Endothelial development-associated gene expression was detected by reverse transcription–polymerase chain reaction analysis and activated during the differentiation of EBs. (B): Immunohistochemical analysis, with anti-albumin (red) and anti-CD31/PECAM-1 (green) antibodies, in mixed cultures of embryonic liver cells in vitro as a control. (C, D): CD31/PECAM-1–positive cells were shown to form a network structure in the presence of growth factors (D) and in the absence of growth factors (C). The outgrowths of EBs at A18 were stained with CD31/PECAM-1 antibodies. Without exogenous growth factors, a part of the outgrowth EBs was shown as vessel-like formation. (E, F): Immunohistochemical analysis of the EB outgrowth at A10 (E) and A18 (F) using anti-albumin (red) and anti-CD31/PECAM-1 (green) antibodies in the absence of any growth factors. Abbreviations: EB, embryoid body; ES, embryonic stem; FL, mouse fetal liver at E15; PECAM-1, platelet-endothelial cell adhesion molecule-1; VEGFR, vascular endothelial growth factor receptor.

 
To analyze the interactions between albumin-producing cells and these endothelial cells, the EB outgrowths at both the early and late stages after plating were stained with anti-albumin and anti-CD31/PECAM-1 antibodies. Using these antibodies discriminated parenchymal or nonparenchymal cells as anti-albumin–positive or anti-CD31/PECAM-1–positive cells, respectively, in mixed control cultures of cells prepared from mouse liver (Fig. 4BGo). Interestingly, the CD31/PECAM-1–positive cells were seen to be migrating in the albumin-positive areas of the EB outgrowths at A10 and made contact with the juxtapositions of the albumin-positive cells (Fig. 4EGo), similar to the situation liver organogenesis in the developing embryo [10]. As can be seen in Figures 4E and 4FGo, albumin-positive cells were proliferating from A10 to A18. The CD31/PECAM-1–positive cells were seen to be proliferating and organizing networks with the spread of the albumin-positive area in the EB outgrowths at A18 (Fig. 4FGo), suggesting that these endothelial cells had a marked influence on formation of hepatic tissue within EBs.

To obtain conclusive evidence that vasculogenesis was necessary for hepatocytes to arise and grow in the EB outgrowth, vasculogenesis was inhibited by addition of thalidomide to the differentiation medium. First, the emergence frequency of contracting cardiomyocytes was significantly lower with the addition of thalidomide (26.7% ± 12.0% at 25 mg/L, 6.8% ± 4.2% at 100 mg/L) at A3 than without thalidomide (99.5% ± 0.5%), suggesting that thalidomide was able to inhibit the differentiation of ES cells to cardiomyocytes. The results of confocal microscopy analysis (Figs. 5A–5CGo) indicated that thalidomide could strongly inhibit the differentiation of CD31/PECAM-1–positive cells in the EB outgrowths compared with the control cultures without thalidomide. In addition, the albumin-positive area was significantly smaller in differentiated EB outgrowths exposed to thalidomide at A18 compared with the control culture in the absence of thalidomide (Fig. 5AGo), and the density and area of the vascular-like network consisting of ES-derived CD31/PECAM-1–positive endothelial cells were much lower in the thalidomide-treated EB outgrowths than in the absence of thalidomide. The expression of VEGFR1, VEGFR2, and PECAM-1 was inhibited by thalidomide in a dose-dependent manner. These results of immunohistochemical and RT-PCR analyses suggested that differentiation to endothelial cells was strongly inhibited by thalidomide. Expression of albumin and TAT was detected in the EBs at A18 in the absence, but not in the presence, of thalidomide (Fig. 5FGo).



View larger version (28K):
[in this window]
[in a new window]
  		Figure 5. Dependence of hepatic morphogenesis depends on angiogenesis or vasculogenesis in the differentiated EBs. (A, B): Immunohistochemical analysis of the EB outgrowths at A18 using anti-CD31/PECAM-1 antibody in the presence of 100 µg/ml thalidomide for 18 days (B) and without thalidomide as a control (A). (C,D):Quantitative analysis of the CD31/PECAM-1–positive area in the EB outgrowths at A18 was performed using the Scion image Beta 4.0.2 software in each of 15 selected individual fields from three independent experiments. Data are given as mean values ± standard error. Student’s t-test for unpaired data was applied as appropriate. Difference of p < .001 was considered significant. (E): Endothelial cell and hepatocyte-associated gene expression was analyzed by reverse transcription–PCR in the thalidomide-treated EB outgrowths of the EBs at A18. PCR amplification of PECAM-1, VEGFR1, VEGFR2, and TAT was carried out for 40 cycles. Amplification of albumin was carried out for 30 cycles. Abbreviations: AL, mouse adult liver; ES, undifferentiated ES cells; FH, mouse fetal heart at E15; FL, mouse fetal liver at E15; GF, growth factor; PCR, polymerase chain reaction; PECAM-1, platelet-endothelial cell adhesion molecule-1; TAT, tyrosine aminotransferase; VEGFR, vascular endothelial growth factor receptor.

 
Furthermore, to address the potential role of endothelial cell differentiation and proliferation in the growth of hepatocytes from ES cells, CBO-P11, a VEGF receptor–specific inhibitor, was added in this system. CD31/PECAM-1–positive cells were reduced by addition of CBO-P11 in the EB outgrowths at A18 compared with the control (Figs. 6A–6CGo). In the presence of CBO-P11, the morphology of the small CD31/PECAM-1–positive area was truncated and disconnected (Fig. 6BGo). Corresponding to the CD31/PECAM-1–positive cell populations, no albumin-positive cells were observed in the CBO-P11–treated EB outgrowths, whereas there were many albumin-positive cells in the control (Figs. 6A, 6B, 6DGo). The expression of PECAM-1 was significantly lower in the CBO-P11–treated EB outgrowths than in the control without CBO-P11. Interestingly, no expression of albumin or TAT was detected in the EBs at A18 in the presence of CBO-P11 (Fig. 6FGo). The results of these experiments involving treatment with thalidomide and CBO-P11 suggest that CD31/PECAM-1–positive cells have a crucial role in the hepatic differentiation of ES cells.



View larger version (38K):
[in this window]
[in a new window]
  		Figure 6. Lack of induction of hepatic morphogenesis by vascular endothelial growth factor inhibitor in the differentiated EBs. (A, B): Immunohistochemical analysis of the EB outgrowths at A18 using anti-CD31/PECAM-1 antibody in the presence of 10 µM CBO-P11 for 18 days (B) and without CBO-P11 as a control (A). (C, D): Quantitative analysis of the CD31/PECAM-1–positive area in the EB outgrowths at A18 was performed using the same method as that for the thalidomide experiments in each of nine individual fields selected from three independent experiments. (E): Endothelial cell and hepatocyte-associated gene expression was analyzed by RT-PCR in the thalidomide-treated EB outgrowths at A18. PCR amplification of PECAM-1 and TAT was carried out for 40 cycles. Amplification of albumin was carried out for 30 cycles. Abbreviations: AL, mouse adult liver; EB, embryoid body; ES, undifferentiated embryonic stem cells; FH, mouse fetal heart at E15; FL, mouse fetal liver at E15; PECAM-1, platelet-endothelial cell adhesion molecule-1; RT-PCR, reverse transcription–polymerase chain reaction; TAT, tyrosine aminotransferase.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The purpose of this study was to devise an in vitro system that would allow liver morphogenesis from ES cells, reproducing the events of liver development in vivo. We first considered it necessary to promote the differentiation of outgrowths from EBs, derived from dissociated ES cells, to cardiomyocytes at high efficiency. Selected sublines from the parental ES cells showed a high frequency of emergence of cardiomyocytes and albumin-positive cells, whereas the frequency of cardiomyocyte emergence from the parental ES cells was not so high because of the heterogeneity of the ES cell culture in which albumin-positive cells failed to appear. The same effect was observed in our culture system, suggesting that the initial pluripotency of ES cells contributed to the differentiation of EBs to beating cardiomyocytes, and after induction to mesodermal lineages hepatic differentiation and maturation occurred in the EB outgrowths. Naggy et al. [23] described that recloned ES cell sublines could contribute significantly to the production of chimeric mice and for germ-line transmission in these mice compared with the parental line and could also become a complete body using ES cell–tetraploid aggregation [23, 24], because after a high number of passages, an ES cell culture is a heterogeneous mixture of undifferentiated and differentiated populations. It is very important for undifferentiated and pluripotent ES cells to be present in these cultures for differentiation not only to cardiomyocytes but also to albumin-producing hepatocytes and endothelial cells, corresponding to the various developmental stages of the liver. We tested several sublines of ES cells for their efficiency in the production of chimeric mice that would have the potential for germ-line transmission and a high frequency of cardiomyocyte emergence. It is interesting that the ES cell sublines that transmitted the germ line in chimeric mice at high efficiency corresponded to those with a frequency of cardiomyocyte emergence of almost 100%. The potential of ES cells to transmit the germ line in chimeric mice corresponded to the frequency of cardiomyocyte emergence in the EB outgrowths. We showed that albumin expression data in both emergence and non-emergence of cardiomyocytes, as shown in Figure 1BGo, although cardiomyocyte ablation and blocking cardiomyocyte differentiation experiments are very interesting. However, we consider that subclone screening for the frequency of emergence of cardiomyocytes from the parental murine ES cells would be useful for establishing an in vitro model of hepatic morphogenesis.

The number of albumin-producing cells increased cumulatively in the expanding vascular network area during differentiation to the late stage. It has been clarified that in vitro differentiation of murine ES cells within EBs leads to complex structures that can mimic the normal developmental process of the early embryo, in particular vasculogenesis and hematopoiesis, although no details of liver morphogenesis have been reported [25–27]. Our present results indicated that expansion of the endothelial cell network derived from ES cells plays an important role in the proliferation of hepatocytes and also liver morphogenesis in vitro, reproducing the events that occur in vivo. Furthermore, our liver morphogenesis system does not involve simple coculture of ES cells with endothelial cells prepared from liver sinusoids or blood vessels but is a novel system that utilizes the differentiation of pluripotent ES cells to cardiomyocytes to support subsequent differentiation to endothelial cells and hepatocytes. The interaction between hepatocytes and endothelial cells in liver organogenesis has already been reported by Matsumoto et al. [10]. Our in vitro system for the induction of liver morphogenesis from ES cells closely corresponds to the natural events of liver development that occur in vivo, as shown in Figure 7Go. Thalidomide, an inhibitor of angiogenesis, inhibited the differentiation and proliferation of CD31/PECAM-1–positive cells in EB outgrowths. However, there is a possibility that thalidomide may have directly suppressed the differentiation of hepatocytes. Therefore, to confirm the crucial role of endothelial cells in hepatic differentiation and maturation, we examined the effect of CBO-P11, a potent VEGF signal-specific inhibitor [28–30], in our culture system. CBO-P11 strongly suppressed the differentiation and proliferation of CD31/PECAM-1–positive cells, corresponding to endothelial cells, during EB differentiation, and consequently, the differentiation of albumin-positive cells, corresponding to hepatocytes, was completely blocked. These results were consistent with the data obtained from the thalidomide experiment.



View larger version (38K):
[in this window]
[in a new window]
  		Figure 7. Illustrations of (A) in vivo liver development and (B) our in vitro system for the construction of hepatic organogenesis using murine ES cells. Abbreviations: ES, embryonic stem; FGF, fibroblast growth factor.

 
The process of organogenesis relies on the presence of specific microenvironments. However, it is difficult to reconstruct such microenvironments in vitro simply by addition of excess free molecules, such as FGF, HGF, and oncostatin M. Strategies for adding growth factors known as liver development inducers to the differentiation medium or for introducing an expression vector of a liver-specific master gene into ES cells can induce the expression of several specific genes in the area of cell interaction, which means that it is difficult to induce the differentiation of ES cell cultures to more than two cell lineages, such as hepatocytes and sinusoidal endothelial cells, through addition of these factors. These kinds of strategies make it impossible, or at least very difficult, to reconstruct target morphogenesis or to induce natural target cells with specific multiple functions. Therefore, no additional growth factors were used in our experiments. We succeeded in reconstructing in vitro the process of liver morphogenesis that involved at least three different types of cell populations: cardiomyocytes, endothelial cells, and hepatocytes. Initiation of liver organogenesis in vivo occurs in the septum transversum. The septum transversum mesenchyme also has important roles in liver organogenesis, such as production of HGF [9, 31]. In our present study, strong expression of HGF was detected in the ES differentiation system, as shown in Figure 2FGo. Although we detected many fibroblastic cells in this system, it was unclear whether some of these cells corresponded to the septum transversum. With regard to liver function, we were able to demonstrate ammonia degradation activity in this liver differentiation system (Fig. 2GGo). Unlike a primary hepatocyte culture, which contains almost 100% hepatocytes, our system contains a heterologous population including hepatocytes, endothelial cells, cardiomyocytes, and so on. However, the level of hepatic function, such as ammonia degradation, in each individual hepatocyte was higher in our differentiation system than in a primary culture, suggesting that hepatocyte–endothelial cell contact is very important for the generation of full hepatic function in hepatocytes, as well as for liver development and proliferation in the embryo. Generally, a hepatocyte primary culture has a short life span, shows no proliferation, and has low hepatic function. Therefore, we consider that a hepatocyte primary culture as a single-cell source is not sufficient for creation of a bioartificial liver system and that nonparenchymal cell populations are also necessary for reproducing the complex structure and polarity of the liver seen in vivo.

Here, we established a novel system for liver organogenesis from murine ES cells based on embryological events, i.e., with contributions from cardiac mesoderm and endothelial cell lineages, which were also derived from the ES cells. Furthermore, it has been difficult up to now to culture hepatocytes prepared from adult or embryonic liver in vitro for a long period, as well as to maintain the multiple functions characteristic of the liver. This is one of the major obstacles to the development of a bioartificial liver system. Our system makes it possible to culture ES cell–derived hepatocytes for a long period, at least for more than 30 days, and these cells are able maintain a high degree of hepatic function (Fig. 2FGo). This innovative system will be useful for creation of liver embryology and regeneration systems as well as for the development of a bioartificial liver system for bridging use in patients waiting for a liver donor and for drug-metabolism assays.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We are grateful to Prof. Nobuaki Yoshida and Prof. Yoichiro Iwakura (Institute of Medical Science, University of Tokyo, Toyko) for providing E14.1 ES cells, Prof. Hisato Kondo (Institute for Molecular and Cellular Biology, Osaka University, Osaka, Japan) for NHL7 cells, RIKEN Cell Bank for STO and HePa 1-6 cell lines, and General Research Laboratory, Shinshu University School of Medicine, Nagano, Japan, for technical assistance. This study was supported by grants from the Ministry of Education, Sports, Science and Technology of Japan (Tokyo) (15700314; 13470150, Grant-in-Aid for 21st Century COE program by the above ministry), Hokuto Foundation of Bioscience (Nagano, Japan), and Foundation of Shinshu Igakushinko (Matsumoto, Japan).


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zaret KS. Regulatory phases of early liver development: paradigms of organogenesis. Nat Rev Genet 2002;3:499–512.[CrossRef][Medline]

  2. Reif S, Terranova VP, el-Bendary M et al. Modulation of extracellular matrix proteins in rat liver during development. Hepatology 1990;12:519–525.[Medline]

  3. Kamiya A, Kojima N, Kinoshita T et al. Maturation of fetal hepatocytes in vitro by extracellular matrices and oncostatin M: induction of tryptophan oxygenase. Hepatology 2002;35:1351–1359.[CrossRef][Medline]

  4. Gualdi R, Bossard P, Zheng M et al. Hepatic specification of the gut endoderm in vitro: cell signaling and transcriptional control. Genes Dev 1996;10:1670–1682.[Abstract/Free Full Text]

  5. Couvelard A, Bringuier AF, Dauge MC et al. Expression of integrins during liver organogenesis in humans. Hepatology 1998;27:839–847.[CrossRef][Medline]

  6. Jung J, Zheng M, Goldfarb M et al. Initiation of mammalian liver development from endoderm by fibroblast growth factors. Science 1999; 284:1998–2003.[Abstract/Free Full Text]

  7. Fukuda-Taira S. Hepatic induction in the avian embryo: specificity of reactive endoderm and inductive mesoderm. J Embryol Exp Morphol 1981;63:111–125.[Medline]

  8. Douarin NM. An experimental analysis of liver development. Med Biol 1975;53:427–455.[Medline]

  9. Rossi JM, Dunn NR, Hogan BL et al. Distinct mesodermal signals, including BMPs from the septum transversum mesenchyme, are required in combination for hepatogenesis from the endoderm. Genes Dev 2001;15:1998–2009.[Abstract/Free Full Text]

  10. Matsumoto K, Yoshitomi H, Rossant J et al. Liver organogenesis promoted by endothelial cells prior to vascular function. Science 2001;294:559–563.[Abstract/Free Full Text]

  11. Sherer GK. Tissue interaction in chick liver development: a reevaluation, I. Epithelial morphogenesis: the role of vascularity in mesenchymal specificity. Dev Biol 1975;46:281–295.[CrossRef][Medline]

  12. Bankston PW, Pino RM. The development of the sinusoids of fetal rat liver: morphology of endothelial cells, Kupffer cells, and the transmural migration of blood cells into the sinusoids. Am J Anat 1980;159:1–15.[CrossRef][Medline]

  13. Enzan H, Himeno H, Hiroi M et al. Development of hepatic sinusoidal structure with special reference to the Ito cells. Microsc Res Tech 1997;39:336–349.[CrossRef][Medline]

  14. Hamazaki T, Iiboshi Y, Oka M et al. Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett 2001;497:15–19.[CrossRef][Medline]

  15. Yamamoto H, Quinn G, Asari A et al. Differentiation of embryonic stem cells into hepatocytes: biological functions and therapeutic application. Hepatology 2003;37:983–993.[CrossRef][Medline]

  16. Yamada T, Yoshikawa M, Kanda S et al. In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green. STEM CELLS 2002;20:146–154.[Abstract/Free Full Text]

  17. Yin Y, Lim YK, Salto-Tellez M et al. AFP(+), ESC-derived cells engraft and differentiate into hepatocytes in vivo. STEM CELLS 2002;20:338–346.[Abstract/Free Full Text]

  18. Jones EA, Tosh D, Wilson DI et al. Hepatic differentiation of murine embryonic stem cells. Exp Cell Res 2002;272:15–22.[CrossRef][Medline]

  19. Chinzei R, Tanaka Y, Shimizu-Saito K et al. Embryoid-body cells derived from a mouse embryonic stem cell line show differentiation into functional hepatocytes. Hepatology 2002;36:22–29.[CrossRef][Medline]

  20. Lavon N, Yanuka O, Benvenisty N. Differentiation and isolation of hepatic-like cells from human embryonic stem cells. Differentiation 2004;72:230–238.[CrossRef][Medline]

  21. Horai R, Asano M, Sudo K et al. Production of mice deficient in genes for interleukin (IL)-1{alpha}, IL-1ß, IL-1{alpha}/ß, and IL-1 receptor antagonist shows that IL-1ß is crucial in turpentine-induced fever development and glucocorticoid secretion. J Exp Med 1998;187:1463–1475.[Abstract/Free Full Text]

  22. Itoh H, Abo T, Sugawara S et al. Age-related variation in the proportion and activity of murine liver natural killer cells and their cytotoxicity against regenerating hepatocytes. J Immunol 1988;141:315–323.[Abstract]

  23. Nagy A, Rossant J, Nagy R et al. Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc Natl Acad Sci U S A 1993;90:8424–8428.[Abstract/Free Full Text]

  24. Auerbach W, Dunmore JH, Fairchild-Huntress V et al. Establishment and chimera analysis of 129/SvEv- and C57BL/6-derived mouse embryonic stem cell lines. Biotechniques 2000;29:1024–1028.[Medline]

  25. Wartenberg M, Gunther J, Hescheler J et al. The embryoid body as a novel in vitro assay system for antiangiogenic agents. Lab Invest 1998;78:1301–1314.[Medline]

  26. Hirashima M, Kataoka H, Nishikawa S et al. Maturation of embryonic stem cells into endothelial cells in an in vitro model of vasculogenesis. Blood 1999;93:1253–1263.[Abstract/Free Full Text]

  27. Wang R, Clark R, Bautch VL. Embryonic stem cell-derived cystic embryoid bodies form vascular channels: an in vitro model of blood vessel development. Development 1992;114:303–316.[Abstract]

  28. Bikfalvi A. Recent developments in the inhibition of angiogenesis: examples from studies on platelet factor-4 and the VEGF/VEGFR system. Biochem Pharmacol 2004;68:1017–1021.[CrossRef][Medline]

  29. Bello L, Lucini V, Costa F et al. Combinatorial administration of molecules that simultaneously inhibit angiogenesis and invasion leads to increased therapeutic efficacy in mouse models of malignant glioma. Clin Cancer Res 2004;10:4527–4537.[Abstract/Free Full Text]

  30. Zilberberg L, Shinkaruk S, Lequin O et al. Structure and inhibitory effects on angiogenesis and tumor development of a new vascular endothelial growth inhibitor. J Biol Chem 2003;278:35564–35573.[Abstract/Free Full Text]

  31. Andermarcher E, Surani MA, Gherardi E. Co-expression of the HGF/SF and c-met genes during early mouse embryogenesis precedes reciprocal expression in adjacent tissues during organogenesis. Dev Genet 1996;18:254–266.[CrossRef][Medline]

Received on October 23, 2004; accepted for publication on March 20, 2005.




This article has been cited by other articles:


Home page
 Stem CellsHome page
S. Snykers, J. De Kock, V. Rogiers, and T. Vanhaecke
In Vitro Differentiation of Embryonic and Adult Stem Cells into Hepatocytes: State of the Art
Stem Cells, March 1, 2009; 27(3): 577 - 605.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
I. Drobinskaya, T. Linn, T. Saric, R. G. Bretzel, H. Bohlen, J. Hescheler, and E. Kolossov
Scalable Selection of Hepatocyte- and Hepatocyte Precursor-Like Cells from Culture of Differentiating Transgenically Modified Murine Embryonic Stem Cells
Stem Cells, September 1, 2008; 26(9): 2245 - 2256.
[Abstract] [Full Text] [PDF]

Home page
 Endocr Relat CancerHome page
D. Thomas, S. Friedman, and R.-Y. Lin
Thyroid stem cells: lessons from normal development and thyroid cancer
Endocr. Relat. Cancer, March 1, 2008; 15(1): 51 - 58.
[Abstract] [Full Text] [PDF]

Home page
 Drug Metab. Dispos.Home page
M. Tsutsui, S. Ogawa, Y. Inada, E. Tomioka, A. Kamiyoshi, S. Tanaka, T. Kishida, M. Nishiyama, M. Murakami, J. Kuroda, et al.
CHARACTERIZATION OF CYTOCHROME P450 EXPRESSION IN MURINE EMBRYONIC STEM CELL-DERIVED HEPATIC TISSUE SYSTEM
Drug Metab. Dispos., April 1, 2006; 34(4): 696 - 701.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogawa, S.
Right arrow Articles by Miyagawa, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogawa, S.
Right arrow Articles by Miyagawa, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS