| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TECHNOLOGY DEVELOPMENT |
a Division of Angiology and Haemostasis, University Hospital, Geneva, Switzerland;
b Unité d’Hémostase, Grenoble, France
Key Words. Lentiviral vector • Endothelial progenitor cell • Gene therapy
Correspondence: Egbert K. O. Kruithof, Ph.D., Division of Angiology and Haemostasis, University Hospital, CH-1211 Geneva, Switzerland. Telephone: 41-22-3729758; Fax: 41-22-3729299; e-mail: Egbert.Kruithof{at}hcuge.ch
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
promoter, and lowest with the phosphoglycerate kinase promoter. When blood mononuclear cells were cultured for 1 week in the absence of endothelial growth supplements, CMV promoter– driven expression of EGFP was two orders of magnitude lower than in similarly transduced EPCs. Our results show that lentiviral vectors are useful tools for the stable introduction of exogenous genes into EPCs and for their expression at desired levels using the appropriate gene promoter.
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
EPCs have been used to increase blood flow in experimental models of limb ischemia or ischemic heart disease [8], to seed vascular grafts [9], or to reendothelialize denuded carotid arteries [10]. Furthermore, EPCs migrate to ischemic regions of tumor tissue and incorporate in newly formed tumor blood vessels [11–13]. In patients with limb ischemia, transplantation of autologous bone marrow cells resulted in an improved tissue perfusion [14]. Intracoronary infusion of early-outgrowth EPCs in patients with ST-segment elevation myocardial infarction was safe and had favorable effects on left ventricular function [15]. In an experimental rat model of myocardial infarction, late-outgrowth EPCs, expanded from human CD34+ progenitor cells, also improved left ventricular ejection fraction [16].
By using gene transfer techniques, the therapeutic potential of EPCs might be enhanced. Thus, after transfer of the vascular endothelial growth factor gene into human EPCs, an increased neovascularization was obtained in an experimental model of limb ischemia in athymic mice [17]. Stable transfer of suicide genes into EPCs and implantation in vivo in tumor-bearing mice led to the long-term incorporation of these cells in newly formed tumor blood vessels. Injection of a prodrug and its conversion by the suicide gene product into a toxic metabolite resulted in a reduced rate of tumor growth [13, 18]. Blood-derived EPCs were transfected with a plasmid-encoding human factor VIII, and stable transfectants were isolated. Injection of these cells into nude mice resulted in sustained and therapeutic levels of factor VIII [19]. Lentivirus-mediated transduction of cord blood–derived EPCs has been applied as a more efficient approach of factor VIII gene delivery [20].
For therapeutic applications, it is imperative to express transgenes at desired and stable levels. The present study was designed to compare the potency of various gene promoters in early- and late-outgrowth EPCs derived from blood mononuclear cells. We observed that the level of stable transgene expression in lentivirus-transduced EPCs could be modulated over several orders of magnitude, with the cytomegalovirus (CMV) promoter exhibiting the highest activity.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Endothelial Progenitor Cells Mononuclear cells were isolated from human blood by centrifugation on Histopaque 1077 (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) and plated on 6- or 12-well culture dishes coated with type 1 collagen (BD Biosciences, San José, CA, http://www.bdbiosciences.com). The culture medium was composed of endothelial basal medium (EBM-2) (Cambrex, Verviers, Belgium, http://www.cambrex.com) supplemented with 2% decomplemented fetal calf serum and an endothelial growth supplement (EGM-2 SingleQuots, Cambrex), which is a mixture of human VEGF, epidermal growth factor, fibroblast growth factor-beta, insulin-like growth factor-1, hydrocortisone, ascorbic acid, and heparin [6]. Nonadherent cells were removed after 48 hours and every second day thereafter. The cells obtained after 1 week in culture are henceforth designated early-outgrowth EPCs, and the cells obtained after 4 weeks in culture are designated late-outgrowth EPCs. In some experiments, the cells were incubated in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% decomplemented fetal calf serum (Invitrogen, Basel, Switzerland, http://www.invitrogen.com) instead of EGM-2.
Human Umbilical Vein Endothelial Cells Human umbilical vein endothelial cells (HUVECs) were isolated and cultured as described previously [21, 22]. HeLa and 293T cells were grown in RPMI, 10% fetal calf serum and DMEM, 10% fetal calf serum, respectively. The blood and umbilical cord samples were obtained with written informed consent from the donors or mothers, with local hospital ethics committee approval.
Lentiviral Vector Production and Titer Determination
For lentiviral vector production, three plasmids were used: pC-MVR8.91 encodes HIV structural genes, pMD.G bears the VSV-G envelope cDNA, and pLoxGFP transfer vectors carry the enhanced green fluorescent protein (EGFP) gene under the control of the cytomegalovirus (CMV) promoter, the human elongation factor (EF1) promoter, or phosphoglycerate kinase (PGK) promoter (all plasmids were gifts from Dr. D. Trono, University Medical Center, Geneva, Switzerland, and have been described in detail elsewhere [23]). Lentiviral vectors were produced by cotransfection of 293T cells with the three plasmids using the calcium-phosphate precipitation method [24, 25]. Sixteen hours after transfection, the medium was changed. Conditioned medium was collected 48 hours later, centrifuged (900g, 5 minutes), passed through 0.45-µm sterile filters, concentrated 100 times by passage through an Amicon Ultra 100,000 MCO filter (Millipore, Billerica, MA, http://www.millipore.com), and stored at –80°C.
Vector titers were determined by flow cytometry analysis of EGFP expression in HeLa cells. Each vector was mixed with polybrene (8 µg/ml) and added to the cells. The cell-containing plates were centrifuged for 1 hour at 1,400g at 25°C, and the cells were further incubated with vector for 72 hours at 37°C in a CO2 incubator. GFP expression was analyzed by flow cytometry, and titers are expressed as transduction units per milliliter (TU/ml). The recombinant DNA work and production of lenti-viral vectors were done according to "Swiss federal guidelines for work with genetically modified organisms."
In Vitro Transduction of HUVECs and EPCs
HUVECs A total of 105 cells were seeded in 24-well plates coated with 0.1% gelatin. The next day, lentiviral vectors, mixed with polybrene (8 µg/ml), were added to the cells at different multiplicities of infection (MOI), centrifuged for 1 hour at 1,400g and 25°C, and incubated for 16 hours at 37°C in 500 µl medium. After incubation, cells were cultured in 1 ml fresh medium. At the specified time points, HUVECs were washed and fixed in 2.5% paraformaldehyde and 2% glucose in phosphate buffered saline (PBS) before flow cytometry analyses for EGFP expression on a FACScan instrument (Becton, Dickinson and Company, Mountain View, CA, http://www.bd.com).
EPCs Cells were transduced with lentiviral vectors at a MOI of 10 in the presence of polybrene (8 µg/ml). For early-outgrowth EPCs, this was done 2 days after isolation, and for late-outgrowth EPCs, this was done 4 weeks after isolation. After 1 hour of centrifugation at 1,400g at 25°C and 16 hours of culture at 37°C in a CO2 incubator, medium was changed and cells were further cultured for up to 5 days, with medium changes every 2 days. Cells were washed, fixed in 2.5% paraformaldehyde containing 2% glucose in PBS, and analyzed by flow cytometry for EGFP expression.
To determine whether EGFP expression was maintained over time, late-outgrowth EPC blood was transduced with lentiviral vectors encoding EGFP under control of the CMV promoter. Four days after transduction, EGFP-positive cells were isolated on a FACStar instrument (Becton, Dickinson and Company). Cells were further cultured for 4 weeks in EGM-2 medium and then analyzed for EGFP expression on a FACScan instrument.
Flow Cytometry Analysis and Immunofluorescence Staining
Antibodies Polyclonal rabbit anti-human von Willebrand factor (vWF) was from DakoCytomation (A0082; Glostrup, Denmark, http://www.dakocytomation.com). The following murine monoclonal antibodies were used: anti-CD31 (JC/70A) from DakoCytomation; anti–VE-cadherin (CD144; TEA1/31) from Beckman Coulter (Marseille, France, http://www.beckmancoulter.com); and anti-human CD45 (MEM-28) from Alexis Biochemicals (Lausen, Switzerland, http://www.alexis-corp.com). Isotype-matched control antibodies were from DakoCytomation. Goat anti-rabbit immunoglobulin G (IgG) conjugated with fluorescein isothiocyanate (FITC) and goat anti-mouse IgG conjugated with FITC, phycoerythrin, rhodamine, or Alexa 647 were from Sigma-Aldrich or Molecular Probes (Eugene, OR, http://probes.invitrogen.com).
Flow Cytometry Analysis Cells were washed in PBS, trypsinized, washed in PBS containing 5% fetal calf serum, and then incubated with primary antibodies (10 µg/ml in PBS-0.5% bovine serum albumin) for 1 hour, washed, and incubated with secondary antibodies for 30 minutes. All steps were performed at 4°C. Cells were washed, fixed in 2.5% paraformaldehyde and 2% glucose in PBS, and analyzed on a FACScan instrument (Becton, Dickinson and Company) using CellQuest software (Becton, Dickinson and Company). Isotype-matched murine antibodies were used as negative controls.
Indirect Immunofluorescence Staining Early- or late-outgrowth EPCs were grown on 0.1% type 1 collagen-coated glass coverslips and analyzed for the cellular location of vWF, as described previously [22]. Mounted cover-slips were examined with an inverted Zeiss-Axiovert 100 fluorescence microscope (Carl Zeiss, Jena, Germany, http://www.zeiss.com). Pictures were acquired with a Hamamatsu C4742-95-10 digital charge–coupled device camera (Hamamatsu Photonics, Osaka, Japan, http://www.hamamatsu.com) and analyzed using Openlab software (Scientific Software, Pleasanton, CA, http://www.scisw.com).
Cellular Uptake of Acetylated Low-Density Lipoprotein Early- and late-outgrowth EPCs were incubated in EGM-2 medium containing 10 µg/ml 1,1'-dioctadecyl-3,3,3',3'-tetra-methyl-indocarbocyanine perchlorate–labeled acetylated low-density lipoprotein (diI-Ac-LDL) (Molecular Probes, L3484) for 5 hours at 37°C. After washing with PBS, these cells were viewed and photographed as described above.
Quantitative Polymerase Chain Reaction Analysis of Chromosomal Transgene Incorporation Mononuclear cells obtained from human peripheral blood were grown in medium containing endothelial growth supplements (EGM-2) or in DMEM with 10% fetal bovine serum. At day 3, the cells were transduced with lentiviral vectors encoding EGFP under control of the CMV promoter and further incubated in EGM-2 or DMEM, 10% fetal calf serum. Five days after transduction, the adherent cells were washed with PBS, trypsinized, and then collected for total genomic DNA extraction. Quantitative polymerase chain reaction (PCR) was performed using 2, 0.2, and 0.02 ng genomic DNA of each sample and primers for a segment of gag that is close to the 5' end of the integrated transgene (forward: GGAGCTAGAACGATTCGCAGTTA; reverse: GGTTGTAGCTGTCCCAGTATTTGTC). The beta-actin gene served as a control gene (forward: TCACCCACACTGTGCCCATCTACGA; reverse: CAGCGGAACCGCTCATTGCCAATGG).
In Vivo Matrigel Assay A total of 5 x 105 early-outgrowth EPCs, transduced with lentiviral vectors for EGFP expression, were collected in 100 µL of PBS, mixed with 500 µl of Matrigel (BD Biosciences), and injected subcutaneously into the back of female nude mice. After 7 days, the Matrigel plugs were collected and snap frozen in OCT compound (Sakura, Torrance, CA, http://www.sakura-americas.com). Ten-micrometer sections were cut from the frozen plugs, mounted on microscope slides, and fixed in 4% paraformaldehyde. The slides were photographed using fluorescence microscopy as described above.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). All early-outgrowth EPCs were positive for CD31, as demonstrated by the complete shift of the symmetric peak obtained with the anti-CD31 antibodies compared with the isotype-matched control antibodies. The partial overlap of the symmetric CD31 and control peaks is comparable to that reported previously [5]. Compared with early-outgrowth EPCs, the level of CD31 expression by late-outgrowth EPCs was at least one order of magnitude higher.
|
promoter, or the PGK promoter. We observed that EGFP expression was highest when under the control of the CMV promoter, intermediate with the EF1 promoter, and lowest with the PGK promoter. These relative promoter potencies were observed at all MOIs and time points studied (Fig. 2).
|
Role of Transgene Promoter
We investigated lentiviral vector–mediated gene transfer in early- and late-outgrowth peripheral blood–derived EPCs and compared promoter efficacies. The cells were transduced with lentiviral vectors for expression of EGFP driven by the CMV, EF1, or PGK promoters. Based on the results obtained for transduction of HUVECs, a MOI of 10 was chosen and EGFP expression was evaluated 72 hours after transduction. For both early-outgrowth EPCs (Fig. 3A) and late-outgrowth EPCs (Fig. 3B), expression of EGFP was highest when driven by the CMV promoter, whereas expression from the EF1 or PGK promoter was one and two orders of magnitude lower, respectively.
|
). Two possible explanations can be put forward to explain the low EGFP expression by cells cultured without EGM-2: a low promoter efficacy or a resistance to transduction. To discriminate between these two possibilities, we analyzed the amount of transgene DNA incorporated into the chromosomes of blood mononuclear cells grown with or without EGM-2. Quantitative real-time PCR was used to quantify DNA corresponding to a gag fragment situated at the 5' end of the transgene, whereas actin DNA was used as control. We observed 129 incorporated transgene copies in cells grown with EGM-2 and 74 copies in cells grown without EGM-2. The 1.7-fold higher incorporation in the cells grown with EGM-2 does not explain the 100-fold higher level of EGFP expression.
Stability of EGFP Expression in Late-Outgrowth EPCs
To determine to what extent EGFP expression was stable, we transduced late-outgrowth EPCs with a lentiviral vector for expression of EGFP under control of the CMV promoter. EGFP-positive cells were isolated by flow cytometry cell sorting, and EGFP expression was analyzed 4 weeks later. At this time point, greater than 90% of the cells were still positive (Fig. 4).
|
, left). The level of CD45 in these cells was comparable to that in cells cultured in the absence of EGM-2, which expressed 10-fold lower levels of EGFP (Fig. 5, right).
|
, or PGK promoter. The transduced cells were injected subcutaneously in a Matrigel plug in the back of female nude mice. One week later, the plugs were recovered and EGFP-related fluorescence was analyzed on 10-µm tissue slices. Highest levels of EGFP expression were observed when under control of the CMV promoter, intermediate levels were observed with EF1 promoter, and low levels were observed with the PGK promoter (Fig. 6).
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We investigated the potential of lentiviral vectors for stable gene transfer in early- and late-outgrowth EPCs. In recent years, lentivirus-mediated gene transfer was shown to be an efficient method to stably introduce genetic modifications in target cells, even if these are in a nonproliferative state [27, 28]. Here we show that lentivirus-mediated gene transfer allows efficient and stable transgene expression in peripheral blood–derived EPCs and that transgene expression levels can be varied over two orders of magnitude by using different well-characterized gene promoters. These differences in promoter efficacies were observed both for early- and late-outgrowth EPCs. Highest expression of EGFP was observed with the CMV promoter, intermediate expression was observed with the EF1 promoter, whereas expression observed with the PGK promoter was very weak. The clear shift in the symmetric fluorescence intensity peak of PGK-EGFP–transduced cells, compared with nontransduced cells, implies that all cells had been transduced and that the weak EGFP expression was due to an intrinsic low activity of the PGK promoter in these cells. The ability to adjust transgene expression to desired levels is important because, depending on the protein to be expressed, optimal therapeutic effects may not coincide with the highest level of transgene expression.
To determine to what extent the endothelial growth supplement EGM-2 favored the outgrowth of cells characterized by a high EGFP expression from the CMV promoter, we also cultured blood mononuclear cells on type 1 collagen in medium without EGM-2 and transduced these cells with a lentiviral vector for EGFP expression under the control of the CMV promoter. The adherent cells that were retained by this procedure only expressed low EGFP levels. The low expression could not be explained by a resistance of these cells to transduction because levels of DNA incorporation were 1.7-fold lower whereas the level of EFGP expression was one hundred-fold lower. The use of the CMV promoter, which is also the strongest promoter of the three tested, is therefore attractive in situations where a high level of transgene expression is to be obtained selectively in EPCs and not in the small number of leukocytes that may contaminate the EPCs isolated from blood mononuclear cells. The weak activity of the CMV promoter in mononuclear cells cultured on type 1 collagen in the absence of endothelial growth supplements extends the results of Salmon et al. [23], who observed that the CMV promoter has low activity in CD34+ hematopoietic progenitor cells and some derived hematopoietic lineages. In the latter study, the low activity from the CMV promoter could not be explained by a low frequency of cell transduction.
The use of the promoters described here is appropriate for conditions where EPCs are isolated from peripheral blood or bone marrow, transduced ex vivo, and then reintroduced into ischemic tissues or used to seed vascular grafts. In contrast, because the CMV promoter is active in many nonleukocyte cell types, endothelial cell–specific promoters, such as the tie2 promoter enhancer [29], seem to be more appropriate when the endothelium is to be modified by direct injection of lentiviral vectors into the vascular system.
In our report, we investigated two different EPCs, early outgrowth and late outgrowth. These two types of EPCs express similar endothelial marker proteins but most likely represent two distinct cell types of different origins [3]. Early-outgrowth EPCs may be derived both from CD14-positive and CD14-negative peripheral blood mononuclear cells, whereas late-outgrowth EPCs are derived from CD14-negative precursors [30, 31]. The early-outgrowth cells have also been referred to as circulating angiogenic cells [3, 4] or circulating progenitors cells [15]. Both early- and late-outgrowth EPCs express several endothelial markers, such as CD31 (albeit at markedly different levels), VE-cadherin, KDR, and vWF; acetylated LDL uptake and binding of the Ulex europaeus lectin are also characteristics of both cell types [4, 31]. Furthermore, in both cell types, the CMV promoter is the most active promoter. In contrast, early-outgrowth EPCs also express leukocyte markers such as CD14 and CD45 and are negative for the EC marker CD34, whereas late-outgrowth EPCs express CD34 and are negative for CD14 and CD45 [4, 26, 30, 31]. In addition, late-outgrowth EPCs exhibit a cobblestone morphology, which is typical for endothelial cells in culture, whereas early-outgrowth EPCs exhibit a rounded or spindle-shaped morphology and are much smaller than late-outgrowth EPCs (this study and [32]). A recent study observed that culturing blood mononuclear cells in the presence of EGM-2 increases the number of CFU-ECs in vitro and their ability to stimulate new blood vessel formation in vivo [31]. We observed that culturing blood mononuclear cells for 1 week in the presence of EGM-2 made the cells responsive to the CMV promoter but did not lead to the loss of CD45. From these results we may conclude that treatment of blood mononuclear cells with endothelial growth supplements favors a differentiation (and possibly selective outgrowth) of progenitors toward an angiogenic phenotype.
For autologous treatment, early-outgrowth EPCs are very interesting because relatively large amounts of these cells can be obtained after a short period of in vitro cell culture. By introducing stable genetic modifications in these cells, their therapeutic potential may be further increased. In contrast, the therapeutic potential of late-outgrowth EPCs seems to be limited at present. First, it takes at least 1 month to obtain limited amounts of late-outgrowth EPCs, which may be too long to be clinically relevant. Second, the amount of circulating precursors of late-outgrowth EPCs, as well as their proliferative capacity, seems to be low in adults in whom therapy with EPCs is most likely to be used [7].
In conclusion, lentiviral vector–mediated gene transfer is an appropriate technology for overexpression of transgenes in early- or late-outgrowth EPCs or mature ECs. Our results suggest that transgene expression levels can be titered by using different promoters.
|
ACKNOWLEDGMENTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
DISCLOSURES
The authors indicate no potential conflicts of interest.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. C. Partlow, J. Chen, J. A. Brant, A. M. Neubauer, T. E. Meyerrose, M. H. Creer, J. A. Nolta, S. D. Caruthers, G. M. Lanza, and S. A. Wickline 19F magnetic resonance imaging for stem/progenitor cell tracking with multiple unique perfluorocarbon nanobeacons FASEB J, June 1, 2007; 21(8): 1647 - 1654. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
