Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online September 22, 2005
Stem Cells Vol. 24 No. 1 January 2006, pp. 177 -185
doi:10.1634/stemcells.2004-0159; www.StemCells.com
© 2006 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow All Versions of this Article:
2004-0159v1
24/1/177    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Constantinescu, D.
Right arrow Articles by Csoka, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Constantinescu, D.
Right arrow Articles by Csoka, A. B.

EMBRYONIC STEM CELLS-CHARACTERIZATION SERIES

Lamin A/C Expression Is a Marker of Mouse and Human Embryonic Stem Cell Differentiation

Dan Constantinescua, Heather L. Grayb, Paul J. Sammakb, Gerald P. Schattena, Antonei B. Csokab

a Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA;
b Department of Obstetrics, Gynecology & Reproductive Sciences, University of Pittsburgh School of Medicine, Pittsburgh Development Center of Magee-Womens Research Institute, Pittsburgh, Pennsylvania, USA

Key Words. Embryonic stem cells • Differentiation • Pluripotency • Lamin A • Lamin B • Nuclear lamina

Correspondence: Antonei B. Csoka, Ph.D., Department of Obstetrics, Gynecology & Reproductive Sciences, University of Pittsburgh School of Medicine, Pittsburgh Development Center of Magee-Womens Research Institute, 204 Craft Ave, Pittsburgh, Pennsylvania 15213, USA. Telephone: 412-641-2433; Fax: 412-641-2410; e-mail: acsoka{at}pdc.magee.edu


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nuclear lamins comprise the nuclear lamina, a scaffold-like structure that lines the inner nuclear membrane. B-type lamins are present in almost all cell types, but A-type lamins are expressed predominantly in differentiated cells, suggesting a role in maintenance of the differentiated state. Previous studies have shown that lamin A/C is not expressed during mouse development before day 9, nor in undifferentiated mouse embryonic carcinoma cells. To further investigate the role of lamins in cell phenotype maintenance and differentiation, we examined lamin expression in undifferentiated mouse and human embryonic stem (ES) cells. Wide-field and confocal immunofluorescence microscopy and semiquantitative reverse transcription–polymerase chain reaction analysis revealed that undifferentiated mouse and human ES cells express lamins B1 and B2 but not lamin A/C. Mouse ES cells display high levels of lamins B1 and B2 localized both at the nuclear periphery and throughout the nucleoplasm, but in human ES cells, B1 and B2 expression is dimmer and localized primarily at the nuclear periphery. Lamin A/C expression is activated during human ES cell differentiation before downregulation of the pluripotency marker Oct-3/4 but not before the downregulation of the pluripotency markers Tra-1-60, Tra-1-81, and SSEA-4. Our results identify the absence of A-type lamin expression as a novel marker for undifferentiated ES cells and further support a role for nuclear lamins in cell maintenance and differentiation.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nuclear lamins are intermediate filament proteins that were originally identified as components of the nuclear lamina [1, 2], a 10- to 50-nm-thick meshwork of proteins that underlies the inner nuclear membrane [3]. It had traditionally been thought that the nuclear lamina functions primarily to provide structural support and organization to the nuclear envelope [410], but recent reports have documented that lamins exist throughout the nucleoplasm, suggesting structural contributions to a nuclear matrix [1113] and roles in DNA replication [14], transcription [15], and RNA processing [1618]. Mutations in lamins have also been assigned a causative role in the group of diseases collectively called laminopathies [19, 20].

In mammals, seven lamin proteins, which are the products of three genes, have been identified and can be divided into two subtypes. B-type lamins include B1, encoded by the LMNB1 gene, and B2 and B3, splice variants of the LMNB2 gene [2123]. A-type lamins A, A{Delta}10, C, and C2 are all splice variants of the LMNA gene [2426]. Lamins B3 and C2 are expressed only in male germ cells [22, 25]. The remaining B-type lamins are present ubiquitously in embryonic and adult cell types. At the cellular level, lamins B1 and B2 are essential for cell growth and survival [27]. lmnB1 knockout mice exhibit abnormal lung and bone development and die at birth [28]. Contrastingly, A-type lamins are primarily found in differentiated cells. During mouse embryonic development, expression of A-type lamins is first detected on day 9 in extraembryonic tissues and on day 12 in the embryo itself [2933]. Embryonic carcinoma cells generally express little or no A-type lamins [30, 34]. Lastly, certain adult cell types that are not fully differentiated also express little or no A-type lamins [29, 35]. Consistent with these findings, lamin A/C is not essential for cell growth and survival [27]. Although lmna knockout mice exhibit normal development at birth, they soon develop retarded postnatal growth and a muscular dystrophy phenotype that results in death by 8 weeks of age [4]. The detection of A-type lamins primarily in differentiated cells suggests that they might function to limit developmental plasticity by maintaining a cell’s differentiated phenotype [29].

Embryonic stem (ES) cells are obtained from the inner cell mass of blastocyst-stage embryos and exhibit unlimited proliferative capacity and pluripotency [36, 37]. The ability of ES cells to differentiate into all cell types of the embryo suggests that they are ideal candidates for therapeutic use. However, the specific differentiation of ES cells toward desired lineages remains ineffective, resulting in mixtures of differentiated cells. Further, due to the proliferative capacity of ES cells and their tendency to form teratomas when transplanted into animals [38, 39], it is important to ensure that differentiated cells do not revert back to an ES cell phenotype after transplantation. Such reversion has been reported for mouse muscle–derived stem cells after differentiation into hematopoietic lineages [40] and for drosophila spermatogonial stem cells that have differentiated into spermatogonia [41]. Thus, before clinical applications, it is necessary to understand the mechanisms controlling ES cell differentiation and the maintenance of the differentiated state. Given the possible role of nuclear lamins in cell maintenance and differentiation, we decided to characterize their expression in mouse ES (mES) and human ES (hES) cells. We report that 129/SVEV mES cells and HSF-6 hES cells express lamins B1 and B2 but not lamin A/C and that as HSF-6 hES cells begin to differentiate into neuronal lineages and cardiomyocytes, lamin A/C expression is activated. Our results demonstrate that lamin A/C expression is a reliable marker of ES cell differentiation.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture

mES Cells   129/SVEV mES cells (Specialty Media, Phillipsburg, NJ, http://www.specialtymedia.com) were maintained in an undifferentiated state by coculture with mitomyocin-treated (Sigma-Al-drich, St. Louis, http://www.sigmaaldrich.com) SNL mouse embryonic fibroblast (MEF) feeder cells (gift from Dr. Richard Chaillet, University of Pittsburgh) in Dulbecco’s modified Eagle’s medium (DMEM) with 15% fetal bovine serum, 1% non-essential amino acids, 1 mM L-glutamine, 0.1 mM ß-mercaptoethanol, 1% nucleosides (all from Specialty Media), and 105 U/ml leukemia inhibitory factor (Chemicon, Temecula, CA, http://www.chemicon.com). Cells were passaged every 2 to 3 days, and media were changed daily.

hES Cells   HSF-6 hES cells (from University of California San Francisco, under license) were maintained in an undifferentiated state by coculture with mitomyocin-treated CF-1 MEF feeder cells in DMEM medium with 20% knockout serum replacer, 1% non-essential amino acids, 1 mM L-glutamine, and 4 ng/ml fibroblast growth factor-2 (all from Invitrogen, Carlsbad, CA, http://www.invitrogen.com). Cells were passaged every 5 to 7 days, and media were changed daily. WI-38 human embryonic lung fibroblasts were cultured in DMEM with 15% fetal bovine serum and 2 mM L-glutamine. Neuronal lineages and cardiomyocytes were obtained by culture of HSF-6 hES for 5 weeks on CF-1 MEF feeder cells without passage. Media were changed every 2 days.

RNA Isolation and Reverse
Transcription–Polymerase Chain Reaction
  The centers of undifferentiated HSF-6 colonies, cultured for 5 days under optimal conditions, were gently scraped with pulled Pasteur pipettes (Figs. 1A, 1BGo). Whole colonies of HSF-6 cells, which had begun to naturally differentiate after 10 days in culture, were scraped as well. WI-38 cells were trypsinized. All cells were spun at x 200 g for 5 minutes and then washed twice with phosphate-buffered saline (PBS). Cell pellets were immediately frozen in liquid nitrogen and stored at –80°C. RNA was isolated using RNAqueous 4-PCR (Ambion, Austin, TX, http://www.ambion.com), and cDNA was generated using the Reverse Transcription System (Promega, Madison, WI, http://www.promega.com) following the manufacturer’s instructions. Spectrophotometry was used to verify quantity and quality of RNA and cDNA. Semiquantitative polymerase chain reaction (PCR) was performed with 50 ng of cDNA in a final concentration of 0.02 U Biolase DNA polymerase, 1 x NH4 buffer, 2.5 mM MgCl2 (Bioline, Randolph, MA, http://www.bioline.com), 0.2 mM dNTPs (Roche Diagnostics, Basel Switzerland, http://www.roche-applied-science.com), and 0.2 µM primers (Invitrogen). PCR conditions were 95°C for 3 minutes followed by 35 cycles at 95°C for 35 seconds, 55°C for 40 seconds, and 72°C for 45 seconds and a final extension at 72°C for 7 minutes. Human-specific primers used for each gene were as follows:


Figure 1
View larger version (96K):
[in this window]
[in a new window]
 
Figure 1. Detection of lamin mRNA in human embryonic stem (hES) cells. HSF-6 hES cells were cultured for 5 days after passage, and the centers of colonies were scraped to obtain a pure population of undifferentiated HSF-6 hES cells for RNA isolation (A, B). Whole HSF-6 hES cell colonies cultured for 10 days after passage, consisting of undifferentiated and differentiated cells, were also scraped for RNA isolation (not shown). (C): Reverse transcription–polymerase chain reaction of WI-38 fibroblasts (lane 1), HSF-6 center colony scrapings (CCS) (lane 2), and HSF-6 whole colony scrapings (WCS) (lane 3).

 
Lamin A/C forward: AATGATCGCTTGGCGGTCTAC, Lamin A/C reverse: CTTCTTGGTATTGCGCGCTTT (255 bp);

Lamin B1 forward: AAAAGACAACTCTCGTCGCAT, Lamin B1 reverse: CCGCTTTCCTCTAGTTGTACG (256 bp);

Lamin B2 forward: ATTCAGAATCCAGGCGTCGAC, Lamin B2 reverse: TTATTGTTGTGACAGGTCTTACGA CG (339 bp);

B-actin forward: TGGCACCACACCTTCTACAATGAGC, B-actin reverse: GCACAGCTTCTCCTTAATGTCACGC (400 bp);

Oct-4 forward: CGRGAAGCTGGAGAAGGAGAAGCTG, Oct-4 reverse: AAGGGCCGCAGCTTACACATGTTC (230 bp).

Wide-Field and Confocal Microscopy and Immunocytochemistry   hES and mES cells were passaged 4 to 5 days and 2 days, respectively, before fixation. Cells were fixed with 100% methanol for 20 minutes at –20°C or 2% formaldehyde for 45 minutes. Cells were subsequently washed twice with PBS, per-meabilized with 0.1% Triton X-100, and incubated for 1 hour at 25°C with combinations of the following primary antibodies: monoclonal mouse anti-human Oct-4 (1:50), polyclonal rabbit anti-human lamin A/C (1:100) (both from Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.com), monoclonal mouse anti-human lamin B1 (1:50) and B2 (1:50) (both from Zymed Laboratories, San Francisco, http://www.zymed.com), monoclonal mouse anti–ß-III tubulin (1:250), mouse antinestin (1:200) (both from Covance, Berkeley, http://www.covance.com), mouse anti-sarcomeric {alpha}-actinin (EA-53) (1:100) (from Sigma), mouse anti–SSEA-4, mouse anti–TRA-160, mouse anti–TRA-180, and mouse anti-light meromyosin (MF-20) (1:3) (all obtained from the Developmental Studies Hybridoma Bank under the auspices of the NICHID, University of Iowa, Department of Biological Sciences, Iowa City). Cells were washed three times with PBS, and the primary antibodies were detected with Alexa Fluor 488, Alexa Fluor 546, and Alexa Fluor 568 secondary antibodies (all 1:100) (all from Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com) for 1 hour at 25°C. DNA was visualized with TOTO-3 (1:1,000) (Molecular Probes), which was added to the secondary antibody mix. Cells were washed three times in PBS and mounted onto glass slides with Vectashield mounting medium (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). Confocal images were captured with a Leica TCS SP2 using proprietary Leica software.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Undifferentiated mES and hES Cells Do Not Express A-Type Lamins
Semiquantitative reverse transcription (RT)-PCR analysis with human-specific primers was used to examine lamin A/C expression levels in HSF-6 hES cells. The centers of several HSF-6 hES cell colonies were scraped 5 days after passage to isolate undifferentiated cells and exclude peripheral cells that might be differentiating (Figs. 1A, 1BGo). Whole colonies were also scraped 10 days after passage to examine whether lamin A/C expression is activated in some peripheral cells. Using this method, we show that HSF-6 hES cells, obtained by center colony scraping and that are undifferentiated by morphological appearance (Fig. 1AGo), express Oct-4 but little or no detectable lamin A/C (Fig. 1CGo, lane 2). In contrast, differentiated WI-38 control cells express lamin A/C (Fig. 1CGo, lane 1). However, lamin A/C was detected in whole colony scrapings (Fig. 1CGo, lane 3), suggesting that lamin A/C expression is activated in some peripheral ES cells that are, presumably, differentiating.

Immunocytochemistry experiments corroborated the RT-PCR results, demonstrating a lack of lamin A/C in HSF-6 hES cells and 129SV/EV mES cells (Fig. 2Go). The pluripotency markers Oct-4, [37, 38, 42], TRA-1-60 [37, 43], TRA-1-81 [37, 43], and SSEA-4 [37, 44] were used to identify undifferentiated cells along with morphological observations (undifferentiated ES cells are relatively small [8- to 10-µm diameter] with a high nucleus/cytoplasm ratio). Undifferentiated HSF-6 hES cells, which are positive for Oct-4 (Fig. 2BGo), TRA-1–60 (Fig. 2EGo), TRA-1-81 (Fig. 2HGo), and SSEA-4 (Fig. 2KGo), lack lamin A/C (Figs. 2C, 2F, 2I, 2LGo), but adjacent CF-1 MEF feeder cells that are negative for each of the pluripotency markers are lamin A/C positive. Similar results were obtained with the H1 hES cell line (not shown). Furthermore, 129/SVEV mES cells, as identified by Oct-4 labeling (Fig. 2NGo), do not express lamin A/C (Fig. 2OGo). In contrast, differentiated SNL MEF feeder cells adjacent to the mES cells that are negative for Oct-4 labeling contain lamin A/C. Collectively, these observations indicate that undifferentiated ES cells do not express lamin A/C.


Figure 2
View larger version (49K):
[in this window]
[in a new window]
 
Figure 2. Human embryonic stem (hES) and mouse embryonic stem (mES) cells do not contain lamin A/C. HSF-6 hES cells were fixed with 100% methanol (A–C) or 2% formaldehyde (D–L) 4 to 5 days after passage. 129/SVEV mES cells were fixed with 100% methanol (M–O) 2 days after passage. Cells were colabeled for lamin A/C (C, F, I, L, O) and the pluripotency markers Oct-4 (B, N), TRA-160 (E), TRA-180 (H), and SSEA-4 (K). Undifferentiated HSF-6 hES cells growing in a colony are positive for Oct-4 (B), TRA-160 (E), TRA-180 (H), and SSEA-4 (L) but negative for lamin A/C (C, F, I, L). Conversely, adjacent differentiated CF-1 mouse embryonic fibroblast (MEF) feeder cells are negative for the pluripotency markers but positive for lamin A/C. Undifferentiated 129/SVEV mES cells within a colony are positive for Oct-4 (N) but negative for lamin A/C (O), whereas adjacent differentiated SNL MEF feeder cells are negative for Oct-4 but positive for lamin A/C. DNA was visualized with TOTO-3 (A, D, G, J, M). Representative MEF feeder cells are identified with arrows. Images were captured using confocal microscopy. Scale bar = 50 µm.

 
Undifferentiated mES and hES Cells Express B-Type Lamins
Next, we used RT-PCR analysis to investigate the expression of lamins B1 and B2 in HSF-6 hES cells and report that HSF-6 hES cells express lamin B1 (Fig. 1CGo, lane 2), but under the conditions used, we could not detect the presence of lamin B2 mRNA (Fig. 1CGo, lane 2). Immunocytochemistry experiments showed that undifferentiated HSF-6 hES cells and 129/SVEV mES cells contain lamins B1 and B2 (Fig. 3Go). Because we previously demonstrated that undifferentiated HSF-6 hES cells and 129/SVEV mES cells do not express lamin A/C, we used this feature along with morphological characteristics to identify undifferentiated ES cells. Undifferentiated HSF-6 hES cells that are lamin A/C negative (Figs. 3B, 3EGo) express lamins B1 (Fig. 3CGo) and B2 (Fig. 3FGo). Similarly, undifferentiated 129/SVEV mES cells that are lamin A/C negative (Figs. 3H, 3KGo) express lamin B1 (Fig. 3IGo) and lamin B2 (Fig. 3LGo). Interestingly, lamins B1 and B2 levels are low in HSF-6 hES cells relative to the differentiated CF-1 MEF feeder cells. Further, lamin B2 is localized primarily at the nuclear envelope (Fig. 4FGo), whereas lamin B1 demonstrates a peripheral and punctate labeling pattern throughout the nucleoplasm (Fig. 4CGo). These results indicate that mouse and human ES cells express both B-type lamins, although expression and/or protein levels may be lower than in differentiated cell types and localization may differ.


Figure 3
View larger version (71K):
[in this window]
[in a new window]
 
Figure 3. Human embryonic stem (hES) and mouse embryonic stem (mES) cells contain lamin B1 and B2. HSF-6 hES cells were fixed with methanol 5 days after passage. Cells were colabeled for lamin A/C (B, E, H, K) in conjunction with either lamin B1 (C, I) or lamin B2 (F, L). Undifferentiated HSF-6 hES cells are negative for lamin A/C (B, E) but positive for lamin B1 (C) and B2 (F). Adjacent differentiated CF-1 MEF feeder cells are positive for lamin A/C, lamin B1, and lamin B2. Lamin B1 (F) and B2 (I) levels are low in hES cells relative to the MEF feeder cells. DNA was visualized with TOTO-3 (A, D, G, J). Representative MEF feeder cells are identified with arrows. Images were captured using confocal microscopy. Scale bar = 50 µm (A–C, G–J) or 5 µm (D–F, J–L).

 

Figure 4
View larger version (38K):
[in this window]
[in a new window]
 
Figure 4. Lamins B1 and B2 localize primarily to the nuclear envelope of undifferentiated human embryonic stem (hES) cells. HSF-6 hES cells were colabeled for lamin A/C (B, E) and lamin B1 (C) or lamin B2 (F). Undifferentiated HSF-6 hES cells that are lamin A/C-negative (B, E) exhibit low levels of lamins B1 (C) and B2 (F). Lamin B2 is present primarily at the nuclear periphery (F). Lamin B1 is present at the periphery as well as in punctate structures throughout the nucleoplam. DNA was visualized with TO-TO-3 (A, E). Images were captured with confocal microscopy. Scale bar = 5 µm.

 
hES Cells Express A-Type Lamins Upon Differentiation to Neuronal Lineages and Cardiomyocytes
Our RT-PCR results from whole HSF-6 hES cell colony scrapings suggested that lamin A/C expression is activated in some peripheral hES cells, suggesting that expression is activated in differentiating cells. Further, some HSF-6 hES cell colonies that we examined exhibited peripheral cells that labeled for both Oct-4 (Fig. 5BGo) and lamin A/C (Fig. 5CGo) and probably represent cells that are beginning to differentiate. To investigate this further, we used immunocytochemistry to examine if lamin A/C expression is activated in neuronal lineages and cardiomyocytes derived from HSF-6 hES cells. Neuronal cells, as identified by either nestin (Fig. 5EGo) or ß-III tubulin (Fig. 5FGo), labeled for lamin A/C (Figs. 5F, 5IGo). Similarly, beating cardiomyocytes, as identified by {alpha}-actinin (Fig. 5KGo) or light meromyosin (MF 20) (Fig. 5NGo), also demonstrated lamin A/C expression (Figs. 5L, 5OGo). Our results indicate that, upon differentiation to neuronal lineages and cardiomyocytes, hES cells begin to express lamin A/C. Furthermore, the detection of cells at the periphery of some HSF-6 hES cell colonies that label for both Oct-4 and lamin A/C suggests that lamin A/C expression is activated before downregulation of Oct-4 so that there is a transient overlap in expression. We did not observe similar colabeling of lamin A/C with Tra-1-60, Tra-1-81, and SSEA-4.


Figure 5
View larger version (47K):
[in this window]
[in a new window]
 
Figure 5. Lamin A/C is activated upon human embryonic stem (hES) cell differentiation to neuronal lineages and cardiomyocytes. Some HSF-6 hES cell colonies contained peripheral cells that colabeled for Oct-4 (B) and lamin A/C (C) with varying intensity. HSF-6 hES cells were cultured for 5 weeks on CF-1 MEF feeder cells without passage to obtain neuronal lineages (D–I) and cardiomyocytes (J–O). Differentiated cells were labeled for lamin A/C (F, I, L, O) in conjunction with either nestin (E), ß-III tubulin (H), {alpha}-actinin (K), or light meromyosin (MF-20) (N). DNA was labeled with TOTO-3 (A, D, G, J). Neuronal lineages, as identified by nestin (E) or ß-III tubulin (H), are positive for lamin A/C (F, I). Cardiomyocytes, as identified by {alpha}-actinin (K) or light meromyosin (MF-20) (N), are positive for lamin A/C (L, O). Images were captured with confocal microscopy. Scale bars = 25 µm.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nuclear lamins are components of the nuclear envelope that are involved in nuclear structural support and organization [410], DNA replication [14], transcription [15], and RNA processing [16, 17]. B-type lamins are present in most cell types from the first zygotic cell division through adulthood [29]. Contrastingly, A-type lamins are detected primarily in cells that are differentiated, as demonstrated by the lack of expression for most mouse embryonic development [29], in various adult cells that are not fully differentiated [29] and in EC cell lines [30, 34]. The observation that B-type lamins are present in all cell types but that A-type lamins are present primarily in differentiated cells suggests that A-type lamins could function to maintain the differentiated state. To begin investigating this possibility, we examined lamin expression in embryonic stem cells and differentiated derivatives. Because ES cells are isolated from blastocyst-stage embryos and are pluripotent [36], we hypothesized that undifferentiated ES cells should express B-type but not A-type lamins and that as ES cells differentiate, lamin A/C expression would be activated.

Using semiquantitative RT-PCR with human-specific primers, we show that undifferentiated HSF-6 cells express lamin B1 (Fig. 1Go, lane 2), but lamin B2 (Fig. 1Go, lane 2) could not be detected using two different sets of primers (only one shown). Interestingly, immunocytochemistry analysis identified the presence of both lamin B1 (Figs. 3C, 3IGo) and B2 (Figs. 3F, 3LGo) in HSF-6 hES and 129/SVEV mES cells. However, HSF-6 hES cells seem to have lower B-type lamin levels relative to differentiated CF-1 MEF feeder cells. Further lamin B2 localization seems to be primarily peripheral, with little or no labeling throughout the nucleoplasm (Fig. 4FGo), whereas lamin B1 seems to be localized both to the periphery and in nuclear foci (Fig. 4CGo). This suggests that although B-type lamins are present in HSF-6 hES cells, the nuclear lamina structure at the periphery and throughout the nucleoplasm is relatively underdeveloped.

Our ability to detect lamin B2 protein using immunocytochemistry but inability to detect lamin B2 mRNA using RT-PCR in HSF-6 hES cells seems contradictory. Cross-reactivity of the lamin B2 antibody with lamin B1 is highly unlikely because it has been shown that the antibody does not detect lamin B1 in Western analysis [45], so we hypothesize two alternative explanations. First, lamin B2 mRNA might have a very short half-life, but sufficient protein accumulates for immunofluorescent detection. Second, hES cells might express a splice variant of lamin B2 that is recognized by the primary antibody but lacks the region amplified by the PCR primers. For example, lamin B3 is a significantly smaller splice variant of lamin B2 that so far has only been detected in male germ cells [22]. However, if such a splice variant is present in hES cells, it is unlikely to be lamin B3 because the region of lamin B2 amplified by the PCR primers is shared by lamin B3 [22]. Therefore, it is possible that hES cells express a unique, previously unidentified splice variant of lamin B2.

Both RT-PCR and immunofluorescence analysis demonstrate that HSF-6 hES cells (Fig. 1CGo, lane 2; Figs. 2C, 2F, 2I, 2LGo) and 129/SVEV mES cells (Fig. 2OGo) do not express lamin A/C. Further, our results show that lamin A/C expression is activated in neuronal lineages (Figs. 5F, 5IGo) and cardiomyocytes (Figs. 5L, 5OGo) differentiated from HSF-6 hES cells. This is consistent with previous reports that have detected lamin A/C only in differentiated cell types [2935]. Interestingly, cells at the periphery of some HSF-6 hES cell colonies, where spontaneous differentiation sometimes occurs (our observations), express both Oct-4 (Fig. 5BGo) and lamin A/C (Fig. 5CGo). The intensity of Oct-4 and lamin A/C labeling varied within individual peripheral cells that had both present, but no statistically significant relationship could be established; we observed cells that had high intensity labeling for both, low intensity labeling for both, or high intensity for one and low intensity for the other. The different combinations of Oct-4 and lamin A/C expression in individual cells suggests that either protein is not directly influenced by the other. Interestingly, different ratios of Oct-4 to lamin A/C could represent cells undertaking alternate differentiation pathways. Thus, it seems that lamin A/C is activated before complete Oct-4 downregulation during the in vitro differentiation process, suggesting that lamin A/C expression is an earlier indicator of ES cell differentiation. However, we did not observe similar colabeling of lamin A/C with Tra-1-60, Tra-1-81, or SSEA-4, suggesting that these pluripotency markers are downregulated before the activation of lamin A/C expression in vitro.

Taken together, our results identify the absence of A-type lamins as a novel marker of undifferentiated ES cells in culture and positive expression as an indicator of differentiation. The presence of B-type lamins but absence of A-type lamins in ES cells demonstrates another similarity between ES cell lines and the inner cell mass cells from which they are derived. However, during murine development, Oct-4 is downregulated in somatic tissues well before lamin A/C expression is detected in any cell type. We describe lamin A/C expression before Oct-4 down-regulation in HSF-6 hES cells, suggesting that in vitro differentiation of ES cell lines might not mimic the consecutive steps that lead to tissue specification during embryonic development in vivo. Lastly, our results are in accordance with a possible role for A-type lamins in the maintenance of the differentiated state.

How could A-type lamins maintain cells in a differentiated state? Once expressed, A-type lamins could "lock" the nucleus of differentiated cells in particular gene expression patterns. This would be a simple way to maintain transcriptional and phenotypic stability in specialized, terminally differentiated cells. A-type lamins could accomplish this by increasing nuclear rigidity, which could constrain chromatin remodeling. Several lines of evidence support this possibility. First, cells from patients with various LMNA mutations have an abnormally plastic nuclear morphology, marked by lobes and invaginations [9, 10]. Second, it has been directly shown that lamin A/C deficiency reduces nuclear structural integrity under mechanical strain [5]. Lastly, lamin A/C [46, 47] and lamin-associated proteins [48] can interact directly with chromatin by binding DNA directly or via DNA-associated proteins. Alternatively, lamin A/C could regulate the expression of specific genes that are involved in the maintenance of a differentiated state, as evidenced by observations that lamin A/C can interact with transcription factors such as MOK2 [49] and SREBP1 [50], as well as retinoblastoma, which is involved in regulating cell-cycle arrest and apoptosis [5153]. Lamin A/C might also have widespread effects on gene expression because proper lamin A/C organization may be essential for polymerase II–dependent transcription [15, 18] and has been found to colocalize with splicing factor speckles [1618]. The possibility should be considered that laminopathies arise because cells are unable to maintain their differentiated state as a result of a disorganized nuclear lamina caused by lamin A mutations. Cellular dysdifferentiation, previously postulated as a cause of cancer and aging [5456], would result in abnormal gene expression, reduced proliferation, and/or apoptosis. The devastating premature aging disease Hutchinson-Gilford Progeria Syndrome could be the ultimate example of such dysdifferentiation.

If A-type lamins maintain the differentiated state by "locking" cells in a specific gene expression pattern, whether directly through structural modification of the nuclear envelope or indirectly by influencing the expression of other genes, their absence in undifferentiated ES cells might be essential for pluripotency. The presence of a flexible nuclear envelope could be necessary for proper chromatin remodeling, which occurs during differentiation. Interestingly, the low levels and/or altered organization of B-type lamins observed in HSF-6 hES cells (Figs. 3C, 3FGo, 4C, 4FGo) could also contribute to nuclear envelope flexibility. In such a scenario, forced expression of lamin A/C or increased B-type lamin expression might "lock" ES cells in their natural undifferentiated state.

In conclusion, our results identify the lack of lamin A/C as a novel marker for undifferentiated ES cells and lamin A/C expression as an early indicator of differentiation. These observations support the hypothesis that lamin A/C has a functional role in the maintenance of the differentiated state. Further, our results and the observation that undifferentiated ES have few nuclear pores (unpublished data) suggest that there are multiple structural differences between the nuclear envelopes of undifferentiated and differentiated cells that may be critical to the differentiation process.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We thank Esther Jane, Patti Petrosko, Amy Mucka, and Hina Qidwai for maintaining the 129/SVEV mouse and HSF-6 human ES cell lines; Richard Chaillet for donating immortalized SNL MEF feeder cells; Leah Kauffman for editing the manuscript; and Chris Navara and Vanessa Y. Rawe for helpful discussion.

DISCLOSURES
The authors indicate no potential conflicts of interest.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Aebi U, Cohn J, Buhle L et al. The nuclear lamina is a meshwork of intermediate-type filaments. Nature 1986;323:560–564.[CrossRef][Medline]

  2. McKeon FD, Kirschner MW, Caput D. Homologies in both primary and secondary structure between nuclear envelope and intermediate filament proteins. Nature 1986;319:463–468.[CrossRef][Medline]

  3. Fawcett DW. On the occurrence of a fibrous lamina on the inner aspect of the nuclear envelope in certain cells of vertebrates. Am J Anat 1966;119:129–145.[CrossRef][Medline]

  4. Sullivan T, Escalante-Alcalde D, Bhatt H et al. Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J Cell Biol 1999;147:913–920.[Abstract/Free Full Text]

  5. Lammerding J, Schulze PC, Takahashi T et al. Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. J Clin Invest 2004;113:370–378.[CrossRef][Medline]

  6. Newport JW, Wilson KL, Dunphy WG. A lamin-independent pathway for nuclear envelope assembly. J Cell Biol 1990;111:2247–2259.[Abstract/Free Full Text]

  7. Smythe C, Jenkins HE, Hutchison CJ. Incorporation of the nuclear pore basket protein nup153 into nuclear pore structures is dependent upon lamina assembly: evidence from cell-free extracts of Xenopus eggs. EMBO J 2000;19:3918–3931.[CrossRef][Medline]

  8. Lenz-Bohme B, Wismar J, Fuchs S et al. Insertional mutation of the Drosophila nuclear lamin Dm0 gene results in defective nuclear envelopes, clustering of nuclear pore complexes, and accumulation of annulate lamellae. J Cell Biol 1997;137:1001–1016.[Abstract/Free Full Text]

  9. Vigouroux C, Auclair M, Dubosclard E et al. Nuclear envelope disorganization in fibroblasts from lipodystrophic patients with heterozygous R482Q/W mutations in the lamin A/C gene. J Cell Sci 2001;114:4459–4468.[Medline]

  10. Csoka AB, Cao H, Sammak PJ et al. Novel lamin A/C gene (LMNA) mutations in atypical progeroid syndromes. J Med Genet 2004;41:304–308.[Free Full Text]

  11. Goldman AE, Moir RD, Montag-Lowy M et al. Pathway of incorporation of microinjected lamin A into the nuclear envelope. J Cell Biol 1992;119:725–735.[Abstract/Free Full Text]

  12. Bridger JM, Kill IR, O’Farrell M et al. Internal lamin structures within G1 nuclei of human dermal fibroblasts. J Cell Sci 1993;104:297–306.[Abstract]

  13. Hozak P, Sasseville AM, Raymond Y et al. Lamin proteins form an internal nucleoskeleton as well as a peripheral lamina in human cells. J Cell Sci 1995;108:635–644.[Abstract]

  14. Moir RD, Spann TP, Herrmann H et al. Disruption of nuclear lamin organization blocks the elongation phase of DNA replication. J Cell Biol 2000;149:1179–1192.[Abstract/Free Full Text]

  15. Spann TP, Goldman AE, Wang C et al. Alteration of nuclear lamin organization inhibits RNA polymerase II-dependent transcription. J Cell Biol 2002;156:603–608.[Abstract/Free Full Text]

  16. Jagatheesan G, Thanumalayan S, Muralikrishna B et al. Colocalization of intranuclear lamin foci with RNA splicing factors. J Cell Sci 1999;112:4651–4661.[Abstract]

  17. Muralikrishna B, Dhawan J, Rangaraj N et al. Distinct changes in intranuclear lamin A/C organization during myoblast differentiation. J Cell Sci 2001;114:4001–4011.[Medline]

  18. Kumaran RI, Muralikrishna B, Parnaik VK. Lamin A/C speckles mediate spatial organization of splicing factor compartments and RNA polymerase II transcription. J Cell Biol 2002;159:783–793.[Abstract/Free Full Text]

  19. Mounkes L, Kozlov S, Burke B et al. The laminopathies: nuclear structure meets disease. Curr Opin Genet Dev 2003;13:223–230.[CrossRef][Medline]

  20. Burke B, Stewart CL. Life at the edge: the nuclear envelope and human disease. Nat Rev Mol Cell Biol 2002;3:575–585.[CrossRef][Medline]

  21. Pollard KM, Chan EK, Grant BJ et al. In vitro posttranslational modification of lamin B cloned from a human T-cell line. Mol Cell Biol 1990;10:2164–2175.[Abstract/Free Full Text]

  22. Furukawa K, Hotta Y. cDNA cloning of a germ cell specific lamin B3 from mouse spermatocytes and analysis of its function by ectopic expression in somatic cells. EMBO J 1993;12:97–106[Medline]

  23. Biamonti G, Giacca M, Perini G et al. The gene for a novel human lamin maps at a highly transcribed locus of chromosome 19 which replicates at the onset of S-phase. Mol Cell Biol 1992;12:3499–3506.[Abstract/Free Full Text]

  24. Fisher DZ, Chaudhary N, Blobel G. cDNA sequencing of nuclear lamins A and C reveals primary and secondary structural homology to intermediate filament proteins. Proc Natl Acad Sci U S A 1986;83:6450–6454.[Abstract/Free Full Text]

  25. Furukawa K, Inagaki H, Hotta Y. Identification and cloning of an mRNA coding for a germ cell-specific A-type lamin in mice. Exp Cell Res 1994;212:426–430.[CrossRef][Medline]

  26. Machiels BM, Zorenc AH, Endert JM et al. An alternative splicing product of the lamin A/C gene lacks exon 10. J Biol Chem 1996;271:9249–9253.[Abstract/Free Full Text]

  27. Harborth J, Elbashir SM, Bechert K et al. Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Sci 2001;114:4557–4565.[Medline]

  28. Vergnes L, Peterfy M, Bergo MO et al. Lamin B1 is required for mouse development and nuclear integrity. Proc Natl Acad Sci U S A 2004;101:10428–10433.[Abstract/Free Full Text]

  29. Rober RA, Weber K, Osborn M. Differential timing of nuclear lamin A/C expression in the various organs of the mouse embryo and the young animal: a developmental study. Development 1989;105:365–378.[Abstract]

  30. Stewart C, Burke B. Teratocarcinoma stem cells and early mouse embryos contain only a single major lamin polypeptide closely resembling lamin B. Cell 1987;51:383–392.[CrossRef][Medline]

  31. Schatten G, Maul GG, Schatten H et al. Nuclear lamins and peripheral nuclear antigens during fertilization and embryogenesis in mice and sea urchins. Proc Natl Acad Sci U S A 1985;82:4727–4731.[Abstract/Free Full Text]

  32. Prather RS, Kubiak J, Maul GG et al. The expression of nuclear lamin A and C epitopes is regulated by the developmental stage of the cytoplasm in mouse oocytes or embryos. J Exp Zool 1991;257:110–114.[CrossRef][Medline]

  33. Prather RS, Sims MM, Maul GG et al. Nuclear lamin antigens are developmentally regulated during porcine and bovine embryogenesis. Biol Reprod 1989;41:123–132.[Abstract]

  34. Peter M, Nigg EA. Ectopic expression of an A-type lamin does not interfere with differentiation of lamin A-negative embryonal carcinoma cells. J Cell Sci 1991;100:589–598.[Abstract/Free Full Text]

  35. Lourim D, Lin JJ. Expression of nulcear lamin A and muscle-specific proteins in differentiating muscle cells in ovo and in vitro. J Cell Biol 1989;109:495–504.[Abstract/Free Full Text]

  36. Magnuson T, Epstein CJ, Silver LM et al. Pluripotent embryonic stem cell lines can be derived from tw5/tw5 blastocysts. Nature 1982;298:750–753.[CrossRef][Medline]

  37. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  38. Reubinoff BE, Pera MF, Fong CY et al. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000; 18:399–404.[CrossRef][Medline]

  39. Gropp M, Itsykson P, Singer O et al. Stable genetic modification of human embryonic stem cells by lentiviral vectors. Mol Ther 2003;7:281–287.[CrossRef][Medline]

  40. Cao B, Zheng B, Jankowski RJ et al. Muscle stem cells differentiate into haematopoietic lineages but retain myogenic potential. Nat Cell Biol 2003;5:640–646.[CrossRef][Medline]

  41. Brawley C, Matunis E. Regeneration of male germline stem cells by spermatogonial dedifferentiation in vivo. Science 2004;304:1331–1334.[Abstract/Free Full Text]

  42. Pesce M, Gross MK, Scholer HR. In line with our ancestors: Oct-4 and the mammalian germ. Bioessays 1998;20:722–732.[CrossRef][Medline]

  43. Andrews PW, Banting G, Damjanov I et al. Three monoclonal antibodies defining distinct differentiation antigens associated with different high molecular weight polypeptides on the surface of human embryonal carcinoma cells. Hybridoma 1984;3:347–361.[Medline]

  44. Kannagi R, Cochran NA, Ishigami F et al. Stage-specific embryonic antigens (SSEA-3 and -4) are epitopes of a unique globo-series ganglioside isolated from human teratocarcinoma cells. EMBO J 1983;2:2355–2361.[Medline]

  45. Lehner CF, Kurer V, Eppenberger HM et al. The nuclear lamin protein family in higher vertebrates: identification of quantitatively minor lamin proteins by monoclonal antibodies. J Biol Chem 1986;261:13293–13301.[Abstract/Free Full Text]

  46. Taniura H, Glass C, Gerace L. A chromatin binding site in the tail domain of nuclear lamins that interacts with core histones. J Cell Biol 1995;131:33–44.[Abstract/Free Full Text]

  47. Shoeman RL, Traub P. The in vitro DNA-binding properties of purified nuclear lamin proteins and vimentin. J Biol Chem 1990;265:9055–9061.[Abstract/Free Full Text]

  48. Vlcek S, Just H, Dechat T et al. Functional diversity of LAP2alpha and LAP2beta in postmitotic chromosome association is caused by an alpha-specific nuclear targeting domain. EMBO J 1999;18:6370–6384.[CrossRef][Medline]

  49. Dreuillet C, Tillit J, Kress M et al. In vivo and in vitro interaction between human transcription factor MOK2 and nuclear lamin A/C. Nucleic Acids Res 2002;30:4634–4642.[Abstract/Free Full Text]

  50. Lloyd DJ, Trembath RC, Shackleton S. A novel interaction between lamin A and SREBP1: implications for partial lipodystrophy and other laminopathies. Hum Mol Genet 2002;11:769–777.[Abstract/Free Full Text]

  51. Ozaki T, Saijo M, Murakami K et al. Complex formation between lamin A and the retinoblastoma gene product: identification of the domain on lamin A required for its interaction. Oncogene 1994;9:2649–2653.[Medline]

  52. Mancini MA, Shan B, Nickerson JA et al. The retinoblastoma gene product is a cell cycle-dependent, nuclear matrix-associated protein. Proc Natl Acad Sci U S A 1994;91:418–422.[Abstract/Free Full Text]

  53. Johnson BR, Nitta RT, Frock RL et al. A-type lamins regulate retinoblastoma protein function by promoting subnuclear localization and preventing proteasomal degradation. Proc Natl Acad Sci U S A 2004; 101:9677–9682.[Abstract/Free Full Text]

  54. Kirkland JL, Tchkonia T, Pirtskhalava T et al. Adipogenesis and aging: does aging make fat go MAD? Exp Gerontol 2002;37:757–767.[CrossRef][Medline]

  55. Kator K, Cristofalo V, Charpentier R et al. Dysdifferentiative nature of aging: passage number dependency of globin gene expression in normal human diploid cells grown in tissue culture. Gerontology 1985;31:355–361.[Medline]

  56. Cutler RG. Recent progress in testing the longevity determinant and dysdifferentiation hypothesis of aging. Arch Gerontol Geriatr 1991;12:75–98.[CrossRef][Medline]

Received July 15, 2004; accepted for publication June 14, 2005.



This article has been cited by other articles:


Home page
Circ. Res.Home page
K. N. Dahl, A. J.S. Ribeiro, and J. Lammerding
Nuclear Shape, Mechanics, and Mechanotransduction
Circ. Res., June 6, 2008; 102(11): 1307 - 1318.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
E. Meshorer and Y. Gruenbaum
Gone with the Wnt/Notch: stem cells in laminopathies, progeria, and aging
J. Cell Biol., April 3, 2008; 181(1): 9 - 13.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
T. Dechat, K. Pfleghaar, K. Sengupta, T. Shimi, D. K. Shumaker, L. Solimando, and R. D. Goldman
Nuclear lamins: major factors in the structural organization and function of the nucleus and chromatin
Genes & Dev., April 1, 2008; 22(7): 832 - 853.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. D. Pajerowski, K. N. Dahl, F. L. Zhong, P. J. Sammak, and D. E. Discher
From the Cover: Physical plasticity of the nucleus in stem cell differentiation
PNAS, October 2, 2007; 104(40): 15619 - 15624.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
R. Alberio, K. H Campbell, and A. D Johnson
Reprogramming somatic cells into stem cells.
Reproduction, November 1, 2006; 132(5): 709 - 720.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
M. S. Rao
One Successful Series Begets Another
Stem Cells, October 1, 2006; 24(10): 2160 - 2161.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow All Versions of this Article:
2004-0159v1
24/1/177    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Constantinescu, D.
Right arrow Articles by Csoka, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Constantinescu, D.
Right arrow Articles by Csoka, A. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS