Stem Cells http://www.peprotech.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Stem Cells Vol. 23 No. 9 October 2005, pp. 1324 -1332
doi:10.1634/stemcells.2005-0085; www.StemCells.com
© 2005 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, Y.
Right arrow Articles by Broxmeyer, H. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, Y.
Right arrow Articles by Broxmeyer, H. E.

SDF-1/CXCL12 Enhances Survival and Chemotaxis of Murine Embryonic Stem Cells and Production of Primitive and Definitive Hematopoietic Progenitor Cells

Ying Guoa,b, Giao Hangoca,b, Huimin Biana,b, Louis M. Pelusa,b, Hal E. Broxmeyera,b

a Department of Microbiology/Immunology, The Walther Oncology Center, Indiana University School of Medicine, Indianapolis, Indiana, USA;
b Walther Cancer Institute, Indianapolis, Indiana, USA

Key Words. Embryonic stem cells • SDF-1/CXCL12 • Apoptosis • Chemotaxis • Differentiation

Correspondence: Hal E. Broxmeyer, Ph.D., Walther Oncology Center, Indiana University School of Medicine, 1044 West Walnut Street, R4-302, Indianapolis, Indiana 46202, USA. Telephone: 317-274-7510; Fax: 317-274-7592; e-mail: hbroxmey{at}iupui.edu


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Understanding embryonic stem cell (ESC) regulation is important for realizing how best to control their growth and differentiation ex vivo for potential therapeutic benefit. Stromal cell–derived factor-1 (SDF-1/CXCL12) and its receptor, CXCR4, have been implicated as important regulators of a number of fetal and adult cell functions, including survival/antiapoptosis and migration/homing of hematopoietic stem and progenitor cells. We hypothesized that the SDF-1/CXCL12–CXCR4 axis would also be important for regulation of murine ESC functions. ESCs secreted low levels of SDF-1/CXCL12 and expressed low levels of CXCR4; however, both increased with differentiation of ESCs. Endogenously produced/released SDF-1/CXCL12 enhanced survival/antiapoptosis of ESCs in the presence of leukemia inhibitory factor but absence of serum, and survival/antiapoptosis was further enhanced by exogenous administration of SDF-1/CXCL12. Furthermore, SDF-1/CXCL12 induced chemotaxis of ESCs, and chemotaxis could be enhanced by diprotin A inhibition of CD26/dipeptidylpeptidase IV. Endogenous and exogenous SDF-1/CXCL12 enhanced embryoid body production of primitive and definitive erythroid, granulocyte-macrophage, and multipotential progenitors. SDF-1/CXCL12 did not noticeably affect production of hemangioblasts. These results demonstrate functional activities of SDF-1/CXCL12 on survival, chemotaxis, and hematopoietic differentiation of murine ESCs that may be relevant for their ex vivo manipulation.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Stromal cell–derived factor-1 (SDF-1/CXCL12), a CXC chemokine, was originally cloned from bone marrow (BM) stromal cells [1] and later found to be a pre–B-cell stimulation factor [2]. Most chemokines bind more than one receptor, and many receptors are bound by multiple chemokines. SDF-1/CXCL12 is one of the few chemokines that binds only to one receptor, CXCR4. Both SDF-1/CXCL12–/– and CXCR4–/– knockout mice share the same phenotype and die in utero with severe abnormalities in B lymphopoiesis and myelopoiesis in BM, cardiogenesis, and vascular and cerebellar development, substantiating the one chemokine–one receptor model for SDF-1/CXCL12–CXCR4 [3–6]. These gene-knockout studies, in addition to other in vivo and in vitro analyses, implicated SDF-1/CXCL12 in chemotaxis and migration of hematopoietic stem cells (HSCs) and myeloid progenitor cells (MPCs) [7–10]. Our previous studies showed that SDF-1/CXCL12 enhanced survival/antiapoptosis of human BM and cord blood (CB) CD343+ and CD34+ cells, murine and human BM MPCs, and human growth factor–dependent MO7e cells [11–14]. Moreover, murine MPCs expressing an SDF-1/CXCL12 transgene under a Rous sarcoma virus promoter demonstrated enhanced survival and reduced apoptosis compared with wild-type control MPCs [11]. These SDF-1/CXCL12 survival–enhancing effects were mediated through CXCR4 and G{alpha}i proteins, as determined by use of species-specific antibodies for mouse or human CXCR4, by the antagonist AMD3100, which blocks binding and intracellular signaling initiated by SDF-1/CXCL12 at both the mouse or human CXCR4 receptor, and by sensitivity to pertusis toxin [11, 12].

In the process of evaluating factors that influence SDF-1/CXCL12 actions, we identified CD26/dipeptidylpeptidase IV (DPPIV), a membrane-bound N-terminal ectopeptidase able to cleave SDF-1/CXCL12 [15–19], as a regulatory cell surface antigen [17]. CD26 truncated SDF-1/CXCL12 and inactivated the chemotaxis-inducing activity of SDF-1/CXCL12 for CD34+ human MPCs [17] and for Sca1+Lin– mouse BM cells [20]. Truncated SDF-1/CXCL12 blocked the chemotaxis-inducing activity of full-length SDF-1/CXCL12 for human CD34+ MPCs [17]. SDF-1/CXCL12 cleavage by CD26/DPPIV on HSCs and MPCs acts as a regulatory event for mobilization, migration, homing, and engraftment of HSCs and MPCs [20–22] and may also be involved in SDF-1/CXCL12–enhanced survival of these cells.

Embryonic stem cells (ESCs) are pluripotent cells derived from the inner cell mass [23]. They are capable of undergoing unlimited numbers of symmetrical divisions without differentiation; in addition, they can give rise to differentiated cell types that are derived from all three primary germ layers of the embryo [23]. In embryonic development, the first hematopoietic and endothelial cells are derived from a common mesodermal precursor, the hemangioblast [24]. Little is known about the effect of SDF-1/CXCL12 on regulation of ESC survival/antiapoptosis, hemangioblast formation, and differentiation. Because SDF-1/CXCL12–/– and CXCR4–/– knockout mice die at E17.5 and suffer major organ developmental abnormalities [3–6], we studied the effects of SDF-1/CXCL12 and CXCR4 on survival/apoptosis, chemotaxis, and differentiation of murine ESCs.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell Culture and Embryoid Body Formation
E14 and CCE ESC lines are derived from 129/SV mouse embryos [25, 26]. E14 and CCE ESC lines were cultured on gelatinized plates in Dulbecco’s modified Eagle’s medium (DMEM) with 15% ESC-qualified fetal calf serum (FCS; HyClone, Logan, UT, http://www.hyclone.com), 5.5 x 10–2 mM ß-mercaptoethanol (Gibco BRL, Carlsbad, CA, http://www.gibcobrl.com), and 103 U/ml leukemia inhibitory factor (LIF) (ESGRO; Chemicon International, Temecula, CA, http://www.chemicon.com). E14 ESCs were stained with anti-mouse Oct-4 antibody (Chemicon International) to make sure the cells were undifferentiated. Forty-eight hours before primary embryoid body (EB) formation, ESCs were transferred to Iscove’s modified Dulbecco’s medium (IMDM; Gibco BRL) with 15% FCS (HyClone), 5.5 x 10–2 mM ß-mercaptoethanol (Sigma, St. Louis, http://www.sigmaaldrich.com) and 103 U/ml LIF. For primary differentiation assays, ESCs were plated in bacterial-grade Petri dishes at 1,000 to 2,000 cells per ml in 1% methylcellulose-based (StemCell Technologies, Vancouver, British Columbia, Canada, http://www.stemcell.com) differentiation media that included IMDM, 2 mM glutamine, penicillin/streptomycin (100 U per ml/100 µg per ml), 5% protein-free hybridoma medium (PFHM-II; Gibco BRL), 200 mg/ml iron-saturated holo-transferrin, 5 mg/ml ascorbic acid, 450 µM monothioglycerol (Sigma), and 15% differentiation FCS (StemCell Technologies), and the cells incubated for 5–7 days at 37°C in 5% CO2. EBs were viewed by microscopy before further experimentation.

Analysis of SDF-1/CXCL12 Protein Secretion During EB Formation
Undifferentiated ESCs were allowed to reach 50% confluency before being cultured as described above. Supernatants were collected after 48 hours and stored at –80°C for further analysis. ESCs were plated in culture for EB formation and supernatant was collected at days 1 through 6 of EB differentiation and stored at –80°C for further analysis. Mouse SDF-1/CXCL12 was quantitated using enzyme-linked immunosorbent assay (ELISA) as previously described [27]. Sample concentrations were calculated from the linear regression equation of a recombinant murine SDF-1{alpha}/CXCL12 (PeproTech Inc., Rocky Hill, NJ, http://www.peprotech.com) standard curve. The SDF-1{alpha}/CXCL12 capture mAb 79018 was raised against full-length recombinant murine SDF-1{alpha}/CXCL12. After calculation, final amounts of SDF-1/CXCL12 were normalized to cell numbers. Experiments were done with the E14 and CCE cell lines.

CXCR4 and CD26 mRNA and Protein Expression
E14 ESCs were cultured and EBs formed as described above. Cells were collected from ESC cultures and day 1 to day 6 EBs. RNA was extracted for real-time reverse transcription–polymerase chain reaction (RT-PCR) analysis. Primers were as follows: forward: 5' CGGCTGTAGAGCGAGTGTTG 3', reverse: 5' CCCCACTTCTTCAGAGTAGTTATCAGA 3', probe: 6FAM-CAT GGAACCGATCAGTGMGBNFQ. Quantitative RT-PCR was performed using the Applied Biosystems Mix (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com) according to the manufacturer’s protocol. Flow cytometry analysis for surface CXCR4 expression was performed using anti-mouse CXCR4 antibody (BD Biosciences, San Diego, http://www.bdbiosciences.com). ESCs were also stained with anti-mouse CXCR4 and anti-mouse Oct-4 antibody and analyzed by flow cytometry to make sure the CXCR4+ and CXCR4– cells were both undifferentiated [28].

E14 cells were collected and RNA was extracted for real-time PCR analysis. Primers were as follows: forward: 5' GAGACC-GTGGAAGGTTCTTCTG 3', reverse: 5' TTGGCACGGTGAT-GATGGT 3', probe: 6FAMACTGCTTGGTGTCGCTMGB-NFQ. Real-time RT-PCR was done as noted previously. Flow cytometry analysis of surface CD26 used anti-mouse CD26 antibody (BD Biosciences).

Survival Assay for ESCs
ESC growth depends on serum. After withdrawal of serum from plates with <25% confluency, 95% of ESCs die within 96 hours. To determine the effect of SDF-1/CXCL12 on ESC survival, studies evaluated control medium, 100 ng/ml SDF-1/CXCL12, 1 µM AMD3100 (AnorMED Inc., Langley, British Columbia, Canada, http://www.anormed.com), or 100 ng/ml SDF-1/CXCL12 plus 1 µM AMD3100. AMD3100 is an antagonist of SDF-1/CXCL12 binding to CXCR4 [29, 30], and we have shown that AMD3100 blocks the hematopoietic progenitor cell survival-enhancing effects and intracellular signaling induced by SDF-1/CXCL12 [11–13]. Reagents were added at the beginning of the experiment, and ESC cultures were initiated without serum in 1% methylcellulose-based DMEM with 5.5 x 10–2 mM 2-ME and 103 U/ml LIF at 2,000 cells per ml. Serum was added at 0, 24, 48, or 96 hours to each group and colonies scored 7 days later. After 7 days, ESCs were collected and the undifferentiated status of the cells checked by staining of the cells with anti-mouse Oct-4 antibody.

Apoptosis Assay for ESCs
To analyze ESC apoptosis after serum withdrawal, cell cultures were initiated without serum but in the presence of LIF. Reagents were added at the beginning of culture as follows: control medium, 100 ng/ml SDF-1/CXCL12, 1 µM AMD3100, or 100 ng/ml SDF-1/CXCL12 and 1 µM AMD3100. Cells were collected at days 1, 2, 3, and 4 after serum withdrawal and were stained with Annexin V antibody (BD Biosciences). After withdrawal of serum for 4 days, ESCs were also stained with anti–Oct-4 to make sure the cells were undifferentiated.

ESC Migration Assay
Chemotaxis assay of E14 ESCs was performed using chambers separated by 8-µm pore filters. ESCs were placed in the upper chamber at 5 x 105 cells per well, and cells were assessed for migration to 0, 25, 50, 100, 200, 400, 600, 800, 1,000, or 1,200 ng/ml SDF-1/CXCL12 in the lower chamber. As a control for chemotaxis, cultures were also done with 400 ng/ml SDF-1/CXCL12 in both the top and bottom chambers or only in the top chamber. The experiments involved three groups: control; diprotin A (an inhibitor of CD26 peptidase activity [17, 20, 22]) pretreated cells (5 mg/ml for 30 minutes at 37°C); or AMD3100 [11–13] pretreated cells (1 µM for 30 minutes at 37°C).

Hemangioblast Assays
EBs were allowed to form as described above. To generate hemangioblast colonies, disaggregated day-3 EB cells were plated at 1 x 105 cells per ml in IMDM-based media with 10% differentiation FCS, D4T cell–conditioned media (D4T cells were kindly provided by Dr. Gordon Keller, Mt. Sinai Hospital, New York), stem cell factor (SCF) (100 ng/ml; PeproTech Inc.), and vascular endothelial growth factor (5 ng/ml; PeproTech Inc.). Colonies were counted after 4–5 days of culture at 37°C in 5% CO2 [24]. The colonies were picked after counting and checked for expression of brachyury, flk-1, and scl-1 to prove these were hemangioblasts [24].

Primitive and Definitive Hematopoietic Progenitor Assays
EBs formed as described above. To generate primitive erythroid (p-BFU-E) colonies, disaggregated day-6 EB cells were plated at 1–2.5 x 105 cells per ml in 1% methylcellulose-based media with 15% serum (Animal Technologies, Inc., Tyler, TX, http://www.animaltechnologies.com) and 5 U/ml erythropoietin. Colonies were counted after 5 days of culture at 37°C in 5% CO2. To analyze definitive erythroid (d-BFU-E), granulocyte-macrophage (CFU-GM), and multipotential granulocyte/erythroid/macrophage/megakaryocyte (CFU-GEMM) colony formation, disaggregated day-6 EB cells were plated at 5 x 105 cells per ml in 1% methylcellulose-based media with 15% differentiated FCS, erythropoietin (5 U/ml), SCF (100 ng/ml), interleukin-3 (10 ng/ml), GM-CSF (10 ng/ml), and M-CSF (5 ng/ml). Cytokines were purchased from PeproTech Inc. Colonies were counted after 7 days of culture at 37°C in 5% CO2. p-BFU-E and definitive progenitor (BFU-E, CFU-GM, and CFU-GEMM) colonies were scored based on colony morphology.

Statistical Analysis
Significant differences were determined by t-test comparisons for at least three experiments each.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Analysis of SDF-1/CXCL12 Release and CXCR4 Expression in ESCs and EBs
To determine whether SDF-1/CXCL12 might play a role in ESC growth and survival and EB formation, we evaluated ESC lines for production/secretion of SDF-1/CXCL12 and CXCR4 expression. Both day-0 undifferentiated E14 and CCE ESCs and day-1 and -2 Ebs generated low levels of SDF-1/CXCL12 (Figs. 1A, 1BGo). After day 2, the levels of SDF-1/CXCL12 in the culture media increased and reached maximum on day 3, after which the levels decreased. Before normalization by cell number, the concentration of SDF-1/CXCL12 in the supernatant increased to day-3 EBs and remained at that level until day 6. Analysis of cultures of E14 ESCs demonstrated that cells that formed within EBs expressed mRNA for CXCR4 (Table 1Go) and expressed surface CXCR4 protein (Fig. 1CGo). Expression of CXCR4 started to increase in day-4 EBs, peaked at day 5, and then declined but remained elevated. Figure 1DGo shows dot plots of CXCR4 expression by flow cytometry. Both CXCR4+ and CXCR4– undifferentiated ESCs (at day 0) highly expressed Oct-4 (Fig. 1EGo), which indicates that the ESCs are undifferentiated at that time.



View larger version (23K):
[in this window]
[in a new window]
  		Figure 1. ESC/EB cell release of SDF-1/CXCL12 and CXCR4 expression. SDF-1/CXCL12 secretion from day 0 to day 6 differentiation of (A) E14 and (B) CCE ESC lines as measured by enzyme-linked immunosorbent assay. Results are shown as mean ± SD for four (CCE cell line) and five (E14 cell line) experiments, each assessed in triplicate. (C): CXCR4 surface protein expression for E14 cells as determined by flow cytometry. Day 0 represents the population of undifferentiated cells, with the days shown on the x-axis indicating days of EB cell differentiation. (D): Dot plot for CXCR4 expression: (a) isotype control, (b) day-0 ESCs, and (c) day-2 EBs. (E): Oct-4 expression of CXCR4+ and CXCR4– cells: (a) isotype control and (b) day-0 ESCs. Significant increase for (A, B, and D) compared with day-0 ESCs, *p < .01; **p < .05. Abbreviations: EB, embryoid body; ESC, embryonic stem cell; SDF-1/CXCL12, stromal cell–derived factor-1.

 

View this table:
[in this window]
[in a new window]
  		Table 1. CXCR4 mRNA expression of E14 cells from days 0–6 as determined by real-time polymerase chain reaction
 
Influence of SDF-1/CXCL12 on ESC Survival and Apoptosis
Because ESCs release SDF-1/CXCL12 and express CXCR4, albeit at low levels, we hypothesized that SDF-1/CXCL12 would enhance survival of ESC colony formation and would demonstrate antiapoptosis activity on ESCs in suspension culture. To test this hypothesis, we assessed the effects of SDF-1/CXCL12, the CXCR4 antagonist AMD3100, and the combination of SDF-1/CXCL12 and AMD3100 on the survival of ESC colony formation subjected to delayed addition of serum but maintained in the presence of LIF (Fig. 2AGo). Exogenous SDF-1/CXCL12 enhanced survival of ESC colony-forming cells subjected to delayed addition of serum throughout the 4-day culture period. Antagonism of the CXCR4 receptor by AMD3100 decreased survival of ESC colonies in the absence and presence of exogenously added SDF-1/CXCL12. After counting, collected ESCs highly expressed Oct-4 demonstrating the undifferentiated nature of these cells (Fig. 2BGo). We next tested the effects of SDF-1/CXCL12, AMD3100, and SDF-1/CXCL12 plus AMD3100 on apoptosis of ESCs in suspension culture with LIF without addition of serum by assessing the percentage of Annexin V–positive cells (Fig. 3AGo). Withdrawal of serum induced apoptosis, but the presence of SDF-1/CXCL12 decreased serum withdrawal–induced apoptosis. AMD3100 enhanced apoptosis in the absence and presence of SDF-1/CXCL12. After withdrawal of serum for 4 days, ESCs still highly expressed Oct-4 (Fig. 3BGo). The AMD3100 results in Figures 2Go and 3Go suggest that endogenously produced SDF-1/CXCL12 enhances survival of ESC colony-forming cells and antiapoptosis of ESCs subjected to serum withdrawal. Moreover, exogenously added SDF-1/CXCL12 enhances survival above that of the SDF-1/CXCL12 produced by the ESCs themselves.



View larger version (25K):
[in this window]
[in a new window]
  		Figure 2. Influence of SDF-1/CXCL12 on survival of ESC colony formation subjected to delayed addition of serum. (A): E14 ESCs were cultured without serum, and serum added at day 0, 1, 2, or 4 after the start of culture. Colonies formed by ESCs were counted 7 days after the addition of serum. Results shown are the average of three experiments, each assessed in triplicate. Experimental points were compared with the time 0 of the control group: (a) p < .05; or to the control group of that specific day, (b) p < .05. AMD3100+SDF-1 group was compared with the SDF-1 group from the same day, (c) p < .05. (B): ESCs were collected after culture for 7 days and stained with anti-mouse Oct-4 antibody and isotype antibody. Abbreviations: ESC, embryonic stem cell; SDF-1/CXCL12, stromal cell–derived factor-1.

 


View larger version (23K):
[in this window]
[in a new window]
  		Figure 3. Influence of SDF-1/CXCL12 on apoptosis of ESCs subjected to serum withdrawal. (A): E14 ESCs were cultured without serum. Cells were collected at day 1, 2, 3, or 4 after serum withdrawal. Cells were stained with Annexin V: (a) p < .05, control group of each time point compared with day 1 control; (b) p < .05, each experiment group compared with the control group of the same day; (c) p < .05, AMD3100+SDF-1 group compared with SDF-1 group of the same day. (B): After withdrawal of serum for 4 days, cells were collected and stained with anti-mouse Oct-4 antibody or isotype control antibody. Abbreviations: ESC, embryonic stem cell; SDF-1/CXCL12, stromal cell–derived factor-1.

 
Chemotaxis of ESCs
The SDF-1/CXCL12–CXCR4 axis is important for homing and engraftment for HSCs [10, 22, 31]. Because ESCs express CXCR4, we hypothesized that SDF-1/CXCL12 could act as a chemotactic agent for ESCs. Based on our previous studies demonstrating a role for CD26 in affecting the activity of SDF-1/CXCL12 by cleaving SDF-1 and generating a SDF-1/CXCL12 antagonist of migration [17, 20, 22], we evaluated CD26 expression on ESCs hypothesizing that if CD26 were present on ESCs, that it might influence the chemotactic activity of SDF-1/CXCL12 for ESCs. We observed CD26 mRNA in ESCs by real-time RT-PCR (data not shown) and noted dim surface expression of CD26 protein (Fig. 4AGo). SDF-1/CXCL12 induced chemotaxis of ESCs in a characteristic dose-dependent, bell-shaped manner with maximal chemotactic response seen at 400–600 ng/ml SDF-1/CXCL12 (Fig. 4BGo). Little or no migration to the bottom chamber is noted with 400 ng/ml SDF-1/CXCL12 in the upper and bottom, or upper chamber only, demonstrating that SDF-1/CXCL12 is chemotactic rather than chemokinetic for ESCs. Pretreatment of ESCs with AMD3100 blocked the chemotactic response of ESCs, substantiating that SDF-1/CXCL12–induced chemotaxis was mediated through CXCR4. Pretreatment of ESCs with the CD26 inhibitor diprotin A (Fig. 4BGo) greatly enhanced SDF-1/CXCL12–induced chemotaxis of ESCs, suggesting that CD26 on murine ESCs plays a negative role in SDF-1/CXCL12–induced chemotaxis, consistent with the reported results in CB and adult BM stem/progenitor cells [20, 22, 32].



View larger version (17K):
[in this window]
[in a new window]
  		Figure 4. CD26 expression and chemotaxis of ESCs. (A): CD26 surface expression of E14 ESCs was determined by flow cytometry. The Geo mean for isotype is 2.65 verses the 6.87 for the CD26 stain. All ESCs expressed dim levels of CD26. (B): Chemotaxis assays were performed comparing diprotin A–treated ({blacktriangleup}) and AMD3100-treated ({bullet}) and nontreated ({blacksquare}) ESCs. These are the combined results of two to four experiments. t-tests were performed between {blacktriangleup} and {blacksquare} (a, p < .05) and between {bullet} and {blacksquare} (b, p < .05). Abbreviations: ESC, embryonic stem cell; FITC, fluorescein isothiocyanate; SDF-1, stromal cell–derived factor-1.

 
Effects of SDF-1/CXCL12 on ESC-Derived Hemangioblast and Primitive and Definitive Colony Formation
To further evaluate hematopoietic cell differentiation of EB cells, we assessed effects of SDF-1/CXCL12 and/or AMD3100 on hemangioblasts, as well as on primitive and definitive progenitors produced in EBs. Neither SDF-1/CXCL12 nor AMD3100 had an effect on EB production of hemangioblasts (Fig. 5AGo). A representative hemangioblast colony is shown in Figure 5BGo. The hemangioblast nature of the colonies was substantiated by expression of Flk-1 and Scl but not brachyury (Fig. 5CGo) [24]. However, SDF-1/CXCL12 enhanced colony formation of p-BFU-E, d-BFU-E, d-CFU-GM, and d-CFU-GEMM progenitors (Fig. 6Go). AMD3100 significantly decreased colony formation of these EB-produced primitive and definitive progenitor cells in the presence or absence of exogenously added SDF-1/CXCL12. This suggests that endogenous SDF-1/CXCL12 has an enhancing effect on EB production of primitive and definitive progenitors, which can be further increased by exogenously added SDF-1/CXCL12, and that the SDF-1/CXCL12 effects are mediated through CXCR4.



View larger version (35K):
[in this window]
[in a new window]
  		Figure 5. Effects of SDF-1/CXCL12 on embryonic stem cell–derived hemangioblasts. (A): E14 embryoid bodies were dissociated and plated into hemangioblast cultures. Hemangioblast colonies were scored 4 days later. Colony numbers were divided by control group number to determine fold change of control. Experiments were done in triplicate and three independent experiments averaged. (B): The colony shown is a representative hemangioblast. (C): Hemangioblast colonies were collected and checked for expression of Flk-1, Scl, and brachyury markers. Abbreviation: SDF-1/CXCL12, stromal cell–derived factor-1.

 


View larger version (41K):
[in this window]
[in a new window]
  		Figure 6. Effects of SDF-1/CXCL12 on embryonic stem cell colony formation. E14 embryoid bodies were dissociated at day 6 and plated under different culture conditions as shown. p-BFU-E was scored 5 days later, whereas CFU-GM, CFU-GEMM, and d-BFU-E were scored 7 days later. Three independent experiments were done, each in triplicate. Colony numbers were divided by control group number to obtain the fold change from control: (a) p < .05, each experimental group was compared with the control group for each progenitor cell; (b) p < .05, each SDF-1/CXCL12 group was compared with the same progenitor cell group to treatment with SDF-1/CXCL12+AMD3100. Abbreviations: CFU-GEMM, colony-forming units-granulocyte, erythroid, macrophage, megakaryocyte; CFU-GM, colony-forming units-granulocyte, macrophage; d-BFU-E, definitive BFU-E; p-BFU-E, primitive BFU-E; SDF-1/CXCL12, stromal cell–derived factor-1.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Adult stem cells depend on cytokines/chemokines and growth factors for survival, proliferation, and differentiation and for their migration/homing [31, 33]. A great deal is known about the effects of cytokines/chemokines on hematopoietic stem and progenitor cell functions, and this information has been used to good advantage for modulating these cells in the clinical setting, particularly for enhancing transplantation effectiveness [31, 33]. ESCs have extensive self-renewal capacity and can differentiate into all types of tissues [34], making them a potentially valuable source of cells for tissue replacement. However, this potential is still essentially unrealized, especially for replacement of the hematopoietic system. In fact, there is a paucity of information on the regulation of the growth, survival, differentiation, and migration of ESCs. Understanding receptors and the cytokines that can regulate these functional capacities of murine ESCs ex vivo offers the possibility of modulating these effects for preclinical studies. Translating findings attained with murine ESCs to the human ESC system may result in better control of human ESCs for potential clinical benefit.

SDF-1/CXCL12 plays an important role in hematopoiesis, as well as in vascular and cerebellar development and cardiogenesis [4–6], and has a number of hematopoietic functions mediated through its G{alpha}i protein–linked receptor, CXCR4 [7–14]. Our studies now implicate the SDF-1/CXCL12–CXCR4 axis in mediating a number of functional activities of murine ESC lines. Interestingly, we found that murine ESC lines produce low amounts of SDF-1/CXCL12 and express low levels of CXCR4 mRNA and surface protein. However, this low-level expression of SDF-1/CXCL12 and CXCR4 is meaningful in terms of functional activity as demonstrated by our survival/antiapoptosis data. In the presence of LIF, but in the absence or delayed addition of serum, cells maintained their primitive ESC morphology and expression of Oct-4. Using AMD3100, an antagonist of the binding of SDF-1/CXCL12 to CXCR4, in the absence of exogenously added SDF-1/CXCL12, ESC survival was decreased and apoptosis increased. This suggests that endogenous SDF-1/CXCL12 produced/released by ESCs had an effect on the survival/antiapoptosis of these cells. That SDF-1/CXCL12 was active in this effect was clear from the fact that AMD3100 promoted apoptosis of ESCs and blocked survival/antiapoptosis effects of exogenously added SDF-1/CXCL12. Because SDF-1/CXCL12 and CXCR4 are also important for survival of other cell types, including neonatal and adult hematopoietic stem and progenitor cells, it is possible that modulation of this chemokine–chemokine receptor interaction, perhaps in the presence of LIF, will be of use for further studies on the in vitro and in vivo activity of murine ESCs, and this may possibly also be applicable for human ESCs, which are less easy to maintain in viable condition ex vivo than are murine ESCs.

SDF-1/CXCL12 is a cytokine that has been well conserved through evolution, in contrast to other chemokines [35, 36]. This is consistent with most chemokine genes, but not SDF-1/CXCL12, being located on chromosomes in amplified gene clusters [36]. During embryogenesis, CXCR4 is detected as early as E7.5 and is a predominate chemokine receptor at that time [36]. This is consistent with our data that during EB formation, CXCR4 expression starts to dramatically increase when primitive erythroid progenitors appear. During organogenesis, CXCR4 and SDF-1/CXCL12 are detected in the developing neuronal, cardiac, vascular, hematopoietic, and craniofacial systems and show dynamic and complementary expression patterns [37]. Also, a wide variety of tissue pairs express CXCR4 and SDF-1/CXCL12, including mesoderm/ectoderm during gastrulation. This suggests that the SDF-1/CXCL12–CXCR4 axis likely plays an important, if not absolutely critical, role in embryogenesis. In the knockout mouse model for CXCR4, CXCR4-deficient embryos were macroscopically distinguishable from their littermates as early as E13.5 [6], suggesting the importance of this axis at least as early as E13.5.

All cells migrate during development, and it is possible that the SDF-1/CXCL12–CXCR4 axis is involved in movement of these cells within the blastocyst [38]. In fact, SDF-1/CXCL12 and CXCR4 have been shown to regulate mouse germ cell migration and survival [39]. It would be of interest to determine if modulation of this axis would be helpful, alone or in combination with other adhesion or homing mechanisms, in targeting ESCs or their progeny to specific tissue sites in vivo. We recently identified CD26/DPPIV as a modulator of the chemotaxis, mobilization, and homing of murine hematopoietic stem and human and murine progenitor cells. CD26 truncates SDF-1/CXCL12, rendering this truncated chemokine inactive as a chemotactic agent, but with antagonist activity to full-length SDF-1/CXCL12 at CXCR4 [17]. Inhibition of CD26 with small peptide agents, such as diprotin A (Ile-Pro-Ile) or Val-Pyr, or functional deletion of CD26 by gene knockout, decreased G-CSF–induced mobilization of adult MPCs [20, 21] and increased the homing and engraftment capabilities of adult murine BM HSCs [23]. Although CD26 was expressed at a low level on the surface of murine ESCs, it is clear that they had peptidase activity because inhibition of CD26 with diprotin A greatly increased their chemotaxis toward SDF-1/CXCL12. Not only was chemotaxis to SDF-1/CXCL12 enhanced by almost twofold in terms of absolute numbers of cells migrating when diprotin A was used to pretreat the ESCs, but significant chemotaxis to SDF-1/CXCL12 was apparent at extremely low levels of SDF-1/CXCL12, which were not chemotactic to non–CD26-peptidase–inhibited ESCs. This in vitro modulation of CD26 with pretreatment of murine ESCs for only 30 minutes with diprotin A prior to initiating chemotaxis is similar to the dramatic enhancement in homing/engraftment of murine BM stem cells with only a 15-minute pretreatment with diprotin A [22]. CD26 may act, in part, as a brake to SDF-1/CXCL12 migration in vivo, and inhibiting, blocking, or deleting CD26 may be of use to enhance homing of ESCs or their progeny in vivo in a specific manner toward tissues expressing SDF-1/CXCL12. Because SDF-1/CXCL12 is equipotent on human and murine hematopoietic progenitor cells for chemotaxis [7–9, 12, 20] and cell survival [11, 12, 14], and inhibition of CD26 enhances the activity of SDF-1/CXCL12 for these effects in both human and murine progenitor cell assays, it is likely that the effects we have described for murine ESCs may also translate to human ESCs, although this latter possibility remains to be determined.

In addition to effects of SDF-1/CXCL12 on murine ESCs, we noted effects of SDF-1/CXCL12 on the hematopoietic differentiation of murine ESCs and/or the function of the differentiated, although still relatively immature, cells. Levels of soluble SDF-1/CXCL12 and expression of CXCR4 increased upon induction of EBs by withdrawal of LIF. Secreted SDF-1/CXCL12 peaked at 3 days and CXCR4 expression peaked at 4–5 days of initiation of EB formation. These are early stages of hemangioblast formation (day 2.5–3.5) [24] and early hematopoiesis (days 4–6) [34, 38]. In the mouse embryo, expression of SDF-1/CXCL12 and CXCR4 was described in the same time range: E7.5 [37]. Whereas we were not able to detect an effect of SDF-1/CXCL12 on EB production of hemangioblasts, endogenous production of SDF-1/CXCL12 was involved in the production of p-BFU-E, as well as d-BFU-E, CFU-GEMM, and CFU-GM, and in hemoglobinization of cells within the EBs, as determined by decreases in these events in the presence of AMD3100. Moreover, in the absence of AMD3100, the exogenous addition of SDF-1/CXCL12 doubled EB production of primitive and definitive progenitors. SDF-1/CXCL12 has been reported to suppress erythroid cell growth of human CB CD34+ cells, effects mediated by FAS/CD95 ligand [40]. Thus, under certain very specific circumstances, SDF-1/CXCL12 might suppress erythropoiesis in neonates or adults yet be supportive or enhancing for erythropoiesis at an earlier stage when a higher level of erythroid cell production is needed. However, whether this specific FAS/CD95 ligand-mediated suppression is active in vivo or even if it is mediated directly on the progenitors present in the CD34+ population, or through CD34+ or other inherent cells, is not known. We have not found SDF-1/CXCL12 to be suppressive for erythroid progenitors or other MPCs in vivo in mice [11] or on myeloid/erythroid progenitors in minimally separated or highly purified populations of human BM or human CB, or at the level of single isolated human progenitors [11, 12, 14].

From our present studies, we suggest that addition of SDF-1/CXCL12 can, in a practical sense, enhance the output of EB-derived progenitors, and perhaps stem cells, for practical preclinical advantage. At this time, EB-derived murine stem cells have only been able to engraft lethally irradiated mice and repopulate their hematopoietic system, with what appear to be normal blood cells, if these cells are transduced with additional genetic material such as HOXB4 [41]. Moreover, because human ESCs do not survive or passage well in single cell suspensions, and they are usually passaged as attached cell populations, it is logistically difficult to perform many types of studies evaluating their growth and migration regulation in vitro, as has been done in our study with murine ESCs. Thus, the field still has a way to go before ESC/EB-derived HSCs can be used for clinical transplantation. When these logistics have been worked out and if one can show similar regulation of human ESCs as we have shown for murine ESCs, it is possible that modulation of CD26 and addition of SDF-1/CXCL12 may be useful to enhance the survival and homing/engraftment of the human ESC/EB-derived HSCs.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This work was supported by U.S. Public Health Service Grants RO1 HL56416, RO1 HL67384, RO1 DK53674 (to H.E.B.), and HL69669 (to L.M.P.) from the National Institutes of Health.

DISCLOSURES
The authors indicate no potential conflicts of interest.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tashiro K, Tada H, Heilker R et al. Signal sequence trap: a cloning strategy for secreted proteins and type I membrane proteins. Science 1993;261:600–603.[Abstract/Free Full Text]

  2. Nagasawa T, Kikutani H, Kishimoto T. Molecular cloning and structure of a pre-B-cell growth-stimulating factor. Proc Natl Acad Sci U S A 1994;91:2305–2309.[Abstract/Free Full Text]

  3. Ma Q, Jones D, Borghesani PR et al. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1-deficient mice. Proc Natl Acad Sci U S A 1998;95:9448–9453.[Abstract/Free Full Text]

  4. Nagasawa T, Hirota S, Tachibana K et al. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 1996;382:635–638.[CrossRef][Medline]

  5. Tachibana K, Hirota S, Iizasa H et al. The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature 1998;393:591–594.[CrossRef][Medline]

  6. Zou YR, Kottmann AH, Kuroda M et al. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 1998;393:595–599.[CrossRef][Medline]

  7. Aiuti A, Webb IJ, Bleul C et al. The chemokine SDF-1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ progenitors to peripheral blood. J Exp Med 1997;185:111–120.[Abstract/Free Full Text]

  8. Kim CH, Broxmeyer HE. In vitro behavior of hematopoietic progenitor cells under the influence of chemoattractants: stromal cell-derived factor-1, steel factor, and the bone marrow environment. Blood 1998;91:100–110.[Abstract/Free Full Text]

  9. Mohle R, Bautz F, Rafii S et al. The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1. Blood 1998;91:4523–4530.[Abstract/Free Full Text]

  10. Peled A, Petit I, Kollet O et al. Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 1999;283:845–848.[Abstract/Free Full Text]

  11. Broxmeyer HE, Cooper S, Kohli L et al. Transgenic expression of stromal cell-derived factor-1/CXC chemokine ligand 12 enhances myeloid progenitor cell survival/antiapoptosis in vitro in response to growth factor withdrawal and enhances myelopoiesis in vivo. J Immunol 2003;170:421–429.[Abstract/Free Full Text]

  12. Broxmeyer HE, Kohli L, Kim CH et al. Stromal cell-derived factor-1/CXCL12 directly enhances survival/antiapoptosis of myeloid progenitor cells through CXCR4 and G(alpha)i proteins and enhances engraftment of competitive, repopulating stem cells. J Leukoc Biol 2003;73:630–638.[Abstract/Free Full Text]

  13. Joo EKBH, Kwon HJ, Kang HB et al. Enhancement of cell survival by stromal cell derived factore-1/CXCL12 involves activation of CREB and induction of MCL-1 and C-FOS in a factor dependent human cell line MO7e. Stem Cell and Development 2004;13:563–570.

  14. Lee Y, Gotoh A, Kwon HJ et al. Enhancement of intracellular signaling associated with hematopoietic progenitor cell survival in response to SDF-1/CXCL12 in synergy with other cytokines. Blood 2002;99:4307–4317.[Abstract/Free Full Text]

  15. Baggiolini M. Chemokines and leukocyte traffic. Nature 1998;392:565–568.[CrossRef][Medline]

  16. Bongers J, Lambros T, Ahmad M et al. Kinetics of dipeptidyl peptidase IV proteolysis of growth hormone-releasing factor and analogs. Biochim Biophys Acta 1992;1122:147–153.[CrossRef][Medline]

  17. Christopherson KW 2nd, Hangoc G, Broxmeyer HE. Cell surface peptidase CD26/dipeptidylpeptidase IV regulates CXCL12/stromal cell-derived factor-1 alpha-mediated chemotaxis of human cord blood CD34+ progenitor cells. J Immunol 2002;169:7000–7008.[Abstract/Free Full Text]

  18. Lambeir AM, Proost P, Durinx C et al. Kinetic investigation of chemokine truncation by CD26/dipeptidyl peptidase IV reveals a striking selectivity within the chemokine family. J Biol Chem 2001;276:29839–29845.[Abstract/Free Full Text]

  19. Schols D, Proost P, Struyf S et al. CD26-processed RANTES(3-68), but not intact RANTES, has potent anti-HIV-1 activity. Antiviral Res 1998;39:175–187.[CrossRef][Medline]

  20. Christopherson KW 2nd, Cooper S, Broxmeyer HE. Cell surface peptidase CD26/DPPIV mediates G-CSF mobilization of mouse progenitor cells. Blood 2003;101:4680–4686.[Abstract/Free Full Text]

  21. Christopherson KW, Cooper S, Hangoc G et al. CD26 is essential for normal G-CSF-induced progenitor cell mobilization as determined by CD26–/– mice. Exp Hematol 2003;31:1126–1134.[Medline]

  22. Christopherson KW 2nd, Hangoc G, Mantel CR et al. Modulation of hematopoietic stem cell homing and engraftment by CD26. Science 2004;305:1000–1003.[Abstract/Free Full Text]

  23. Odorico JS, Kaufman DS, Thomson JA. Multilineage differentiation from human embryonic stem cell lines. STEM CELLS 2001;19:193–204.[Abstract/Free Full Text]

  24. Kennedy M, Firpo M, Choi K et al. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature 1997;386:488–493.[CrossRef][Medline]

  25. Robbins PB, Yu XJ, Skelton DM et al. Increased probability of expression from modified retroviral vectors in embryonal stem cells and embryonal carcinoma cells. J Virol 1997;71:9466–9474.[Abstract]

  26. Sawai S, Shimono A, Hanaoka K et al. Embryonic lethality resulting from disruption of both N-myc alleles in mouse zygotes. New Biol 1991;3:861–869.[Medline]

  27. Pelus LM, Bian H, King AG et al. Neutrophil-derived MMP-9 mediates synergistic mobilization of hematopoietic stem and progenitor cells by the combination of G-CSF and the chemokines GRObeta/CXCL2 and GRObetaT/CXCL2delta4. Blood 2004;103:110–119.[Abstract/Free Full Text]

  28. Okamoto K, Okazawa H, Okuda A et al. A novel octamer binding transcription factor is differentially expressed in mouse embryonic cells. Cell 1990;60:461–472.[CrossRef][Medline]

  29. De Clercq E. The bicyclam AMD3100 story. Nat Rev Drug Discov 2003;2:581–587.[CrossRef][Medline]

  30. Hatse S, Princen K, Bridger G et al. Chemokine receptor inhibition by AMD3100 is strictly confined to CXCR4. FEBS Lett 2002;527:255–262.[CrossRef][Medline]

  31. Shaheen M, Broxmeyer HE. The humoral regulation of hematopoiesis. In: Hoffman R, Benz E, Shattil S et al., eds. Hematology: Basic Principles and Practice, 4th ed. Philadelphia: Churchill Livingstone, 2005.

  32. Christopherson KWI, Broxmeyer HE. Hematopoietic stem & progenitor cell homing, engraftment, & mobilization in the context of the CXCL12/SDF-1–CXCR4 axis. In: Broxmeyer HE, ed. Cord Blood: Biology, Immunology, Banking, and Clinical Transplantation. Bethesda, MD: American Association of Blood Banking, 2004:65–86.

  33. Bagby GJ, Henrich M. Growth factors, cytokines and control of hematopoiesis. In: Hoffman R, Shattil S, Furie B et al., eds. Hematology: Basic Principles and Practice, 3rd ed. New York: Churchill Livingstone, 1999:154–201.

  34. Keller GM. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 1995;7:862–869.[CrossRef][Medline]

  35. Bleul CC, Fuhlbrigge RC, Casasnovas JM et al. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J Exp Med 1996;184:1101–1109.[Abstract/Free Full Text]

  36. Campbell JJ, Hedrick J, Zlotnik A et al. Chemokines and the arrest of lymphocytes rolling under flow conditions. Science 1998;279:381–384.[Abstract/Free Full Text]

  37. McGrath KE, Koniski AD, Maltby KM et al. Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev Biol 1999;213:442–456.[CrossRef][Medline]

  38. Palis J, Yoder MC. Yolk-sac hematopoiesis: the first blood cells of mouse and man. Exp Hematol 2001;29:927–936.[CrossRef][Medline]

  39. Molyneaux KA, Zinszner H, Kunwar PS et al. The chemokine SDF1/CXCL12 and its receptor CXCR4 regulate mouse germ cell migration and survival. Development 2003;130:4279–4286.[Abstract/Free Full Text]

  40. Gibellini D, Bassini A, Re MC et al. Stroma-derived factor 1alpha induces a selective inhibition of human erythroid development via the functional upregulation of Fas/CD95 ligand. Br J Haematol 2000;111:432–440.[CrossRef][Medline]

  41. Kyba M, Perlingeiro RC, Daley GQ. HoxB4 confers definitive lymphoid-myeloid engraftment potential on embryonic stem cell and yolk sac hematopoietic progenitors. Cell 2002;109:29–37.[CrossRef][Medline]

Received February 28, 2005; accepted for publication May 19, 2005.



This article has been cited by other articles:


Home page
 JPEN J Parenter Enteral NutrHome page
J. L. Hermsen, F. E. Gomez, Y. Maeshima, Y. Sano, W. Kang, and K. A. Kudsk
Decreased Enteral Stimulation Alters Mucosal Immune Chemokines
JPEN J Parenter Enteral Nutr, January 1, 2008; 32(1): 36 - 44.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Biol.Home page
R. Palumbo, B. G. Galvez, T. Pusterla, F. De Marchis, G. Cossu, K. B. Marcu, and M. E. Bianchi
Cells migrating to sites of tissue damage in response to the danger signal HMGB1 require NF-{kappa}B activation
J. Cell Biol., October 8, 2007; 179(1): 33 - 40.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
J. Xu, A. Mora, H. Shim, A. Stecenko, K. L. Brigham, and M. Rojas
Role of the SDF-1/CXCR4 Axis in the Pathogenesis of Lung Injury and Fibrosis
Am. J. Respir. Cell Mol. Biol., September 1, 2007; 37(3): 291 - 299.
[Abstract] [Full Text] [PDF]

Home page
 haematolHome page
M. Shi, J. Li, L. Liao, B. Chen, B. Li, L. Chen, H. Jia, and R. C. Zhao
Regulation of CXCR4 expression in human mesenchymal stem cells by cytokine treatment: role in homing efficiency in NOD/SCID mice
Haematologica, July 1, 2007; 92(7): 897 - 904.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
Y. Tan, H. Shao, D. Eton, Z. Yang, L. Alonso-Diaz, H. Zhang, A. Schulick, A. S. Livingstone, and H. Yu
Stromal cell-derived factor-1 enhances pro-angiogenic effect of granulocyte-colony stimulating factor
Cardiovasc Res, March 1, 2007; 73(4): 823 - 832.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
X. Huang, Y. Fu, R. A. Charbeneau, T. L. Saunders, D. K. Taylor, K. D. Hankenson, M. W. Russell, L. G. D'Alecy, and R. R. Neubig
Pleiotropic Phenotype of a Genomic Knock-In of an RGS-Insensitive G184S Gnai2 Allele.
Mol. Cell. Biol., September 1, 2006; 26(18): 6870 - 6879.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
Y. Guo, B. Graham-Evans, and H. E. Broxmeyer
Murine Embryonic Stem Cells Secrete Cytokines/Growth Modulators That Enhance Cell Survival/Anti-Apoptosis and Stimulate Colony Formation of Murine Hematopoietic Progenitor Cells
Stem Cells, April 1, 2006; 24(4): 850 - 856.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, Y.
Right arrow Articles by Broxmeyer, H. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, Y.
Right arrow Articles by Broxmeyer, H. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS
http://www.epitomics.com