Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online August 11, 2005
Stem Cells Vol. 24 No. 1 January 2006, pp. 13 -22
doi:10.1634/stemcells.2004-0346; www.StemCells.com
© 2006 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0346v1
24/1/13    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yokota, T.
Right arrow Articles by Sato, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yokota, T.
Right arrow Articles by Sato, S.

TISSUE-SPECIFIC STEM CELLS

Bone Marrow Lacks a Transplantable Progenitor for Smooth Muscle Type {alpha}-Actin–Expressing Cells

Takafumi Yokotaa, Yutaka Kawakamib, Yoshinori Nagaia, Jian-xing Mab, Jen-Yue Tsaic, Paul W. Kincadea, Sanai Satob

a Immunobiology and Cancer Program, Oklahoma Medical Research Foundation, Oklahoma City, Oklahoma;
b Department of Medicine, University of Oklahoma Health Science Center, Oklahoma City, Oklahoma;
c National Eye Institute, NIH, Bethesda, Maryland, USA

Key Words. Hematopoietic stem cells • Stromal cells • Transdifferentiation • Smooth muscle {alpha}-actin • Transgenic green fluorescent protein mouse

Correspondence: Sanai Sato, M.D., Ph.D., Medicine/Endocrinology, OUHSC, PO Box 26901, BSEB 331, Oklahoma City, Oklahoma 73190-3048, USA. Telephone: 405-271-5896; Fax: 405-271-5973; e-mail: sanai-sato{at}ouhsc.edu


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
While some studies have suggested that hematopoietic stem cells might give rise to other tissue types, others indicate that transdifferentiation would have to be an extremely rare event. We have now exploited smooth muscle type {alpha}-actin ({alpha}SMA) promoter– driven green fluorescent protein (GFP) transgenic mice ({alpha}SMA-GFP mice) for bone marrow transplantation to evaluate their potential to generate donor-type tissues in irradiation chimeras. There was a highly restricted pattern of GFP expression in the transgenic mice, marking bone marrow stromal cells and mesangial cells in the kidney. However, these characteristics were not transferable to wild-type animals given transgenic marrow cells even though hematopoietic cells were largely replaced. Our findings support earlier studies suggesting that the bone marrow microenvironment is difficult to transplant and indicate that hematopoietic stem cells are unlikely to give rise to {alpha}SMA-expressing progeny.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bone marrow contains hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs) [1, 2]. Bone marrow cells are capable of differentiating into various lineages including hepatocytes [35], vascular endothelial cells [6], biliary epithelial cells [7], adipocytes [1], cardiomyocytes [8], neuronal cells [9], and skeletal muscle cells [10, 11]. This has raised the hope of developing new stem cell strategies for tissue repair and regeneration.

Recent studies with nonspecific green fluorescent protein (GFP) transgenic mice have also suggested that bone marrow HSCs may give rise into other tissue/cell types, including vascular smooth muscle cells [12] and glomerular mesangial cells [13]. However, many other studies argue against HSC plasticity [1419]. Cell fusion is the central issue in this controversy [20]. Macrophages have an ability to fuse among themselves and with other cell types [21] and are the major participants in cell fusion [18, 22]. Because any tissue injury results in extensive recruitment of inflammatory cells, the evidence for stem cell plasticity is often confounded by the results of cell fusion. There is another technical issue in bone marrow transplantation. Bone marrow stromal cells, including MSCs [1, 23], are generally not replaced with systemic bone marrow transplantation [24, 25]. To address these issues, the specific identification of the cells of interest and minimizing the potential of false-positive results by cell fusion are crucial.

Recently, we have developed a new transgenic smooth muscle type {alpha}-actin ({alpha}SMA)-GFP mouse that carries a GFP gene coupled with {alpha}SMA regulatory sequence [26]. By utilizing this {alpha}SMA-GFP mouse as a bone marrow donor, the smooth muscle cells originating from transplanted bone marrow cells can be specifically identified by the expression of GFP. Here, we report that bone marrow of {alpha}SMA-GFP mouse contains GFP+ ({alpha}SMA-expressing) cells. However, a progenitor for {alpha}SMA-expressing cells was not transplantable in systemic bone marrow chimeras even when hematopoiesis was successfully reconstituted by transplanted stem cells. Developmental plasticity of HSCs seems to be strictly limited, and the transdifferentiation of HSCs into mesenchymal cells unlikely occurs in vivo.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
{alpha}SMA-GFP and Tie2-GFP Mice
The {alpha}SMA-GFP mice (C57BL6) that express GFP under the control of {alpha}SMA promoter were produced in the Transgenic Mice Facility of the National Eye Institute, NIH. The {alpha}SMA promoter was provided by Dr. James A. Fagin of Ohio State University (see Wang et al. [26] for details). The regulatory sequence of {alpha}SMA gene used contains –1074 bp of 5' flanking region, the transcription start site, 48 bp of exon 1, the 2.5-kb intron 1, and the 15-bp exon 2 of mouse {alpha}SMA. GFP is specifically expressed in both vascular and nonvascular smooth muscle cells [27, 28].

Tie2-GFP mice that express GFP under endothelial-specific receptor tyrosine kinase (Tek, also called Tie-2) promoter were first described by Motoike et al. [29]. The mice used in this study were obtained through Jackson Laboratory (Bar Harbor, ME, http://www.jax.org) (stock No. 003658). Because the mouse strain FVB/N, the original background of Tie2-GFP mouse, carries the rd mutant gene that causes retinal degeneration [30], the mice were backcrossed to C57BL6. The removal of rd mutant gene was confirmed by polymerase chain reaction (PCR) amplification followed by digestion with the restriction enzyme Dde 1 that recognizes the mutant sequences [31].

All experimental procedures involving animals were reviewed by the Institutional Animal Care and Use Committee of University of Oklahoma Health Sciences Center, and animals were cared for in accordance with its guidelines.

Bone Marrow Transplantation
Bone marrow transplantation was performed with {alpha}SMA-GFP and Tie2-GFP mice as donors and Rag2–/– mice (T- and B-cell deficient [32], C57BL6 background) as recipients. Immediately after the mice were killed by carbon dioxide suffocation, bone marrow cells were flushed from femurs and tibiae, pooled, and washed twice with Ca2+-, Mg2+-free phosphate-buffered saline (PBS). The recipient mice received a lethal dose (950 rads) of total body irradiation from a 137Cs source. After 5 to 6 hours of irradiation, 107 bone marrow cells were injected to the recipient mice through the tail vein, as described [13, 33]. Unless specifically mentioned, all experiments in this study were conducted at 6 months after the bone marrow transplantation was performed.

Vascular Smooth Muscle Cells
Aortas were obtained from {alpha}SMA-GFP mice immediately after they were euthanized with carbon dioxide suffocation. The aortas were carefully dissected, and all contaminating tissues were removed under a microscope. The obtained aortas were minced into small pieces with two blades and cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (FCS) (Biofluids Inc., Rockville, MD, http://www.biofluids.com) in collagen-coated culture plates (Becton Dickinson Labware, Bedford, MA, http://www.bd.com) under a 5% carbon dioxide atmosphere. The cells were grown from the pieces of aorta attached to the culture plate within a few days and expanded at least up to four to five passages. In this study, the cells were used at four passages. The identity of cells was confirmed by detecting the expression of GFP and immunostaining with antibody against {alpha}SMA (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com). Retinal capillary pericytes were cultured as previously reported [34].

Isolation of Renal Glomeruli and Mesangial Cell Cultures
Immediately after the mice were killed, kidneys were dissected into cortex and medulla regions. The cortex was minced into small pieces with blades and passed through a 50-mesh stainless steel sieve (sieve opening, 300 µm; VWR International, Bristol, CT, http://www.vwr.com) and a 100-µm nylon cell strainer (BD Biosciences, Franklin Lakes, NJ, http://www.bdbiosciences.com). In this differential sieving, the intact glomeruli retained on the 100-µm nylon cell strainer, whereas many small-tissue debris/fragments went through the strainer. The glomeruli were washed and resuspended in PBS. The purity of glomeruli was confirmed by microscopy.

To culture mesangial cells, the glomeruli were incubated with 750 U/ml collagenase (type IA) (Sigma-Aldrich) in PBS at 37°C for 25 minutes. After being washed with PBS, the digested glomeruli were cultured in DMEM media containing 10% FCS. The identity of cells was confirmed by immunostaining with antibody against {alpha}SMA.

Antibodies and Cell Sorting
The antibodies phycoerythrin (PE)-conjugated Flk-1 and Sca-1 (Ly6A/E; D7) monoclonal antibodies (mAbs) and allophycocyanin (APC)-conjugated CD44, Mac-1, and c-kit (2B8) mABs were all purchased from BD PharMingen (San Diego, http://www.bdbiosciences.com/pharmingen). PE-conjugated anti-Tie2 (TEK) was purchased from eBioscience (San Diego, http://www.ebioscience.com). The stained cells with PE- or APC-conjugated antibodies were subjected to sorting on a MoFlo (DakoCytomation, Fort Collins, CO, http://www.dakocytomation.us). Flow cytometric analysis was performed with a FAC-Scalibur and the Cellquest program (Becton Dickinson Labware).

Isolation of Bone Marrow Hematopoietic Stem Cells and Peripheral Mononuclear Cells
Bone marrow cells collected from mice were suspended with Hanks’ medium supplemented with 3% FCS. Cells were incubated with antibodies to lineage markers (Gr-1 and Mac-1 for myeloid cells, anti-CD19 and anti-CD45RA for B lineage cells, and TER-119 for erythroid cells), followed by incubation with goat anti-rat immunoglobulin G-coated magnetic beads (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com). Cells attached to beads were removed with a magnetic separator using negative selection columns. The lineage-depleted bone marrow cells were then incubated with a mixture of labeled antibodies to the lineage markers (fluorescein isothiocyanate-conjugated anti-CD3, anti-CD8, anti–Gr-1, anti–Mac-1, anti–TER-119, anti-CD2, and anti-CD45R) and APC-conjugated anti–c-kit antibody and PE-conjugated anti–Sca-1 antibody to sort lineage marker–negative (Lin) c-kit+ and Sca-1+ populations. In this study, Lin Sca-1+ c-kit+ cells were used as HSC-enriched cells.

Peripheral mononuclear cells were separated from blood by centrifugation on Ficoll/Hypaque (lymphocyte separation medium; Cellgro, Mediatech, Herndon, VA, http://www.cellgro.com).

DNA Preparation and Polymerase Chain Reaction
DNA isolation was performed with a QIAshredder (Qiagen, Valencia, CA, http://www1.qiagen.com) and a DNA isolation kit (QIAprep mini spin kit, Qiagen). All experiments were conducted according to the manufacturer’s instructions.

PCR was conducted using PuReTaq Ready-To-Go PCR Beads (0.2 ml tubes/plate, Amersham Biosciences, Piscataway, NJ, http://www.amersham.com) on a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com). Approximately 50 ng of isolated genomic DNA was amplified in a total volume of 25 µl with PCR beads that contained 2.5 units of Tag DNA polymerase, 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, 200 µ M of dATP, dCTP, dGTP, and dTTP, and RNase/DNase-free bovine serum albumin. The amplification was performed by a total of 32 cycles of denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, and elongation at 72°C for 30 seconds. The products were visualized by ethidium bromide after electrophoresis on 1% agarose gel. The primers used were AGAACATCATCCCTGCATCC (sense primer) and CTGGGATGGAAATTGTGAGG (antisense primer) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (product size, 500 bp) and AAGGGCGAGGAGCTGTTCAC (sense primer) and TTCTGCTGGTAGTGGTCGGC (anti-sense primer) for GFP (product size, 495 bp).

Real-time PCR was conducted on a Smart Cycler II system (Cepheid, Sunnyvale, CA, http://www.cepheid.com) using SYBER Green reverse transcription–PCR reagents (Applied Biosystems). The experiments were performed according to the manufacturer’s instructions.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
{alpha}SMA-GFP Mice Express GFP in Vascular Smooth Muscle Cells Including Renal Glomerular Mesangial Cells
{alpha}SMA-GFP transgenic mice carry a GFP gene regulated by the {alpha}SMA promoter, and GFP expression is strictly limited to the cells that express {alpha}SMA [27, 28]. No hematopoietic cells express GFP. In retina, GFP was detectable only in retinal vasculature (Fig. 1AGo) because vascular smooth muscle cells and capillary pericytes are the only cells that express {alpha}SMA. GFP was also detectable in cultured capillary pericytes (Fig. 1BGo). Similarly, vascular smooth muscles are the major {alpha}SMA-expressing cells in the kidney. In glomeruli, however, mesangial cells are the only cell type that expresses {alpha}SMA. Although the {alpha}SMA levels in normal mesangial cells are generally low in vivo [35], GFP was still detectable in glomeruli isolated from {alpha}SMA-GFP mice (Fig. 2AGo). Moreover, in cell culture, mesangial cells all displayed the high levels of GFP expression (Fig. 2BGo). This indicates that, by using {alpha}SMA-GFP mice as bone marrow donors, newly formed smooth muscle cells and glomerular mesangial cells of bone marrow origin can be specifically identified.


Figure 1
View larger version (60K):
[in this window]
[in a new window]
 
Figure 1. Green fluorescent protein (GFP) images of flat mount of retina (A) and cultured retinal capillary pericytes (B) from smooth muscle type {alpha}-actin–GFP mice. Note that GFP was expressed only in retinal vasculature. The signals of GFP were stronger in arterioles than venuoles, reflecting the thickness of smooth muscle layers of vessels.

 

Figure 2
View larger version (72K):
[in this window]
[in a new window]
 
Figure 2. Green fluorescent protein (GFP) expression in renal glomerulus (A) and mesangial cells (B) isolated from smooth muscle type {alpha}-actin–GFP mouse. In (A), GFP image is overlapped on the phase-contrast image of isolated glomerulus.

 
Bone Marrow of {alpha}SMA-GFP Transgenic Mice Contains a Small Population of GFP+ Cells
Using an isolation method for authentic GFP+ cells, a small GFP+ population (0.02%–0.03% of bone marrow mononuclear cells) could be specifically detected and sorted from bone marrow [36]. No GFP+ cells were detectable in wild-type mice. Those marrow-derived {alpha}SMA-GFP+ cells were heterogeneous with respect to Sca-1, c-kit, and Mac-1 expression (Fig. 3Go). Their surface phenotype was Sca-1 in 82.2%, c-kit in 70.4%, and Mac-1+ in 55.4%, whereas CD44 was detectable on more than 99% of the cells. Those GFP+ cells were distinct from endothelial lineage cells because two vascular endothelial cell markers, Tie-2 and Flk-1 (VEGFR2, KDR), were negative. The marrow-derived GFP+ cells were also distinct from vascular smooth muscle cells. The cells isolated from aorta of {alpha}SMA-GFP mice were brighter in GFP intensity and exclusively negative for Mac-1 expression (Fig. 4Go). Importantly, similar GFP+ cells to ones in bone marrow were also detectable in peripheral blood of {alpha}SMA-GFP mice at very low frequencies (approximately 0.15% of mononuclear cells).


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. Expression of surface phenotype of green fluorescent protein (GFP)-positive bone marrow cells from smooth muscle type {alpha}-actin–GFP mice.

 

Figure 4
View larger version (27K):
[in this window]
[in a new window]
 
Figure 4. Comparison of green fluorescent protein (GFP)–positive bone marrow cells (left) and aorta smooth muscle cells (right) isolated from smooth muscle type {alpha}-actin–GFP mice.

 
Bone Marrow Stromal Cells Derived From {alpha}SMA-GFP Mice Express GFP
Although {alpha}SMA is a well-established cell marker for smooth muscle cells and differentiated myofibroblasts [37], bone marrow stromal cells are also known to express {alpha}SMA [3840]. Stromal cells are adherent and clonogenic in vitro and are suggested to contain a putative smooth muscle progenitor [41]. To confirm the {alpha}SMA expression in stromal cells, we examined whether GFP+ cells were detectable in bone marrow cell cultures established from {alpha}SMA-GFP mice (Fig. 5Go).


Figure 5
View larger version (43K):
[in this window]
[in a new window]
 
Figure 5. Green fluorescent protein (GFP) expression in bone marrow stromal cells isolated from smooth muscle–type {alpha}-actin ({alpha}SMA)-GFP mice. Bone marrow cells from {alpha}SMA-GFP mice were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum. (A): Phase-contrast image of the cells cultured for 7 days. (B): GFP image of (A). (C): GFP image of the cells after the culture for 14 days. Note that GFP is positive only in the cells (stromal cells) that strongly attached to the culture plate but not in other cell types.

 
Bone marrow cells obtained from {alpha}SMA-GFP mice were cultured in DMEM media supplemented with 10% FCS that had been widely used for the culture of vascular smooth muscle cells and capillary pericytes [42]. Although no obvious GFP+ cells were observed at the initiation of culture, cells with high GFP intensity became conspicuous among the cells attached to the culture plate within 1 to 2 weeks. When the culture was continued, GFP+ cells gradually dominated among the attached cells. The bone marrow cells were also cultured in Dexter media that can support in long-term the growth of hematopoietic cells as well as stromal cells. GFP expression was detected only in the stromal cells that were strongly attached to culture plates. No hematopoietic cells grown in the same culture showed GFP expression. This indicates that bone marrow contains stromal progenitors that differentiate into cells expressing {alpha}SMA.

Because {alpha}SMA-GFP mice contain GFP+ bone marrow cells, there is a possibility that this small population of GFP+ cells can be the source for {alpha}SMA-expressing (GFP+) stromal cells. To test this possibility, GFP+ cells sorted from bone marrow cells of {alpha}SMA-GFP mice were cultured in DMEM media containing 10% FCS. However, no GFP+ stromal cells were detected in culture even after more than 4 weeks. It is also possible that, to differentiate into stromal cells, these cells may require the interaction with some other cell types. To test this possibility, the same GFP+ cells were also cultured together with the whole bone marrow cells from wild-type mice. However, stromal cells grown in this culture were all GFP negative. This suggests that {alpha}SMA-expressing (GFP+) cells are unlikely to be the progenitors for {alpha}SMA-expressing stromal cells.

{alpha}SMA-GFP Chimeric Mice Reconstitute Hematopoiesis With Stem Cells Carrying a {alpha}SMA-GFP Transgene
To test the hypothesis that bone marrow cells can be a source of progenitors for vascular smooth muscle cells or glomerular mesangial cells, we performed bone marrow transplantation to create a chimeric model in which marrow cells from {alpha}SMA-GFP mice were transferred into wild-type mice (Rag2–/– mice) that received a lethal dose (950 rads) of irradiation. Because neither granulocytes nor monocytes express {alpha}SMA, the possible artifact by cell fusion [17, 18] could be minimized by using {alpha}SMA-GFP mice as bone marrow donors.

The long-term reconstitution of hematopoiesis by donor HSCs was confirmed by detecting the GFP transgene in bone marrow cells at 6 months after bone marrow transplantation. In PCR analysis (Fig. 6Go), the GFP transgene was detected in whole bone marrow cells, sorted Lin c-kit+ Sca-1+ cells, and peripheral mononuclear cells (MNCs) obtained from the recipients of {alpha}SMA-GFP marrow transplant. The intensity of PCR product amplified for GFP gene in chimeric mice was comparable to that of {alpha}SMA-GFP donor mice. Without receiving bone marrow transplants, no PCR products for the GFP gene were detected in the cells of wild-type mice. To estimate the efficiency of transplantation, the GFP transgene was quantified by real-time PCR. The transplantation efficiency (percent) based on the copy number of GFP transgene adjusted by a house-keeping GAPDH gene was 86.8 ± 11 (mean ± standard deviation, n = 6). This confirms that, at least, HSCs of {alpha}SMA-GFP transgenic mice were successfully transplanted and the hematopoietic cells were largely replaced with cells carrying the {alpha}SMA-GFP transgene.


Figure 6
View larger version (50K):
[in this window]
[in a new window]
 
Figure 6. Detection of green fluorescent protein (GFP) transgene by polymerase chain reaction in whole bone marrow cells (A), hematopoietic stem cell-enriched Lin Sca-1+ c-kit+ cells (B), and peripheral mononuclear cells (C) of smooth muscle type {alpha}-actin ({alpha}SMA)-GFP mice (lane 1), wild-type (Rag2–/–) mice that received bone marrow transplantation from {alpha}SMA-GFP mice (lane 2), and wild-type (Rag2–/–) mice without transplantation (lane 3).

 
To further confirm the replacement of HSCs, we performed bone marrow transplantation using Tie2-GFP mice that express GFP under the control of a Tie-2 promoter. Because HSCs are known to express Tie-2 [43, 44], Tie2-GFP+ cells can be detectable in bone marrow of Tie2-GFP chimeric mice if HSCs are successfully transplanted. In flow cytometric analysis (Fig. 7Go), Tie2-GFP mice displayed a small population of GFP+ cells. This GFP+ cell population was also clearly detectable in Tei2-GFP chimeric mice, confirming that HSCs are transplantable with the procedure used for {alpha}SMA-GFP mice in this study.


Figure 7
View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Flow cytometric analysis of bone marrow cells of Tie2–green fluorescent protein (GFP) mouse (A), Rag2–/– mouse (B), and Rag2–/– mouse receiving bone marrow transplantation from Tie2-GFP mice (C). The numbers in graph indicate the percentages of GFP-positive cells.

 
{alpha}SMA-GFP Chimeric Mice Generate Neither GFP+ Bone Marrow Cells nor GFP+ Stromal Cells
Because reconstitution of hematopoiesis with stem cells carrying the {alpha}SMA-GFP gene was confirmed, we examined whether {alpha}SMAs expressing bone marrow cells and stromal cells were also reconstituted with the cells carrying the {alpha}SMA-GFP transgene in {alpha}SMA-GFP chimeric mice.

In flow cytometric analyses, {alpha}SMA-GFP mice displayed a small population (0.02%–0.03%) of GFP+ bone marrow cells whereas no GFP+ cells were detected in wild-type mice. In {alpha}SMA-GFP chimeric mice, however, there was no significant increase in the GFP+ cell population (Fig. 8Go). This was true with 20 chimeric mice that successfully received the {alpha}SMA-GFP bone marrow transplant. The bone marrow cells were also cultured in DMEM containing 10% FCS using six-well plates, and the GFP expression was examined under the fluorescent microscope continuously twice a week until cells reached 60%–80% confluence (approximately 106 cells per well). However, no single GFP+ cell was detected at any time throughout cell culture (Fig. 9Go). This means that no single animal among 20 mice showed an increase in GFP+ bone marrow cells and no single GFP+ cell was detected among 2 x 107 stromal cells examined. This suggests that a progenitor for {alpha}SMA-expressing ({alpha}SMA-GFP+) cells is distinct from that for hematopoietic cells. It is also not transplantable.


Figure 8
View larger version (23K):
[in this window]
[in a new window]
 
Figure 8. Green fluorescent protein (GFP)-positive bone marrow cells of smooth muscle type {alpha}-actin ({alpha}SMA)-GFP mouse (A), Rag2–/– mouse (B), and Rag2–/– mouse received from bone marrow transplantation from {alpha}SMA-GFP chimeric (Rag2–/– ) mouse (C) at 6 months after transplantation.

 

Figure 9
View larger version (92K):
[in this window]
[in a new window]
 
Figure 9. Phase contrast (left) and green fluorescent protein (GFP) images (right) of bone marrow stromal cells. Bone marrow cells isolated from smooth muscle type {alpha}-actin ({alpha}SMA)-GFP mice (A) and a wild-type (Rag2–/– ) mouse that received bone marrow transplantation from {alpha}SMA-GFP mice (B) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal calf serum for 2 weeks.

 
No GFP+ Glomerular Mesangial Cells Were Generated in {alpha}SMA-GFP Chimeric Mice
A previous study using nonspecific GFP mice suggested that bone marrow HSCs can generate glomerular mesangial cells [13]. If HSCs differentiate into {alpha}SMA-expressing mesangial cells, GFP+ cells should be detectable in glomeruli of {alpha}SMA-GFP chimeric mice where hematopoiesis was reconstituted with HSCs carrying the {alpha}SMA-GFP gene.

Unlike {alpha}SMA-GFP donor mice, however, no GFP expression was detected in glomeruli of {alpha}SMA-GFP marrow–recipient mice. It is still possible that, since the expression levels of {alpha}SMA in normal glomeruli in vivo are generally low, newly formed mesangial cells would not express detectable levels of GFP even though they carried the {alpha}SMA-GFP gene. To more rigorously explore whether glomeruli contained mesangial cells with the {alpha}SMA-GFP gene, the isolated glomeruli were digested with collagenase and cultured in DMEM media containing 10% FCS because mesangial cells highly express {alpha}SMA in vitro [35] (Fig. 2Go). If HSCs differentiate into mesangial cells, GFP+ cells should have been detectable among the cells grown from glomeruli even if GFP was undetectable in intact glomeruli. With the procedure described here, approximately 10,000 glomeruli were generally recovered from one kidney. GFP expression was also routinely examined under fluorescent microscope until the cells reached near confluence (approximately 106 cells) in six-well plates. This means that nearly 4 x 105 isolated glomeruli and 4 x 107 cultured mesangial cells from 20 mice that successfully received {alpha}SMA-GFP bone marrow transplants were examined. However, no GFP+ cells were detected in either isolated glomeruli or cultured mesangial cells from {alpha}SMA-GFP chimeric mice despite the fact that the same cells from {alpha}SMA-GFP donor mice all displayed strong GFP signals (Fig. 10Go). These findings strongly suggest that the competence of marrow HSCs to generate {alpha}SMA-expressing cells in the periphery is extremely low. The transdifferentiation of HSCs in vivo, if any, must be an extremely rare event.


Figure 10
View larger version (84K):
[in this window]
[in a new window]
 
Figure 10. Phase-contrast (left) and green fluorescent protein (GFP) images (right) of glomerular mesangial cells isolated from smooth muscle–type {alpha}-actin ({alpha}SMA)-GFP mice (A) and wild-type (Rag2–/–) mouse that received a bone marrow transplant from {alpha}SMA-GFP mice (B).

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Creating chimeric mice by bone marrow transplantation has been widely used to identify cells of marrow origin, but discrimination of donor-type cells is the key step in this approach. The present study uses a new transgenic {alpha}SMA-GFP mouse that expresses GFP under control of the {alpha}SMA promoter as a bone marrow donor to specifically identify donor-type {alpha}SMA-expressing cells. Because GFP expression is limited to cells that express {alpha}SMA, GFP+ cells are detectable only when the cells from donor mice differentiate into {alpha}SMA-expressing cells. The principal findings are as follows. First, murine bone marrow contains a small population of {alpha}SMA-expressing cells, and {alpha}SMA is present in cultured marrow stromal cells. Second, the progenitor for these {alpha}SMA-expressing cells is distinct from HSCs and is not systemically transplantable. Third, the plasticity of HSCs is strictly limited, and HSCs unlikely differentiate into mesenchymal cells under physiological conditions.

Bone marrow cells have been shown to differentiate into various mesenchymal cells, although the originating progenitors have not been well defined. Nonspecific GFP mice that express GFP under control of the chicken {alpha}-actin promoter with a cytomegarovirus enhancer [45] have been widely used as bone marrow donors to create chimeric mice. GFP+ cells have been detected in choroidal angiogenesis [46] and in renal glomeruli [13, 33, 47, 48] using this chimeric model. With this evidence, bone marrow cells were suggested to contribute to regeneration of vascular smooth muscle cells in peripheral tissues. However, because all hematopoietic cells were GFP positive, it is difficult to conclusively identify the particular GFP+ cells. Moreover, monocytes/macrophages carrying the GFP protein often fuse to host cells. Mesenchymal stem cells are also known to include stromal cells [25, 49] that are capable of differentiating into {alpha}SMA-expressing cells [41]. However, in general, stromal cells are not replaced with systemic bone marrow transplantation [24, 25]. Whether bone marrow contains a transplantable mesenchymal progenitor is still controversial. Our study clearly demonstrated that no {alpha}SMA-expressing stromal cells expressed GFP in {alpha}SMA-GFP chimeric mice even though hematopoiesis was successfully reconstituted with cells carrying a {alpha}SMA-GFP transgene. This indicates that stem or progenitor cells for {alpha}SMA-expressing cells and stem/progenitors (HSCs) for hematopoiesis are distinct and that stromal progenitors are not transplantable.

The plasticity of HSCs is another controversial issue [50]. Sata et al. [12] reported that {alpha}SMA-expressing cells were generated from transplanted HSC-enriched Lin c-kit+ Sca-1+ cells in injured arteries. Masuya et al. [13] also reported that glomerular mesangial cells were generated from Lin c-kit+ Sca-1+ CD34 cells from a bone marrow donor even without particular tissue injuries, suggesting that HSCs can contribute to physiological turnover of mesangial cells. Our data directly contradict those studies. In this study, the {alpha}SMA-GFP transgene was clearly detectable in both Lin c-kit+ Sca-1+ bone marrow cells and peripheral mononuclear cells of {alpha}SMA-GFP chimeric mice. If HSCs were the source of {alpha}SMA-expressing cells, some {alpha}SMA-GFP+ cells should have been detectable in either intact glomeruli or cultured mesangial cells. However, not even one GFP+ cell was detected in many mice that successfully received {alpha}SMA-GFP marrow transplants. This indicates that transdifferentiation of HSCs to nonhematopoietic cell types is unlikely to occur in vivo. This also indicates the importance of the use of specific mesenchymal markers for the study of mesenchymal stem/progenitors. The infiltration of inflammatory cells is inevitable in many cases and particularly in injured tissues. Even though "false positives" by cell fusion are carefully excluded, the identification of a small population of real GFP+ cells is difficult if many GFP+ inflammatory cells are present.

The present study also demonstrated that bone marrow contains a small population of GFP+ ({alpha}SMA-expressing) cells and similar GFP+ cells were also detectable in peripheral mononuclear cell preparations. These cells were negative for the endothelial cell markers Tie-2 and KDR. They were also different from vascular smooth muscle cells with respect to Mac-1 expression and the intensity of GFP signals. However, these cells are unlikely to be progenitors for {alpha}SMA-expressing cells. At the very least, they are not the source of {alpha}SMA-expressing stromal cells in bone marrow cell culture in vitro.

The stromal stem/progenitor for {alpha}SMA-expressing cells is clearly difficult to transplant. In this study, we used Rag2–/– mice as bone marrow recipients to enhance the engraftment of such bone marrow minor populations by combining immunodeficiency of Rag2–/– and lethal doses of irradiation. However, the progenitor for {alpha}SMA-expressing cells was not transplantable. Whether the efficiency could be improved to transplant the stromal progenitor is an important question relevant to developing new tissue regeneration therapies. New strategies such as direct infusion into the bone cavity may be needed to effectively engraft such cells [5153]. {alpha}SMA-GFP mice should provide an excellent tool for that type of investigation.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
T.Y. and Y.K. contributed equally to this study. Supported by NIH grant AI 20069 (to P.W.K.).

DISCLOSURES
The authors indicate no potential conflicts of interest.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.[Abstract/Free Full Text]

  2. Fibbe WE. Mesenchymal stem cells. A potential source for skeletal repair. Ann Rheum Dis 2002;61(suppl 2):ii29–ii31.[Free Full Text]

  3. Petersen BE, Bowen WC, Patrene KD et al. Bone marrow as a potential source of hepatic oval cells. Science 1999;284:1168–1170.[Abstract/Free Full Text]

  4. Alison MR, Poulsom R, Jeffery R et al. Hepatocytes from non-hepatic adult stem cells. Nature 2000;406:257.[CrossRef][Medline]

  5. Lagasse E, Connors H, Al-Dhalimy M et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med 2000;6:1229–1234.[CrossRef][Medline]

  6. Asahara T, Murohara T, Sullivan A et al. Isolation of putative progenitor endothelial cells for angiogenesis. Science 1997;275:964–967.[Abstract/Free Full Text]

  7. Theise ND, Nimmakayalu M, Gardner R et al. Liver from bone marrow in humans. Hepatology 2000;32:11–16.[CrossRef][Medline]

  8. Makino S, Fukuda K, Miyoshi S et al. Cardiomyocytes can be generated from marrow stromal cells in vitro. J Clin Invest 1999;103:697–705.[Medline]

  9. Eglitis MA, Mezey E. Hematopoietic cells differentiate into both microglia and macroglia in the brains of adult mice. Proc Natl Acad Sci U S A 1997;94:4080–4085.[Abstract/Free Full Text]

  10. Ferrari G, Cusella-De Angelis G, Coletta M et al. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 1998;279:1528–1530.[Abstract/Free Full Text]

  11. Gussoni E, Soneoka Y, Strickland CD et al. Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 1999;401:390–394.[CrossRef][Medline]

  12. Sata M, Saiura A, Kunisato A et al. Hematopoietic stem cells differentiate into vascular cells that participate in the pathogenesis of atherosclerosis. Nat Med 2002;8:403–409.[CrossRef][Medline]

  13. Masuya M, Drake CJ, Fleming PA et al. Hematopoietic origin of glomerular mesangial cells. Blood 2003;101:2215–2218.[Abstract/Free Full Text]

  14. Wagers AJ, Sherwood RI, Christensen JL et al. Little evidence for developmental plasticity of adult hematopoietic stem cells. Science 2002; 297:2256–2259.[Abstract/Free Full Text]

  15. Chien KR. Stem cells: lost in translation. Nature 2004;428:607–608.[CrossRef][Medline]

  16. Murry CE, Soonpaa MH, Reinecke H et al. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 2004;428:664–668.[CrossRef][Medline]

  17. Balsam LB, Wagers AJ, Christensen JL et al. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature 2004;428:668–673.[CrossRef][Medline]

  18. Camargo FD, Finegold M, Goodell MA. Hematopoietic myelomonocytic cells are the major source of hepatocyte fusion partners. J Clin Invest 2004;113:1266–1270.[CrossRef][Medline]

  19. Nygren JM, Jovinge S, Breitbach M et al. Bone marrow-derived hematopoietic cells generate cardiomyocytes at a low frequency through cell fusion, but not transdifferentiation. Nat Med 2004;10:494–501.[CrossRef][Medline]

  20. Camargo FD, Chambers SM, Goodell MA. Stem cell plasticity: from transdifferentiation to macrophage fusion. Cell Prolif 2004;37:55–65.[CrossRef][Medline]

  21. Vignery A. Osteoclasts and giant cells: macrophage-macrophage fusion mechanism. Int J Exp Pathol 2000;81:291–304.[CrossRef][Medline]

  22. Willenbring H, Bailey AS, Foster M et al. Myelomonocytic cells are sufficient for therapeutic cell fusion in liver. Nat Med 2004;10:744–748.[CrossRef][Medline]

  23. Pereira RF, O’Hara MD, Laptev AV et al. Marrow stromal cells as a source of progenitor cells for nonhematopoietic tissues in transgenic mice with a phenotype of osteogenesis imperfecta. Proc Natl Acad Sci U S A 1998;95:1142–1147.[Abstract/Free Full Text]

  24. Simmons PJ, Przepiorka D, Thomas ED et al. Host origin of marrow stromal cells following allogeneic bone marrow transplantation. Nature 1987;328:429–432.[CrossRef][Medline]

  25. Bianco P, Gehron Robey P. Marrow stromal stem cells. J Clin Invest 2000;105:1663–1668.[Medline]

  26. Wang J, Niu W, Nikiforov Y et al. Targeted overexpression of IGF-I evokes distinct patterns of organ remodeling in smooth muscle cell tissue beds of transgenic mice. J Clin Invest 1997;100:1425–1439.[Medline]

  27. Tsai J-Y, Yu Z-X, Wawrousek EF et al. Generation and characterization of SMAA-GFP mice. Invest Ophthalmol Vis Sci 2001;42:2734.

  28. Tsai J-Y, Yamamoto T, Fariss RN et al. Using SMAA-GFP mice to study pericyte coverage of retinal vessels. Invest Ophthalmol Vis Sci 2002;43: E-abstract 1929.

  29. Motoike T, Loughna S, Perens E et al. Universal GFP reporter for the study of vascular development. Genesis 2000;28:75–81.[CrossRef][Medline]

  30. Pittler SJ, Baehr W. Identification of a nonsense mutation in the rod photoreceptor cGMP phosphodiesterase beta-subunit gene of the rd mouse. Proc Natl Acad Sci U S A 1991;88:8322–8326.[Abstract/Free Full Text]

  31. Gimenez E, Montoliu L. A simple polymerase chain reaction assay for genotyping the retinal degeneration mutation (Pdeb(rd1)) in FVB/N-derived transgenic mice. Lab Anim 2001;35:153–156.[Medline]

  32. Shinkai Y, Rathbun G, Lam KP et al. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 1992;68:855–867.[CrossRef][Medline]

  33. Imasawa T, Utsunomiya Y, Kawamura T et al. The potential of bone marrow-derived cells to differentiate to glomerular mesangial cells. J Am Soc Nephrol 2001;12:1401–1409.[Abstract/Free Full Text]

  34. Sato S, Secchi EF, Lizak MJ et al. Polyol formation and NADPH-dependent reductases in dog retinal capillary pericytes and endothelial cells. Invest Ophthalmol Vis Sci 1999;40:697–704.[Abstract/Free Full Text]

  35. Elger M, Drenckhahn D, Nobiling R et al. Cultured rat mesangial cells contain smooth muscle alpha-actin not found in vivo. Am J Pathol 1993;142:497–509.[Abstract]

  36. Yokota T, Kouro T, Hirose J et al. Unique properties of fetal lymphoid progenitors identified according to RAG1 gene expression. Immunity 2003;19:365–375.[CrossRef][Medline]

  37. Tomasek JJ, Gabbiani G, Hinz B et al. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol 2002;3:349–363.[CrossRef][Medline]

  38. Peled A, Zipori D, Abramsky O et al. Expression of alpha-smooth muscle actin in murine bone marrow stromal cells. Blood 1991;78:304–309.[Abstract/Free Full Text]

  39. Galmiche MC, Koteliansky VE, Briere J et al. Stromal cells from human long-term marrow cultures are mesenchymal cells that differentiate following a vascular smooth muscle differentiation pathway. Blood 1993; 82:66–76.[Abstract/Free Full Text]

  40. Cai D, Marty-Roix R, Hsu HP et al. Lapine and canine bone marrow stromal cells contain smooth muscle actin and contract a collagen-glycosaminoglycan matrix. Tissue Eng 2001;7:829–841.[CrossRef][Medline]

  41. Kashiwakura Y, Katoh Y, Tamayose K et al. Isolation of bone marrow stromal cell-derived smooth muscle cells by a human SM22alpha promoter: in vitro differentiation of putative smooth muscle progenitor cells of bone marrow. Circulation 2003;107:2078–2081.[Abstract/Free Full Text]

  42. Sakurai S, Alam S, Pagan-Mercado G et al. Retinal capillary pericyte proliferation and c-Fos mRNA induction by prostaglandin D2 through the cAMP response element. Invest Ophthalmol Vis Sci 2002;43:2774–2781.[Abstract/Free Full Text]

  43. Shaw JP, Basch R, Shamamian P. Hematopoietic stem cells and endothelial cell precursors express Tie-2, CD31 and CD45. Blood Cells Mol Dis 2004;32:168–175.[CrossRef][Medline]

  44. Arai F, Hirao A, Ohmura M et al. Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 2004;118:149–161.[CrossRef][Medline]

  45. Okabe M, Ikawa M, Kominami K et al. "Green mice" as a source of ubiquitous green cells. FEBS Lett 1997;407:313–319.[CrossRef][Medline]

  46. Espinosa-Heidmann DG, Caicedo A, Hernandez EP et al. Bone marrow-derived progenitor cells contribute to experimental choroidal neovascularization. Invest Ophthalmol Vis Sci 2003;44:4914–4919.[Abstract/Free Full Text]

  47. Ito T, Suzuki A, Imai E et al. Bone marrow is a reservoir of repopulating mesangial cells during glomerular remodeling. J Am Soc Nephrol 2001; 12:2625–2635.[Abstract/Free Full Text]

  48. Imai E, Ito T. Can bone marrow differentiate into renal cells? Pediatr Nephrol 2002;17:790–794.[CrossRef][Medline]

  49. Gronthos S, Zannettino AC, Hay SJ et al. Molecular and cellular characterisation of highly purified stromal stem cells derived from human bone marrow. J Cell Sci 2003;116:1827–1835.[Abstract/Free Full Text]

  50. Hirschi KK, Majesky MW. Smooth muscle stem cells. Anat Rec 2004; 276A:22–33.[Medline]

  51. Kushida T, Inaba M, Hisha H et al. Intra-bone marrow injection of allogeneic bone marrow cells: a powerful new strategy for treatment of intractable autoimmune diseases in MRL/lpr mice. Blood 2001;97:3292–3299.[Abstract/Free Full Text]

  52. Wang J, Kimura T, Asada R et al. SCID-repopulating cell activity of human cord blood-derived CD34-cells assured by intra-bone marrow injection. Blood 2003;101:2924–2931.[Abstract/Free Full Text]

  53. Burt RK, Verda L, Kim DA et al. Embryonic stem cells as an alternate marrow donor source: engraftment without graft-versus-host disease. J Exp Med 2004;199:895–904.[Abstract/Free Full Text]

Received on December 6, 2004; accepted for publication on June 27, 2005.




This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
V. A. Dolgachev, M. R. Ullenbruch, N. W. Lukacs, and S. H. Phan
Role of Stem Cell Factor and Bone Marrow-Derived Fibroblasts in Airway Remodeling
Am. J. Pathol., February 1, 2009; 174(2): 390 - 400.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
S. H. Phan
Biology of Fibroblasts and Myofibroblasts
Proceedings of the ATS, April 15, 2008; 5(3): 334 - 337.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. Hinz, S. H. Phan, V. J. Thannickal, A. Galli, M.-L. Bochaton-Piallat, and G. Gabbiani
The Myofibroblast: One Function, Multiple Origins
Am. J. Pathol., June 1, 2007; 170(6): 1807 - 1816.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2004-0346v1
24/1/13    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yokota, T.
Right arrow Articles by Sato, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yokota, T.
Right arrow Articles by Sato, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS