Stem Cells http://www.peprotech.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online July 28, 2005
Stem Cells Vol. 23 No. 9 October 2005, pp. 1378 -1388
doi:10.1634/stemcells.2005-0090; www.StemCells.com
© 2005 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0090v1
23/9/1378    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Silberstein, L.
Right arrow Articles by Göttgens, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silberstein, L.
Right arrow Articles by Göttgens, B.

Transgenic Analysis of the Stem Cell Leukemia +19 Stem Cell Enhancer in Adult and Embryonic Hematopoietic and Endothelial Cells

Lev Silbersteina, María-José Sánchezb, Merav Socolovskyc, Ying Liuc, Gary Hoffmana, Sarah Kinstona, Sandie Piltza, Mark Bowena, Laure Gambardellad, Anthony R. Greena, Berthold Göttgensa

a Department of Hematology, Cambridge Institute for Medical Research, University of Cambridge, Cambridge, United Kingdom;
b Centro Andaluz de Biologia del Desarrollo, Universidad Pablo de Olavide, Seville, Spain;
c University of Massachusetts Medical School, Department of Pediatrics (Hematology/Oncology Division) and Department of Cancer Biology, Worcester, Massachusetts, USA;
d The Laboratory of Lymphocyte Signaling and Development, The Babraham Institute, Babraham, Cambridge, United Kingdom

Key Words. Hematopoietic stem cell • Transcription factor SCL/tal-1 • Transcriptional regulation • Experimental models

Correspondence: Berthold Göttgens, D.Phil., Department of Hematology, Cambridge Institute for Medical Research, Cambridge University, Hills Road, Cambridge CB2 2XY, U.K. Telephone: 44-1223-336829; Fax: 44-1223-762670; e-mail: bg200{at}cam.ac.uk


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
Appropriate transcriptional regulation is critical for the biological functions of many key regulatory genes, including the stem cell leukemia (SCL) gene. As part of a systematic dissection of SCL transcriptional regulation, we have previously identified a 5,245-bp SCL +18/19 enhancer that targeted embryonic endothelium together with embryonic and adult hematopoietic progenitors and stem cells (HSCs). This enhancer is proving to be a powerful tool for manipulating hematopoietic progenitors and stem cells, but the design and interpretation of such transgenic studies require a detailed understanding of enhancer activity in vivo. In this study, we demonstrate that the +18/19 enhancer is active in mast cells, megakaryocytes, and adult endothelium. A 644-bp +19 core enhancer exhibited similar temporal and spatial activity to the 5,245-bp +18/19 fragment both during development and in adult mice. Unlike the +18/19 enhancer, the +19 core enhancer was only active in adult mice when linked to the eukaryotic reporter gene human placental alkaline phosphatase. Activity of a single core enhancer in HSCs, endothelium, mast cells, and megakaryocytes suggests possible overlaps in their respective transcriptional programs. Moreover, activity in a proportion of thymocytes and other SCL-negative cell types suggests the existence of a silencer elsewhere in the SCL locus.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
Appropriate control of cell type–specific gene expression lies at the heart of development. Hematopoiesis provides a prime example of this process, in which key transcription factors play central roles in cell fate specification and subsequent differentiation [1]. Moreover, aberrant expression of the same key transcription factors is often associated with the development of leukemia [2]. Accurate transcriptional regulation is therefore clearly critical, but in most cases the underlying molecular mechanisms remain poorly understood.

The stem cell leukemia gene (SCL), also known as TAL-1, encodes a basic helix-loop-helix transcription factor, which was first identified through its ectopic expression in T-cell acute lymphoblastic leukemia (T-ALL). SCL is normally expressed in hemangioblasts, hematopoietic stem cells (HSCs), erythroid cells, megakaryocytes, and mast cells as well as angioblasts, mature endothelial cells, smooth muscle myocytes, and specific areas of the central nervous system [3]. Targeted deletion has shown that SCL is essential for the formation of HSCs during mouse embryonic development and for the remodeling of primary yolk sac vasculature [4–8]. Moreover, ectopic expression of SCL during Zebrafish development resulted in excessive formation of hemangioblasts and blood cells at the expense of other mesodermal fates [9]. In the adult, studies of conditional SCL knockout mice demonstrated that SCL is not required for self-renewal or long-term repopulation activity of HSCs but that short-term repopulating capacity of SCL-deleted HSCs is severely impaired [10–12]. The same studies also revealed that SCL is vital for adult megakaryopoiesis and erythropoiesis, which was consistent with previous reports demonstrating that enforced expression of SCL in purified normal human hematopoietic CD34+ cells increased the number of erythroid and megakaryocyte colonies [13].

We have systematically dissected the mechanisms regulating transcription of the SCL locus. So far, these studies have resulted in the identification of five independent enhancers, each of which targets expression to a specific subdomain of the normal SCL expression pattern [14–18]. Of particular note, a 3' element (the SCL +18/19 enhancer) was found to direct expression to embryonic endothelium and to most adult and embryonic hematopoietic progenitors and long-term repopulating stem cells [18, 19]. Moreover, this enhancer was able to rescue early hematopoietic progenitors and yolk sac angiogenesis in SCL–/– mouse embryos when it was used to drive expression of an SCL cDNA [19].

The +18/19 enhancer was originally characterized as a 5,245-bp fragment. This fragment has been used to direct HSC expression of several proteins, including SCL itself [19], Cre recombinase [20], tetracycline transactivator [21], the TVA avian retroviral receptor protein [22], and oncogenic fusion proteins [23]. Interpretation of these and future studies using this experimental approach will require detailed knowledge of the precise cell types targeted. However, apart from hematopoietic progenitors and stem cells, there has been no detailed analysis of the activity of this fragment in adult mice. A 644-bp core +19 enhancer has been shown to target hematopoietic cells and endothelium at a single time point during embryonic development. However, no phenotypic characterization of the hematopoietic cells was performed, and activity of the core enhancer has not been studied at other developmental stages or in adult mice. In this article, we report a detailed analysis of the activity of the 5,245-bp +18/19 enhancer and the 644-bp +19 core enhancer in transgenic mice.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Conclusions
 References
 
Transgenic Reporter Constructs
The 6E5/lac/18/19 and SV/lac/19 constructs have been described previously [16, 18]. The murine SCL 18/19 insert represents a BglII fragment of 5,245-bp length (corresponding to bp 74,709 to 79,953 in GenBank entry AJ131017 [GenBank] ). The SCL 19 insert represents a 644-bp SspI/HindIII fragment (corresponding to bp 78,842 to 79,485 in GenBank entry AJ131017 [GenBank] ) and contains a previously mapped region of accessible chromatin [16]. To generate the SV/PLAP/19 construct, the SV40 minimal promoter was obtained from the pGL-2 promoter plasmid (Promega, Madison, WI, http://www.promega.com). The rabbit ß-globin second intron, known to enhance transgene expression in mice [24–28], was obtained from pSG5 (Stratagene, La Jolla, CA, http://www.stratagene.com). The placental alkaline phosphatase (PLAP) gene, including the SV40 polyadenylation signal, was subcloned from the APpA3 plasmid (gift from Dr. P. Rigby). The transgenic construct that consisted of the above fragments was designated SV/PLAP. The +19 core enhancer is a 644-bp fragment of mouse genomic DNA located 19 kb downstream of the SCL promoter 1a. It was subcloned from the SV/lac/19 construct and inserted downstream of the PLAP gene to generate the SV/PLAP/19 construct.

Transgenic Mice
Transgenic mice were generated and maintained as described [17]. Genotyping of PLAP transgenic mice was performed by polymerase chain reaction (PCR) using the following primers: GAC TGA GCC CAT GAC ACC AA and TGG ACA AAC CAC AAC TAG AAT GC. The primers were located at the junction of the PLAP coding sequence and the SV40 polyA signal. PCR conditions were 94°C for 10 seconds, 65°C for 30 seconds, and 72°C for 60 seconds, repeated 34 times. Genotyping of lacZ transgenic mice and X-gal staining of whole-mount embryos and cytospin preparations were performed as described [17]. Primary bone marrow mast cells were isolated as described [29]. The final cell population after 20 days in culture was 90% positive for Fce receptor by fluorescence-activated cell sorting (FACS).

Flow Cytometry
Fetal livers were dissected from E11.5 (for surface-marker analysis) or E12.5 (for long-term reconstitution experiments) mouse embryos derived from crossing heterozygous transgenic males with F1 nontransgenic females. A monoclonal antibody against PLAP (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) was conjugated to fluorescein isothiocyanate (FITC) using the Fluore-porter FITC protein labeling kit (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com). ß-Galactosidase activity was detected using the fluorescent substrate FDG (fluorescein di-ß-D-galactopyranoside) as described [30]. Phycoerythrin (PE)–conjugated monoclonal antibodies against surface markers B220, CD4, CD8, CD71, Ter119, Gr1, Mac1, and IgM as well as Ter119-biotin, FITC-conjugated IgG2a, and PE-conjugated IgG2b (isotype controls) were purchased from BD Biosciences (San Diego, http://www.bdbiosciences.com). Allophycocyanin-conjugated streptavidin was obtained from Molecular Probes. FACS was performed using a FACS Calibur flow cytometer (BD Biosciences), and the results were analyzed with Win MDI software (Scripps Research Institute, La Jolla, CA, http://facs.scripps.edu/software.html). Dead cells were excluded by propidium iodide staining.

Cell Sorting, Analysis of Reconstitution, and Donor Cell Contribution
For flow cytometric sorting, adult bone marrow and E11–E12 fetal liver cells were stained with anti-PLAP antibody as described above. Cells were sorted at 4°C on a high-speed sorter (Dako-Cytomation, Glostrup, Denmark, http://www.dakocytomation.com) and collected in phosphate-buffered saline (PBS) containing 5% fetal calf serum. Dead cells were excluded by propidium iodide staining. The purity of sorted bone marrow cells was 90% for the PLAP+ fraction and in excess of 95% for the PLAP– fraction. In two experiments using fetal liver, the purity was 96% for the positive fraction and 67% and 98% for the negative fraction. Sorted cells were counted and injected into the tail vein of 2- to 5-month-old irradiated female (CBA x C57Bl/6) F1 mice. Transgenic donor cells were coinjected with 2 x 105 nontransgenic splenic cells for radioprotection. On the day of the transfer, recipient mice were exposed to a split dose of a total of 900 rads from a cesium source. Transplanted animals were bled from the tail vein 4–6 months after transplantation to monitor reconstitution. Donor cells were detected by PCR analysis of recipient peripheral blood DNA using the PLAP primers as described above. To test the contribution of donor HSCs to different hematopoietic lineages, long-term transplanted mice were euthanized at 4–6 months after transplant. Genomic DNA was isolated from tissues or FACS-sorted cells and analyzed by PCR for the presence of the PLAP transgene.

Real-Time Reverse Transcription–PCR
Wild-type fetal liver cells were labeled with Ter119 and CD71 antibodies (BD-Pharmingen, San Diego, http://www.bdbiosciences.com/pharmingen) as described [31] and sorted on a Cytomation MoFlo high-speed sorter at a sheath pressure of 30 psi. Cells were sorted from each of the Ter119/CD71 subsets S1 to S5. RNA was prepared using the RNeasy kit (Qiagen, Valencia, CA, http://www1.qiagen.com) and was treated with amplification-grade DNaseI (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). Reverse transcription (RT) was performed using 5µg of RNA per sample, using superscript II (Invitrogen) and random hexamer primers. The resulting template cDNA from each of subsets S1 to S4 was subjected to real-time PCR on an Applied Bio-systems (Foster City, CA, http://www.appliedbiosystems.com) 7300 Real-Time PCR System. TaqMan probes in conjunction with TaqMan real-time PCR master-mix (Applied Biosystems) were used for quantitation of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and of 18S ribosomal RNA. SYBR-Green real-time PCR master mix (Applied Biosystems) in conjunction with the following primers was used for quantification of SCL (CATGTTCACCAACAACAACCG-3 and GGTGTGAGGAC-CATCAGAAATCTC) and for ß-actin (CACCGAGGCCCCCCT and TTGAAGGTCTCAAACATGATCTGG). A single PCR product for each of these PCR reactions was confirmed by gel electrophoresis and by melting-curve analysis. In all cases, no product was obtained in the absence of template. Similarly, no product was obtained in the absence of RT.

Histochemical Detection of PLAP
Histochemical detection of PLAP in tissue sections was performed as described [32] with the following modifications. The tissues were fixed in neutral-buffered formalin for 24 hours, dehydrated in ethanol series, cleared in xylene, processed into paraffin wax at 60°C for a total of 40 minutes, and embedded. Sections 5–6 µm were placed on electrostatically charged slides (VWR International, West Chester, PA, http://www.vwr.com) and rehydrated. For the inhibition of endogenous phosphatases, the sections were incubated in preheated PBS at 75°C for 35 minutes. After a 10-minute wash in alkaline phosphatase (AP) buffer (0.1 M Tris-HCl, pH 9.5, 0.1 M MgCl2, 0.1 M NaCl), the slides were transferred into AP staining solution (0.1 M Tris-HCl, pH 9.5, 0.05 M MgCl2, 0.1 M NaCl, and 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT) substrate; Roche Diagnostics, Basel Switzerland, http://www.roche-applied-science.com) and incubated in the dark at room temperature for 1 hour. Tissue sections were counterstained with brazilin (Anachem, Bedfordshire, U.K., http://www.anachem.co.uk), rehydrated in ascending concentrations of ethanol, cleared in Histoclear (Fisher Scientific International, Hampton, NH, http://www.fisherscientific.com), and mounted in Clarion mounting media (Abcam, Cambridge, U.K., http://www.abcam.com).


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Conclusions
 References
 
5,245-bp SCL +18/19 Enhancer Targets ß-Galactosidase Expression to Adult Endothelium, Megakaryocytes, and Mast Cells
Activity of the 5,245-bp SCL +18/19 enhancer fragment in adult tissues was assessed in transgenic mice carrying the +6E5/Lac/+18/19 reporter construct (Fig. 1AGo). As shown in Figure 1BGo, histochemical analysis of tissue sections demonstrated ß-galactosidase activity in endothelial cells in multiple tissues, including kidney, heart, liver, lung, spleen, and skin, in three out of six lines analyzed. The widespread endothelial activity of the SCL +18/19 enhancer during embryonic development [18] is therefore maintained in adult mice.



View larger version (89K):
[in this window]
[in a new window]
  		Figure 1. The 5,245-bp SCL +18/19 enhancer fragment is active in adult endothelium. (A): Diagram of the murine SCL locus indicating the position of the 5,245-bp BglII fragment containing the SCL +18/19 enhancer. Shown underneath is the transgenic reporter construct, which contained the SCL exon 4 promoter (+6E5 fragment) and a lacZ reporter gene in addition to the +18/19 3' enhancer fragment. (B): Three transgenic lines carrying the +6E5/lac/+18/19 construct were analyzed for lacZ expression in adult tissues by histochemical analysis of tissue sections. Blue staining indicates ß-galactosidase activity. No staining was observed in nontransgenic controls. Two lines showed widespread endothelial lacZ expression, whereas no expression was observed in the third line. The results shown are for line 2262 [18]. Kidney, arrowheads indicate ß-galactosidase–positive glomerular endothelial cells. Heart, arrow indicates ß-galactosidase staining in the endocardium. Liver, widespread endothelial ß-galactosidase activity was observed including staining in sublobular veins (sv). Lung, endothelial cells lining vessels and alveolar ducts were positive (a, artery; b, bronchiole; d, alveolar duct). Spleen, a network of endothelial cells was positive (see arrowheads). Skin, endothelial cells stained positive for ß-galactosidase in the dermis (arrow points to lining endothelium of a small vessel). (C): High-power view of section of the spleen showing a megakaryocyte staining positive for ß-galactosidase activity (line 2262 [18]). (D): Primary bone marrow mast cells derived as described [33] were analyzed by flow cytometry demonstrating that approximately 50% of the resultant FcRcIgE-positive mast cells expressed the ß-galactosidase transgene (detected using FDG). Abbreviations: FDG, fluorescent ß-galactosidase substrate fluorescein di–ß-D-galactopyranoside; SCL, stem cell leukemia.

 
Within the hematopoietic system, SCL is expressed in the erythroid, megakaryocyte, and mast cell lineages [3]. It has previously been reported that the SCL +18/19 enhancer does not display significant activity in Ter119+ erythroid cells [18], but activity of the enhancer in megakaryocytes and mast cells was not investigated. Examination of X-gal–stained bone marrow cytospin preparations and histological sections of the spleen from two independent lines revealed that approximately 50% of megakaryocytes expressed the transgene (Fig. 1CGo and data not shown). To study enhancer activity in mast cells, primary bone marrow mast cells were derived as described [33]. FACS analysis demonstrated that approximately half of the resultant FcRcIgE-positive mast cells expressed the ß-galactosidase transgene (Fig. 1DGo). These data suggest that the SCL +18/19 enhancer is capable of maintaining transgene expression when stem and progenitor cells differentiate into mature mast cells and megakaryocytes. Because all HSCs express ß-galactosidase in the 6E5/lac/18/19 transgenic lines used here, expression of ß-galactosidase in only half of the differentiated mast cells and megakaryocytes may represent position-dependent variegation.

644-bp +19 Core Enhancer Targets ß-Galactosidase Expression to Endothelium and Blood Throughout Early Embryogenesis but Not in Adult Mice
We have previously used F0 transgenic analysis to identify a 644-bp core +19 enhancer located within the 5,245-bp +18/19 fragment. This core enhancer was sufficient to target expression at E11.5 to endothelial cells as well as to rare round cells in the fetal liver and to clusters of cells attached to the ventral wall of the dorsal aorta [16]. No phenotypic analysis of the presumed hematopoietic cells was performed, and activity of the enhancer was not studied at any other time points. To carry out a detailed analysis of the biological activity of the +19 core enhancer, five lines of transgenic mice were generated in which the +19 core enhancer was linked to a minimal promoter and lacZ reporter cassette (SV/lac/19; Fig. 2AGo). We had shown previously that the +18/19 enhancer did not have locus control region activity [18]. Transgene activity was dependent on integration sites, and consequently transgene copy number did not correlate with expression levels and some transgenic lines did not express at all [18]. In the current study, two out of five SV/lac/19 lines showed detectable ß-galactosidase expression and a similar pattern of enhancer activity at E11.5. Given our previous observation that the +18/19 enhancer did not have locus control region activity, it was not unexpected that three SV/lac/19 transgenic lines showed no expression.



View larger version (59K):
[in this window]
[in a new window]
  		Figure 2. The +19 core enhancer targets ß-galactosidase expression to endothelium and blood throughout early embryogenesis but not in adult mice. (A): Diagram of the murine SCL locus indicating the position of the 5,245-bp BglII fragment containing the SCL +18/19 enhancer. Shown underneath are the +6E5/lac/+18/19 and SV/lac/19 transgenic reporter constructs indicating the position of the 644-bp +19 core enhancer within the larger 5,245-bp +18/19 enhancer fragment. (B): Analysis of SV/lac/19 embryos (line 588) by whole-mount staining for ß-galactosidase activity. E7.5, staining in the extraembryonic region destined to form the yolk sac blood islands; E8.5, prominent staining in the developing vasculature; E9.5, endothelial staining in developing intersomitic vessels; E12.5, widespread endothelial staining. Blue staining indicates ß-galactosidase activity. No staining was observed in nontransgenic controls. No ß-galactosidase activity was detectable in adult tissues (data not shown). (C, D): Flow cytometric analysis of fetal liver and adult bone marrow demonstrated that approximately 4% of E11.5 fetal liver cells expressed the transgene in line 588, most of which also expressed the hematopoietic progenitor marker c-kit. However, no transgene expression was observed in adult bone marrow (compare plots for nontransgenic, +6E5/lac/+18/19 [line 2262], and SV/lac/19 [line 588]). Abbreviations: FDG, fluorescent ß-galactosidase substrate fluorescein di–ß-D-galactopyranoside; PI, propidium iodide; SCL, stem cell leukemia.

 
Enhancer activity was then studied in the two expressing transgenic lines at multiple time points during embryonic development (Fig. 2BGo). At E7.5, lacZ staining was observed in the extra-embryonic region destined to form the yolk sac blood islands. From E8.5, prominent staining was observed in the developing vasculature, with prominent staining in intersomitic vessels at E9.5. Endothelial staining persisted at E12.5 but progressively diminished at later developmental stages and was absent in adult mice (data not shown). Loss of activity of the +19 core enhancer in the adult was also observed in the hematopoietic system. As shown in Figure 2CGo, FACS analysis of E11.5 fetal liver demonstrated that approximately 4% of cells expressed the transgene, most of which also expressed c-kit, a marker of hematopoietic progenitors and stem cells. However, similar analysis of adult bone marrow (Fig. 2DGo) revealed no detectable activity of the +19 core enhancer in any of the SV/lac/19 transgenic lines, in contrast to transgenic lines carrying lacZ driven by the 5,245-bp SCL +18/19 enhancer. These data therefore demonstrate that activity of the 644-bp +19 core enhancer during development is similar to that of the 5,245-bp +18/19 enhancer. However, the +19 core enhancer was not sufficient to produce ß-galactosidase expression in adult mice.

SCL +19 Core Enhancer Targets PLAP Expression to Endothelium and Hematopoietic Cells During Embryogenesis and in Adult Mice
The 6E5/lac/18/19 and SV/lac/19 constructs contain the SCL 6E5 and simian virus SV40 minimal promoters, respectively. The absence of ß-galactosidase expression in adult SV/lac/19 transgenic mice might therefore have been a consequence of using these two different promoters. However, we have recently shown that the SV40 minimal promoter in connection with the SCL 18/19 enhancer can reproducibly drive expression of the tetracycline transactivator gene in adult bone marrow [21]. Failure of expression in adult SV/lac/19 transgenic mice would also be consistent with the suggestion that the +19 core enhancer may require additional sequences outside the core enhancer to maintain expression throughout ontogeny. Alternatively, the ß-galactosidase reporter gene may not faithfully report enhancer activity in adult mice, a scenario that has been suggested previously [34–39]. To distinguish these possibilities, ß-galactosidase was replaced by the mammalian reporter gene human PLAP. Previous studies have demonstrated that PLAP functions as a robust reporter in transgenic mice and can be detected in tissue sections as well as by FACS [32, 40–50].

Unlike the SV/lac/19 construct, the SV/PLAP/19 construct reproducibly directed expression in adult tissues, with five out of six transgenic lines analyzed showing strong expression in adult hematopoietic and endothelial cells. Embryonic expression in hematopoietic and endothelial cells was present in three out of three lines tested. At E11.5, transgene expression was observed in endothelial cells, including those in the yolk sac and fetal liver, as well as in clusters of round cells attached to the ventral wall of the dorsal aorta (Fig. 3BGo). FACS analysis demonstrated that fetal liver cells expressing the PLAP transgene also expressed the progenitor marker c-kit (Fig. 3CGo). In the bone marrow, approximately half of the transgene-positive cells were c-kit positive (Fig. 3CGo). Expression in adult endothelium was observed in all tissues examined, including the intestine, lung, and pancreas (Fig. 3DGo). Taken together, these results suggested that the +19 core enhancer contains all sequences necessary for cell type–specific activity in postnatal mice but only in the context of some reporter genes.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 3. The SCL +19 core enhancer targets PLAP expression to endothelium and hematopoietic cells during embryogenesis and in adult mice. (A): Diagram of the murine SCL locus indicating the position of the 5,245-bp BglII fragment containing the SCL +18/19 enhancer. Shown underneath are the +6E5/lac/+18/19, SV/lac/19, and SV/PLAP/19 transgenic reporter constructs. (B): Histochemical detection of PLAP activity (purple stain) in sections of SV/PLAP/19 transgenic E11.5 mouse embryos showed expression in endothelium (see section of yolk sac), endothelial cells, and round (haematopoietic) cells in the fetal liver and clusters of round cells attached to the ventral wall of the dorsal aorta. Similar data were obtained in three lines. The data shown are for line 1772. (C): The SV/PLAP/19 reporter construct is active in fetal liver and adult bone marrow hematopoietic cells. Flow cytometric analysis demonstrated that fetal liver cells expressing PLAP also expressed the progenitor marker c-kit. In bone marrow, less than half of the PLAP+ cells also expressed c-kit (data shown are for line 1791). (D): The SV/PLAP/19 reporter construct is active in adult endothelium. Shown are histological sections demonstrating endothelial PLAP activity (blue staining) in the intestine, lung, and pancreas. Similar results were obtained for five out of six lines analyzed. The data shown are for line 1772. Abbreviations: PLAP, placental alkaline phosphatase; SCL, stem cell leukemia.

 
SCL +19 Core Enhancer Targets Long-Term Repopulating HSCs
The ability to target long-term repopulating HSCs is a key feature of the 5,245-bp SCL +18/19 enhancer fragment [19]. To assess whether the +19 core enhancer was also sufficient to drive expression in HSCs, PLAP+ and PLAP– cells from SV/PLAP/19 transgenic adult bone marrow or E12.5 fetal liver were used in long-term repopulation studies. PCR for the donor PLAP transgene was used to assess engraftment and confirm multilineage contribution 4 to 6 months after transplantation.

As shown in Table 1Go, 4 out of 13 animals transplanted with 103 to 104 PLAP+ fetal liver cells showed long-term hematopoietic engraftment. Similarly, 4 out of 14 animals transplanted with 103 to 5 x 103 bone marrow cells showed long-term hematopoietic contribution of PLAP+ donor cells. Subsequent multilineage reconstitution analysis in three positive animals from each group demonstrated contribution of PLAP+ cells to all hematopoietic lineages analyzed in all recipients tested (Fig. 4Go and data not shown). Long-term engraftment was occasionally observed in recipients of 105 PLAP– fetal liver or bone marrow cells, indicating that a minority of HSCs were not targeted in SV/PLAP/19 lines. Taken together, these results suggest that the +19 core enhancer is active in most long-term repopulating HSCs in fetal liver and bone marrow.


View this table:
[in this window]
[in a new window]
  		Table 1. The +19 core enhancer targets long-term repopulating hematopoietic stem cells in SV/PLAP/19 transgenic mice
 


View larger version (15K):
[in this window]
[in a new window]
  		Figure 4. The +19 core enhancer targets long-term repopulating hematopoietic stem cells in SV/PLAP/19 transgenic mice. Multilineage reconstitution analysis demonstrated that PLAP-positive hematopoietic stem cells contribute to all lineages. Hematopoietic cell populations were isolated by fluorescence-activated cell sorting where necessary, and genomic DNA was analyzed by polymerase chain reaction for presence of the PLAP transgene (Bl, peripheral blood; BM, bone marrow; Th, thymus; S, spleen; LN, lineage-negative cell; T, T cells; B, B cells; E, erythroid cells; M, monocytes/macrophages; –, nontransgenic control; w, water control; +, transgenic control). Three animals transplanted with fetal liver and three animals transplanted with bone marrow PLAP+ cells were analyzed for multilineage contribution. All six animals showed multilineage contribution (representative data shown). Data shown are for line 1791.

 
SCL +19 Core Enhancer Targets Mature Megakaryocytes and Bone Marrow Mast Cells but Not Definitive Erythroid Cells
As shown above, the 5,245-bp fragment of the SCL+18/19 enhancer is active in mast cells and megakaryocytes. Examination of bone marrow sections from SV/PLAP/19 transgenic mice showed that in two out of three lines analyzed, the +19 core enhancer was also strongly active in a large proportion of megakaryocytes (Fig. 5AGo). Staining in the third line was weaker yet clearly positive compared with nontransgenic controls. In addition, the +19 core enhancer was active in 95% of bone marrow mast cells, derived by culturing in the presence cytokines, as previously described [51]. The phenotype of the resultant cells was confirmed by expression of c-kit and positive staining with toluidine blue (Fig. 5BGo). These observations suggested that the +19 core enhancer is capable of maintaining transgene expression when immature progenitors differentiate into mature mast cells and megakaryocytes.



View larger version (39K):
[in this window]
[in a new window]
  		Figure 5. Survey of hematopoietic PLAP expression in SV/PLAP/19 transgenic mice. (A): The +19 core enhancer drives expression in bone marrow megakaryocytes in SV/PLAP/19 transgenic mice. Shown are low- and high-magnification views of bone marrow sections stained for PLAP activity (purple). (B): The +19 core enhancer is active in mast cells in SV/PLAP/19 transgenic mice. Bone marrow mast cells were derived as previously described [51], and their phenotype was confirmed by expression of c-kit and positive staining with toluidine blue. Flow cytometric analysis demonstrated that 95% of mast cells expressed the PLAP transgene. (C): Immature erythroid cells express PLAP in SV/PLAP/19 transgenic mice. Five stages (S1–S5) of increasing erythroid maturation were distinguished by flow cytometric analysis using the CD71 and Ter119 markers. S1 and S2 correspond to the CFU-E/proerythoblast stages; S3 and S4, respectively, to early and late basophilic erythroblasts; and S5 to orthochromatophilic erythroblasts. Shown is the distribution of PLAP– (blue) compared with PLAP+ (red) cells within these five stages in E15.5 fetal liver from SV/PLAP/19 transgenic embryos. (D): The percentage of PLAP+ cells sharply decreases with increasing erythroid maturation. The graph shows the proportion of PLAP+ (red) and PLAP– (blue) cells for all stages (S1–S5) of erythroid differentiation analyzed. (E): Expression of endogenous SCL is not downregulated during erythroid differentiation. SCL transcripts were quantified using real-time reverse transcription–polymerase chain reaction in fetal liver cells sorted from the regions S1–S5. SCL expression levels were normalized against three control RNAs (GAPDH, ß-actin, and 18S rRNA). (F): Splenic Mac-1+ myeloid and B220+ B-lymphoid cells express PLAP in SV/PLAP/19 transgenic mice. Splenocytes were analyzed by flow cytometry using the Mac1 and B220 markers in combination with an antibody against PLAP. (G): Thymic CD4- and CD8-positive T lymphocytes express PLAP in SV/PLAP/19 transgenic mice. Thymocytes were analyzed by flow cytometry using the CD4 and CD8 markers in combination with an antibody against PLAP. Data shown are for line 1791. Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; PLAP, placental alkaline phosphatase; SCL, stem cell leukemia.

 
Previous studies showed that the 5,245-bp SCL +18/19 enhancer directed ß-galactosidase expression to only a small minority of Ter119+ erythroid cells [18]. By contrast, analysis of E15.5 fetal liver and adult bone marrow showed PLAP activity in up to 49% of Ter119+ erythroid cells (data not shown). FACS analysis using the CD71 and Ter119 markers to distinguish five stages (S1 to S5; Fig. 5CGo) of increasing erythroblast maturation demonstrated that the proportion of transgene-positive cells at each stage decreased from 96% (S1) to 3% (S5) (Figs. 5C, 5DGo). Moreover, the level of PLAP expression progressively decreased with increasing erythroid differentiation. Mean PLAP expression levels of PLAP+ cells declined approximately 10-fold between regions S1 and S3 (data not shown). Analogous results were obtained from analysis of spleen and bone marrow cells (data not shown). These results indicate that activity of the +19 core enhancer rapidly diminished during early erythroblast maturation. The different patterns of reporter gene expression observed in the 6E5/lacZ/+18/19 mice (few transgene-positive erythroid cells [18]) and the SV/PLAP/19 mice (significant levels of transgene expression but only in the most immature erythroid cells) is likely to reflect differences in mRNA and/or protein stability between the two different reporter genes. However, our data do not exclude the possibility that sequences outside the +19 core enhancer (but within the 6E5/lacZ/+18/19 cassette) are able to repress enhancer activity in erythroid cells.

SCL is generally thought to be upregulated during erythroid maturation [52, 53], yet one study also reported potential down-regulation [54]. To compare endogenous SCL transcription with activity of the +19 core enhancer, SCL transcripts were quantified using real-time RT-PCR in fetal liver cells sorted from the regions S1 to S5, thus allowing us to assess SCL expression levels in prospectively isolated primary cells of increasing erythroid maturation. Expression levels were normalized against three control RNAs, namely GAPDH, ß-actin, and 18S rRNA (Fig. 5EGo). This analysis demonstrated that SCL was expressed at high levels throughout erythroid maturation (cycle threshold numbers in similar range as GAPDH). Moreover, when normalized against GAPDH and 18S rRNA, SCL expression levels increased during erythroid maturation, whereas they remained constant when normalized against ß-actin (Fig. 5EGo). Importantly, regardless of the normalization control used and in contrast to the SV/PLAP/19 reporter gene, levels of endogenous SCL expression did not decrease during erythroid differentiation. This marked discrepancy is unlikely to be due to the presence of long-lived SCL mRNA species because we have shown previously that increased stability cannot account for increased SCL mRNA levels during erythroid differentiation of mouse erythroleukemia cells [55]. Taken together, our results therefore indicate that the +19 core enhancer is insufficient to maintain SCL expression during definitive erythroid differentiation and suggest that an additional regulatory element is required to express SCL during the later stages of erythropoiesis.

Activity of the +19 Core Enhancer in Other Hematopoietic Lineages
FACS analysis demonstrated PLAP expression in spleen and bone marrow of five out of six SV/PLAP/19 transgenic lines analyzed. In the highly expressing line 1791, PLAP+ cells included approximately half of Mac1+ myeloid and B220+ B-lymphoid cells (Fig. 5EGo). FACS analysis of adult thymus showed that a significant proportion of CD4+ and CD8+ thymocytes expressed the PLAP transgene in two out of four lines analyzed (Fig. 5GGo and data not shown). Reporter gene expression in lymphoid cells had previously been seen in some transgenic lines carrying the larger 5,245-bp +18/19 enhancer transgene [18]. Endogenous SCL is not expressed in most thymocytes, B cells, or Mac+ bone marrow cells. Our observation that the +19 core enhancer and the 5,245-bp +18/19 enhancer are active in these cell types suggests the existence of a silencer present elsewhere in the endogenous SCL locus. Failure to downregulate SCL is associated with T-ALL, and characterizing the mechanisms responsible for SCL repression therefore represents an important future goal.


   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Conclusions
 References
 
Previous analysis of SCL transcriptional regulation had identified a 5,245-bp +18/19 enhancer that targeted HSCs at all stages of ontogeny [19]. Within this fragment, a 644-bp core +19 enhancer was subsequently defined and shown to be active at a single time point in embryonic blood and endothelium [16]. We now show that in contrast to the full 5,245-bp SCL +18/19 enhancer, the 644-bp +19 core enhancer failed to express a linked ß-galactosidase reporter gene in adult tissues. This result was surprising given the tight correlation of activity during embryonic development between the 5.5-kb and 644-bp fragments. Several possible explanations might account for the observed discrepancy. First, the original 5,245-bp fragment may contain two distinct stem cell enhancers, with one (the +19) being active in the embryo and a second active in adult HSCs. Second, the +19 region alone may be sufficient for embryonic expression but may require additional sequences outside the core enhancer for activity in adult tissues. Third, in adult mice, the ß-galactosidase reporter gene may cause inactivation of the +19 core enhancer but not the larger +18/19 fragment. Inactivation of regulatory regions linked to lacZ transgenes has been reported previously and has generally been attributed to the prokaryotic origin of the lacZ sequence [34–39].

Our results demonstrate that the 644-bp +19 core enhancer is sufficient to target PLAP expression to adult tissues, including HSCs, and therefore suggest that ß-galactosidase–mediated transgene inactivation was responsible for the absence of expression in adult SV/lac/19 transgenic mice. The fact that the 5,245-bp fragment was not prone to ß-galactosidase–mediated transgene inactivation may be due to the presence of one or more additional regulatory elements in this bigger fragment. A strong candidate for such an element is the +18 region, which adopts an open chromatin configuration in progenitor cells [15] and can enhance activity of the +19 core enhancer in transfection assays (L.S. and B.G., unpublished data). The absence of the +18 region from the +19 core enhancer fragment may also be responsible for our observation that, unlike the 5.5-kb SCL 3' enhancer fragment, the +19 core enhancer did not target all bone marrow HSCs. These considerations would argue for inclusion of the +18 region with the +19 core enhancer when designing constructs to target expression of exogenous genes to HSCs.

Two other reporter cassettes have been shown by long-term reconstitution assays to target expression to HSCs. The first one, a 14-kb fragment containing Sca-1 regulatory elements, is active in all HSCs in adult bone marrow, as well as endothelium, renal cortical tubules, bone marrow stromal cells, and other hematopoietic cells, consistent with expression of endogenous Sca-1 [56]. Unlike SCL, Sca-1 is not a functional marker of HSC formation, and the Sca-1 epitope, encoded by the strain-specific Ly-6E/A alleles, shows expression on 99% of HSCs with Ly-6A strains yet only 25% of cells with Ly-6E strains [57]. Moreover, there is no Sca-1 equivalent in humans, and the large size of the Sca-1 cassette has so far precluded detailed molecular analysis of upstream transcription factors. The second cassette contains 18-kb 5' and 26-kb 3' genomic sequences of the human CD34 gene. As for Sca-1, the size of the CD34 cassette has so far precluded detailed molecular analysis. Moreover, cell type–specific activity of this cassette outside the hematopoietic system has not been investigated [58]. The small size and robust in vivo activity of the SCL +18/19 enhancer has led several groups to use it as a way of targeting expression to HSCs [19–23, 59]. Therefore, comprehensive analysis of the in vivo activity of the SCL +18/19 enhancer within and outside the hematopoietic system not only provides further insights into transcriptional regulation of SCL but will be vital to interpret current and future mouse models generated using this powerful regulatory element.

We have previously reported that the 5,245-bp +18/19 enhancer targets most HSCs and progenitors but is active only in a small minority of Ter119+ erythroid cells [18]. These data suggest the existence of a separate erythroid enhancer required for maintaining SCL expression during erythroid differentiation. Here we show that PLAP expression could be detected in a significant proportion of ther119+ cells in SV/PLAP/19 transgenic fetal liver, spleen, and bone marrow. The difference in the level of ß-galactosidase and PLAP levels in differentiating erythroid cells may reflect differences in messenger RNA stability, protein half lives, or sensitivity of the detection methods used (antibody-based PLAP detection compared with the enzymatic assay for ß-galactosidase). Although PLAP expression rapidly declined with increasing erythroid maturation, endogenous SCL expression remained high, consistent with the existence of a separate SCL erythroid enhancer. Indeed, we have recently identified an erythroid enhancer 40 kb downstream of mouse SCL exon 1a (Ogilvy et al., unpublished data).

The endogenous SCL gene is downregulated during the early stages of lymphoid differentiation—mature B and T lymphocytes as well as CD4+CD8+ double-positive thymocytes do not express SCL. It was therefore striking to find that both the +18/19 and +19 SCL enhancer fragments were active in a significant proportion of mature lymphocytes in multiple lines of transgenic mice (this study and [18]). These data suggest that appropriate downregulation of SCL requires one or more cis-elements outside the 5,245-bp +18/19 fragment. Biallelic SCL expression in leukemic thymocytes lacking rearrangements of the SCL locus [60] may well reflect interference with the mechanisms that normally silence SCL transcription. Characterization of a putative silencer may therefore illuminate the pathogenesis of T-cell leukemia as well as the poorly understood mechanisms by which lineage-restricted genes are downregulated during differentiation.


   CONCLUSIONS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
References
 
The SCL +18/19 stem cell enhancer is one of the most popular tools to engineer transgene expression in HSCs in vivo. Therefore, comprehensive analysis of the in vivo activity of the SCL 3' enhancer within and outside the hematopoietic system not only provides further insight into transcriptional regulation of SCL but will also be vital to interpret current and future mouse models generated using this powerful regulatory element.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 
Work in the authors’ laboratory is funded by the Leukaemia Research Fund, Wellcome Trust, BBSRC, and Cambridge MIT Institute. We are grateful to Paula Braker for coordinating with the Central Biomedical Services. M.S. was supported by a National Cancer Institute Howard Temin (KO1) Award. M.J.S. was supported through an MRC career development award.

DISCLOSURES
The authors indicate no potential conflicts of interest.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusions
 References
 

  1. Orkin SH. Diversification of haematopoietic stem cells to specific lineages. Nat Rev Genet 2000;1:57–64.[CrossRef][Medline]

  2. Tenen DG. Disruption of differentiation in human cancer: AML shows the way. Nat Rev Cancer 2003;3:89–101.[CrossRef][Medline]

  3. Begley CG, Green AR. The SCL gene: from case report to critical hematopoietic regulator. Blood 1999;93:2760–2770.[Free Full Text]

  4. Shivdasani RA, Mayer EL, Orkin SH. Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature 1995;373:432–434.[CrossRef][Medline]

  5. Robb L, Lyons I, Li R et al. Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene. Proc Natl Acad Sci U S A 1995;92:7075–7079.[Abstract/Free Full Text]

  6. Porcher C, Swat W, Rockwell K et al. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell 1996;86:47–57.[CrossRef][Medline]

  7. Robb L, Elwood NJ, Elefanty AG et al. The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse. EMBO J 1996;15:4123–4129.[Medline]

  8. Visvader JE, Fujiwara Y, Orkin SH. Unsuspected role for the T-cell leukemia protein SCL/tal-1 in vascular development. Genes Dev 1998;12:473–479.[Abstract/Free Full Text]

  9. Gering M, Rodaway AR, Göttgens B et al. The SCL gene specifies haemangioblast development from early mesoderm. EMBO J 1998;17:4029–4045.[CrossRef][Medline]

  10. Mikkola HK, Klintman J, Yang H et al. Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature 2003;421:547–551.[CrossRef][Medline]

  11. Curtis DJ, Hall MA, Van Stekelenburg LJ et al. SCL is required for normal function of short-term repopulating hematopoietic stem cells. Blood 2004;103:3342–3348.[Abstract/Free Full Text]

  12. Hall MA, Curtis DJ, Metcalf D et al. The critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU-S12. Proc Natl Acad Sci U S A 2003;100:992–997.[Abstract/Free Full Text]

  13. Elwood NJ, Zogos H, Pereira DS et al. Enhanced megakaryocyte and erythroid development from normal human CD34(+) cells: consequence of enforced expression of SCL. Blood 1998;91:3756–3765.[Abstract/Free Full Text]

  14. Göttgens B, Barton LM, Gilbert JG et al. Analysis of vertebrate SCL loci identifies conserved enhancers. Nat Biotechnol 2000;18:181–186.[CrossRef][Medline]

  15. Göttgens B, McLaughlin F, Bockamp EO et al. Transcription of the SCL gene in erythroid and CD34 positive primitive myeloid cells is controlled by a complex network of lineage-restricted chromatin-dependent and chromatin-independent regulatory elements. Oncogene 1997;15:2419–2428.[CrossRef][Medline]

  16. Göttgens B, Nastos A, Kinston S et al. Establishing the transcriptional programme for blood: the SCL stem cell enhancer is regulated by a multi protein complex containing Ets and GATA factors. EMBO J 2002;21:3039–3050.[CrossRef][Medline]

  17. Sinclair AM, Göttgens B, Barton LM et al. Distinct 5µ SCL enhancers direct transcription to developing brain, spinal cord, and endothelium: neural expression is mediated by GATA factor binding sites. Dev Biol 1999;209:128–142.[CrossRef][Medline]

  18. Sánchez M, Göttgens B, Sinclair AM et al. An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors. Development 1999;126:3891–3904.[Abstract]

  19. Sánchez MJ, Bockamp EO, Miller J et al. Selective rescue of early haematopoietic progenitors in Scl(–/–) mice by expressing Scl under the control of a stem cell enhancer. Development 2001;128:4815–4827.[Abstract/Free Full Text]

  20. Gothert JR, Gustin SE, Hall MA et al. In vivo fate-tracing studies using the SCL stem cell enhancer: embryonic hematopoietic stem cells significantly contribute to adult hematopoiesis. Blood 2004;105:2724–2732.

  21. Koschmieder S, Göttgens B, Zhang P et al. Inducible chronic phase of myeloid leukemia with expansion of hematopoietic stem cells in a transgenic model of BCR-ABL leukemogenesis. Blood 2005;105:324–334.[Abstract/Free Full Text]

  22. Murphy GJ, Göttgens B, Vegiopoulos A et al. Manipulation of mouse hematopoietic progenitors by specific retroviral infection. J Biol Chem 2003;278:43556–43563.[Abstract/Free Full Text]

  23. Eguchi M, Eguchi-Ishimae M, Green A et al. Directing oncogenic fusion genes into stem cells via an SCL enhancer. Proc Natl Acad Sci U S A 2005;102:1133–1138.[Abstract/Free Full Text]

  24. Melcher R, Grosch HW, Hasilik A. Plasmid vectors with a 5µ-hybrid intron facilitate high-level glycoprotein expression in CHO-cells. Biochim Bio-phys Acta 2002;1575:49–53.[Medline]

  25. Buchman AR, Berg P. Comparison of intron-dependent and intron-independent gene expression. Mol Cell Biol 1988;8:4395–4405.[Abstract/Free Full Text]

  26. Palmiter RD, Sandgren EP, Avarbock MR et al. Heterologous introns can enhance expression of transgenes in mice. Proc Natl Acad Sci U S A 1991;88:478–482.[Abstract/Free Full Text]

  27. Brinster RL, Allen JM, Behringer RR et al. Introns increase transcriptional efficiency in transgenic mice. Proc Natl Acad Sci U S A 1988;85:836–840.[Abstract/Free Full Text]

  28. Choi T, Huang M, Gorman C et al. A generic intron increases gene expression in transgenic mice. Mol Cell Biol 1991;11:3070–3074.[Abstract/Free Full Text]

  29. Costello PS, Turner M, Walters AE et al. Critical role for the tyrosine kinase Syk in signalling through the high affinity IgE receptor of mast cells. Oncogene 1996;13:2595–2605.[Medline]

  30. Miles C, Sánchez MJ, Sinclair A et al. Expression of the Ly-6E.1 (Sca-1) transgene in adult hematopoietic stem cells and the developing mouse embryo. Development 1997;124:537–547.[Abstract]

  31. Socolovsky M, Nam H, Fleming MD et al. Ineffective erythropoiesis in Stat5a(–/–)5b(–/–) mice due to decreased survival of early erythroblasts. Blood 2001;98:3261–3273.[Abstract/Free Full Text]

  32. DePrimo SE, Stambrook PJ, Stringer JR. Human placental alkaline phosphatase as a histochemical marker of gene expression in transgenic mice. Transgenic Res 1996;5:459–466.[CrossRef][Medline]

  33. Bockamp EO, Fordham JL, Göttgens B et al. Transcriptional regulation of the stem cell leukemia gene by PU.1 and Elf-1. J Biol Chem 1998;273:29032–29042.[Abstract/Free Full Text]

  34. Cohen-Tannoudji M, Morello D, Babinet C. Unexpected position-dependent expression of H-2 and beta 2-microglobulin/lacZ transgenes. Mol Reprod Dev 1992;33:149–159.[CrossRef][Medline]

  35. Cohen-Tannoudji M, Vandormael-Pournin S, Drezen J et al. lacZ sequences prevent regulated expression of housekeeping genes. Mech Dev 2000;90:29–39.[CrossRef][Medline]

  36. Mehtali M, LeMeur M, Lathe R. The methylation-free status of a housekeeping transgene is lost at high copy number. Gene 1990;91:179–184.[CrossRef][Medline]

  37. Ogilvy S, Elefanty AG, Visvader J et al. Transcriptional regulation of vav, a gene expressed throughout the hematopoietic compartment. Blood 1998;91:419–430.[Abstract/Free Full Text]

  38. Garrick D, Sutherland H, Robertson G et al. Variegated expression of a globin transgene correlates with chromatin accessibility but not methylation status. Nucleic Acids Res 1996;24:4902–4909.[Abstract/Free Full Text]

  39. Guy LG, Kothary R, Wall L. Position effects in mice carrying a lacZ trans-gene in cis with the beta-globin LCR can be explained by a graded model. Nucleic Acids Res 1997;25:4400–4407.[Abstract/Free Full Text]

  40. Knoll BJ, Rothblum KN, Longley M. Two gene duplication events in the evolution of the human heat-stable alkaline phosphatases. Gene 1987;60:267–276.[CrossRef][Medline]

  41. Knoll BJ, Rothblum KN, Longley M. Nucleotide sequence of the human placental alkaline phosphatase gene: evolution of the 5' flanking region by deletion/substitution. J Biol Chem 1988;263:12020–12027.[Abstract/Free Full Text]

  42. Henthorn PS, Knoll BJ, Raducha M et al. Products of two common alleles at the locus for human placental alkaline phosphatase differ by seven amino acids. Proc Natl Acad Sci U S A 1986;83:5597–5601.[Abstract/Free Full Text]

  43. DePrimo SE, Cao J, Hersh MN et al. Use of human placental alkaline phosphatase transgenes to detect somatic mutation in mice in situ. Methods 1998;16:49–61.[CrossRef][Medline]

  44. Carvajal JJ, Cox D, Summerbell D et al. A BAC transgenic analysis of the Mrf4/Myf5 locus reveals interdigitated elements that control activation and maintenance of gene expression during muscle development. Development 2001;128:1857–1868.[Abstract]

  45. Chen B, Gandhi R, Baltimore D. CD4 down-modulation during infection of human T cells with human immunodeficiency virus type 1 involves independent activities of vpu, env, and nef. J Virol 1996;70:6044–6053.[Abstract]

  46. Gandhi RT, Chen BK, Straus SE et al. HIV-1 directly kills CD4+ T cells by a Fas-independent mechanism. J Exp Med 1998;187:1113–1122.[Abstract/Free Full Text]

  47. Jacob J, Baltimore D. Modelling T-cell memory by genetic marking of memory T cells in vivo. Nature 1999;399:593–597.[CrossRef][Medline]

  48. Cepko C, Ryder EF, Austin CP et al. Lineage analysis using retrovirus vectors. Methods Enzymol 1995;254:387–419.[Medline]

  49. Lobe CG, Koop KE, Kreppner W et al. Z/AP, a double reporter for cre-mediated recombination. Dev Biol 1999;208:281–292.[CrossRef][Medline]

  50. Ziegler S, Burki K, Skoda RC. A 2-kb c-mpl promoter fragment is sufficient to direct expression to the megakaryocytic lineage and sites of embryonic hematopoiesis in transgenic mice. Blood 2002;100:1072–1074.[Abstract/Free Full Text]

  51. Shelburne CP, McCoy ME, Piekorz R et al. Stat5 expression is critical for mast cell development and survival. Blood 2003;102:1290–1297.[Abstract/Free Full Text]

  52. Aplan PD, Nakahara K, Orkin SH et al. The SCL gene product: a positive regulator of erythroid differentiation. EMBO J 1992;11:4073–4081.[Medline]

  53. Visvader J, Begley CG, Adams JM. Differential expression of the LYL, SCL and E2A helix-loop-helix genes within the hemopoietic system. Oncogene 1991;6:187–194.[Medline]

  54. Mouthon MA, Bernard O, Mitjavila MT et al. Expression of tal-1 and GATA-binding proteins during human hematopoiesis. Blood 1993;81:647–655.[Abstract/Free Full Text]

  55. Murrell AM, Bockamp EO, Göttgens B et al. Discordant regulation of SCL/TAL-1 mRNA and protein during erythroid differentiation. Oncogene 1995;11:131–139.[Medline]

  56. Ma X, Robin C, Ottersbach K et al. The Ly-6A (Sca-1) GFP transgene is expressed in all adult mouse hematopoietic stem cells. STEM CELLS 2002;20:514–521.[Abstract/Free Full Text]

  57. Spangrude GJ, Brooks DM. Mouse strain variability in the expression of the hematopoietic stem cell antigen Ly-6A/E by bone marrow cells. Blood 1993;82:3327–3332.[Abstract/Free Full Text]

  58. Okuno Y, Huettner CS, Radomska HS et al. Distal elements are critical for human CD34 expression in vivo. Blood 2002;100:4420–4426.[Abstract/Free Full Text]

  59. Chen CZ, Li M, de Graaf D et al. Identification of endoglin as a functional marker that defines long-term repopulating hematopoietic stem cells. Proc Natl Acad Sci U S A 2002;99:15468–15473.[Abstract/Free Full Text]

  60. Ferrando AA, Herblot S, Palomero T et al. Biallelic transcriptional activation of oncogenic transcription factors in T-cell acute lymphoblastic leukemia. Blood 2004;103:1909–1911.[Abstract/Free Full Text]

Received March 3, 2005; accepted for publication May 12, 2005.



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
J. Sausville, A. A. Molinolo, X. Cheng, J. Frampton, N. Takebe, J. S. Gutkind, and R. A. Feldman
RCAS/SCL-TVA Animal Model Allows Targeted Delivery of Polyoma Middle T Oncogene to Vascular Endothelial Progenitors In vivo and Results in Hemangioma Development
Clin. Cancer Res., June 15, 2008; 14(12): 3948 - 3955.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J.-R. Landry, S. Kinston, K. Knezevic, M. F.T.R. de Bruijn, N. Wilson, W. T. Nottingham, M. Peitz, F. Edenhofer, J. E. Pimanda, K. Ottersbach, et al.
Runx genes are direct targets of Scl/Tal1 in the yolk sac and fetal liver
Blood, March 15, 2008; 111(6): 3005 - 3014.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Ogilvy, R. Ferreira, S. G. Piltz, J. M. Bowen, B. Gottgens, and A. R. Green
The SCL +40 Enhancer Targets the Midbrain Together with Primitive and Definitive Hematopoiesis and Is Regulated by SCL and GATA Proteins
Mol. Cell. Biol., October 15, 2007; 27(20): 7206 - 7219.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
E. Bockamp, C. Antunes, M. Maringer, R. Heck, K. Presser, S. Beilke, S. Ohngemach, R. Alt, M. Cross, R. Sprengel, et al.
Tetracycline-controlled transgenic targeting from the SCL locus directs conditional expression to erythrocytes, megakaryocytes, granulocytes, and c-kit-expressing lineage-negative hematopoietic cells
Blood, September 1, 2006; 108(5): 1533 - 1541.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
L. R. Mollica, J. T. B. Crawley, K. Liu, J. B. Rance, P. N. Cockerill, G. A. Follows, J.-R. Landry, D. J. Wells, and D. A. Lane
Role of a 5'-enhancer in the transcriptional regulation of the human endothelial cell protein C receptor gene
Blood, August 15, 2006; 108(4): 1251 - 1259.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. E. Pimanda, L. Silberstein, M. Dominici, B. Dekel, M. Bowen, S. Oldham, A. Kallianpur, S. J. Brandt, D. Tannahill, B. Gottgens, et al.
Transcriptional Link between Blood and Bone: the Stem Cell Leukemia Gene and Its +19 Stem Cell Enhancer Are Active in Bone Cells.
Mol. Cell. Biol., April 1, 2006; 26(7): 2615 - 2625.
[Abstract] [Full Text] [PDF]</