First published online June 8, 2006
Stem Cells
Vol. 24 No.
10
October 2006, pp.
2232
-2243
doi:10.1634/stemcells.2005-0612; www.StemCells.com
© 2006 AlphaMed Press
TISSUE-SPECIFIC STEM CELLS |
Enhanced Engraftment of Mesenchymal Stem Cells in a Cutaneous Wound Model by Culture in Allogenic Species-Specific Serum and Administration in Fibrin Constructs
Carl A. Gregorya,
Emigdio Reyesa,
Mandolin J. Whitneya,
Jeffrey L. Speesb
aCenter for Gene Therapy, Tulane University Health Sciences Center, New Orleans, Louisiana, USA;
bDepartment of Medicine, Cardiovascular Research Institute, University of Vermont, Colchester, Vermont, USA
Key Words. Adult bone marrow stem cells • Stem cell culture • Mesenchymal stem cells • Immune system • Experimental models • Ex vivo expansion • Engraftment
Correspondence: Carl A. Gregory, Ph.D., Center for Gene Therapy, Tulane University Health Sciences Center, 1430 Tulane Avenue, New Orleans, Louisiana 70112, USA. Telephone: 504-988-7176; Fax: 504-988-7710; e-mail: cgregory{at}tulane.edu
Received on December 5, 2005;
accepted for publication on May 30, 2006.
First published online in STEM CELLS EXPRESS June 8, 2006.
 |
ABSTRACT
|
|---|
Human mesenchymal stem cells (hMSCs), also referred to as multipotent stromal cells, are currently being applied in clinical trials for bone diseases, graft versus host disease, and myocardial infarction. However, the standard growth medium for hMSCs contains 10%20% fetal calf serum (FCS), and FCS is strongly immunogenic in both rodents and humans. Previously, we reported that by a sensitive fluorescence-based assay, 730 mg of internalized FCS is associated with 108 hMSCs, a dosage that will probably be needed for most therapies. We also found that a brief culture in medium containing autologous 20% adult human serum (AHS) or autologous 10% AHS supplemented with growth factors (AHS+) reduced the contamination by more than 99.9%. We have now extensively characterized the culture conditions and shown that hMSC expansion is possible using heterologous 20% AHS or heterologous 10% AHS+. The uptake of FCS is an active process that acts to concentrate contamination in the cells even under low serum conditions (2% FCS) but can be actively displaced by incubation of the cells in medium with AHS. Rat MSCs (rMSCs) can be expanded under similar conditions using supplemented heterologous adult rat serum (ARS+). After expansion in FCS, a further 8 days of culture with ARS+ significantly improves the viability of the rMSCs in vivo after encapsulation in fibrin followed by subcutaneous implantation in rats. Our results have the potential to dramatically improve cellular and genetic therapies using hMSCs.
 |
INTRODUCTION
|
|---|
Human bone marrow-derived mesenchymal stem cells (hMSCs) are currently being applied in clinical trials for bone diseases [13], graft versus host disease [4, 5], myocardial infarction [6], and neurodegenerative disorders [7]. MSCs are nonhematopoietic adult progenitor cells that retain their multipotentiality after extensive ex vivo culture, making this source of stem cells attractive candidates for cytotherapy and gene delivery [816]. The standard condition for MSC expansion is
-minimal essential medium (MEM) with 10%20% fetal calf serum (FCS), and to date, all U.S. Food and Drug Administration (FDA)-approved clinical trials have employed hMSCs expanded in FCS under FDA-approved protocols [1, 15, 17]. The use of FCS to expand MSCs for clinical use is also acceptable in Europe [18, 19]. Although hMSCs themselves are not highly immunogenic [2023], when expanded in FCS they are likely to generate immune responses in some patients on first administration. More patients are predicted to respond adversely if repeated administrations are required; anaphylactic reactions have been noted in several patients who received repeated administrations of dendritic cells or lymphocytes cultured in FCS [2426]. Furthermore, in one clinical trial for the treatment of osteogenesis imperfecta, a patient was identified with antibodies against bovine serum proteins after treatment with hMSCs grown in medium containing FCS; this patient did not exhibit successful cellular engraftment [2].
Previously, we reported that by fluorescence-based assay, 730 mg of internalized FCS is associated with 108 hMSCs, a dosage that will probably be needed for therapy [27]. We also found that a brief culture with 20% adult human serum (AHS) or 10% AHS with growth factors (AHS+) reduced the contamination by more than 99.9% [27]. Subsequently, the utility of human serum in MSC expansion has been confirmed by other investigators [2830], and the potential of plasma has also been demonstrated [31, 32].
In this study, we have now extensively characterized species-specific culture conditions for hMSCs and rat MSCs (rMSCs). We show that hMSC and rMSC expansion is possible using heterologous species-specific serum for periods sufficient to significantly deplete FCS contamination. The resulting MSCs are phenotypically similar to those grown in standard conditions with FCS. We also demonstrate that uptake of FCS by MSCs is an active process that leads to an intracellular accumulation of bovine antigens even when significantly lower concentrations of FCS are used in the expansion medium (2% FCS). Finally, we describe a rat-based assay of subcutaneous MSC engraftment involving the pre-encapsulation of the cells in a fibrin matrix. With this assay, we show that MSCs exhibit enhanced long-term viability when cultured to remove bovine contaminants. The culture conditions reported in this study provide a means to propagate MSCs and efficiently sustain their survival in immunocompetent models of adult stem cell engraftment. The method has the potential to significantly improve human cellular and genetic therapies using hMSCs.
 |
MATERIALS AND METHODS
|
|---|
Serum Preparation
Preparation of human serum was carried out as described previously [27]. Five-hundred milliliters of whole blood was taken from consenting donors who had previously donated bone marrow for preparation of hMSCs. The blood was recovered into 600-ml blood bags (Baxter Fenwal, Deerfield, IL, http://www.baxter.com) in the absence of anticoagulants and allowed to clot for 4 hours at room temperature. The serum (100150 ml) was aspirated from the clot and centrifuged at 500g for 20 minutes. The supernatant was then centrifuged for a further 20 minutes at 2,000g. The cleared serum was incubated at 56°C for 20 minutes to deactivate complement followed by storage at 80°C. Rat serum was prepared as follows: Sprague-Dawley rats were acquired from Charles River Laboratories, Inc. (Wilmington, MA, http://www.criver.com) and allowed to grow to 150250 g. Under anesthesia, the rats were exsanguinated by cardiac puncture with a 10-ml syringe. The blood was allowed to clot for approximately 1 hour and then was centrifuged at 3,000g for 30 minutes. The serum was recovered (approximately 0.5 of the total volume of the draw) and then subjected to further centrifugation for 20 minutes at 3,500g. The cleared serum was incubated at 56°C for 20 minutes to deactivate complement followed by storage at 80°C. Medium containing either the human or the rat serum was filtered through a 0.22-µm membrane before use. It is critical that human or rat serum be prepared and frozen within 6 hours of recovery in the absence of additives.
Fluorescent Serum Preparation
Fluorescein-conjugated fluorescent FCS (fFCS) and AHS (fAHS) were prepared as described previously [27]. Briefly, the FCS was diafiltered into sodium bicarbonate buffer at pH 9.0, labeled with fluorescein isothiocyanate (FITC), and extensively diafiltered into phosphate-buffered saline (PBS) to remove unreacted FITC. The labeled FCS was then adjusted back to the original protein concentration.
Tissue Culture
hMSCs were prepared and grown as described previously by the Tulane Health Sciences Center stem cell distribution facility [13, 33]. To safeguard against the inclusion of poor MSC preparations that occasionally occur [34] in the stem cell archive, the cells are prequalified for proliferative and trilineage differentiation potential using parameters designed for clinical grade MSC preparation. rMSCs from Sprague-Dawley rats (Charles River Laboratories, Inc.) and from Sprague-Dawley enhanced green fluorescent protein (eGFP) transgenic rats (kindly provided by M. Okabe, Genome Information Research Center, Osaka University, Japan) were prepared as described previously [35]. hMSCs and rMSCs were initially expanded in a complete culture medium (CCM) consisting of
-MEM (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) with 20% FCS (lot selected for rapid growth of MSCs; Atlanta Biologicals, Norcross, GA), 100 U/ml penicillin, 100 µg/ml streptomycin, and 1 mM L-glutamine (Invitrogen). The hMSCs and rMSCs were expanded in FCS-containing medium until passage 2 or 3, respectively, then frozen down until required. For assays of cell proliferation, cells were quantified by fluorescent labeling of nucleic acids (CyQuant dye; Invitrogen). hMSCs were plated at 100 cells per cm2 into 10-cm2 wells (Corning Life Sciences, Acton, MA, http://www.corning.com/lifesciences) and allowed to grow for 4 days. The cells were washed with PBS, and medium was added that contained the indicated concentration of serum and growth factors. The cells were recovered by trypsinization, washed in PBS, and added to the fluorescent labeling mix. Fluorescence measurements were carried out using a microplate fluorescence reader (FLX800; BioTek Instruments, Inc., Winooski, VT, http://www.biotek.com) set to 480 nm excitation and 520 nm emission. Data were statistically analyzed using Student's t test (two-tailed). Experiments were repeated using hMSCs from at least two donors. Uptake experiments with fFCS and fAHS were done as described previously [27]. For fAHS uptake experiments, cells grown in 20% FCS were incubated in medium containing 10% heterologous FITC-labeled human serum supplemented with 10 ng ml1 epidermal growth factor (EGF) and 10 ng ml1 basic fibroblast growth factor (bFGF) for 4 days prior to two PBS washes and digital imaging. For FCS uptake experiments, cells were seeded into 10-cm2 plates (Corning Life Sciences) at 100 cells per cm2 and allowed to grow in complete medium containing 20% FCS for 4 days before replacement with medium containing the indicated concentration of fFCS for 2 days. After two PBS washes, in addition to quantification of fFCS as above (FLX800; BioTek Instruments, Inc.), the cells were visualized by phase-contrast and epifluorescence microscopy (Nikon Eclipse TE200; Nikon, Tokyo, http://www.nikon.com) and documented by digital imaging.
Osteogenic Differentiation and Quantification of Alizarin Red S Staining
For standard osteogenic differentiation, confluent monolayers of hMSCs were incubated in medium supplemented with 108 M dexamethasone (Decadron; Merck & Co., Inc., Whitehouse Station, NJ, http://www.merck.com), 50 µg ml1 ascorbic acid, and 5 mM ß-glycerol phosphate (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) for 40 days with changes of medium every 5 days. Quantification of staining was carried out using a previously described dye extraction procedure [36].
Adipogenic Differentiation and Quantification of Oil Red O Staining
All reagents were purchased from Sigma-Aldrich. Confluent monolayers of hMSCs in six-well plates (10 cm2 per well) were incubated in medium supplemented with 108 M dexamethasone, 5 x 108 M isobutylmethylxanthine, and 5 x 107 M indomethacin. After 30 days, the adipogenic cultures are fixed in 10% formalin for 15 minutes and stained with fresh oil red O solution in 60% (vol/vol) isopropanol in PBS for 20 minutes. Quantification of staining was carried out using a previously described procedure [37].
Fibrin Constructs
Blood was recovered from adult Sprague-Dawley rats as described above. The blood was drawn into a 10-ml syringe containing 1.5 ml 200 mM sodium citrate (pH 7.4) (Sigma-Aldrich). The resultant plasma was recovered from the blood by centrifugation at 3,000g for 30 minutes (approximately 0.8 of the total volume of the draw), and then the supernatant was subjected to further centrifugation for 20 minutes at 3,500g. rMSCs were pre-expanded in CCM and then cultured for a further 2 days in the appropriate experimental medium preparation: CCM, osteogenic medium, or adipogenic medium. Cells were recovered by trypsinization, washed in PBS, and then added to the appropriate volume of rat plasma. The plasma/cell suspension was then aliquoted into wells of a 12-well (1 ml) or 24-well (0.5 ml) tissue culture plate (Corning Life Sciences). To initiate clotting, an equal volume of thromboplastin was added (Plastinex; Corning Life Sciences) followed by 0.1 volumes of a 1 M solution of tissue culture grade CaCl2. Clotting was allowed to proceed for 24 hours, and then the appropriate experimental medium preparation was added to cover the solid construct. The constructs were cultured in CCM for a further 8 days with a change of medium every 2 days. For assays of cell proliferation within the construct, total DNA was quantified by fluorescent labeling of nucleic acids (CyQuant dye; Invitrogen) as described above. DNA recovery was normalized to cell number, and baseline values were acquired from unseeded constructs.
Implantation of Constructs Created Under Different Cell Expansion Conditions
Adult age-matched male Sprague-Dawley rats were separated into three groups of six animals. Before implantation of the constructs, three animals of each group had 0.5 ml of blood drawn from the tail vein under anesthesia. Serum was recovered from the blood as described [27]. Implants containing 300,000 GFP-labeled MSCs pre-expanded in 20% FCS, 20% ARS, or ARS+ were cultured in 24-well plates for 7 days at 37°C in humidified air containing 5% CO2. Under anesthesia, the fibrin constructs were implanted subcutaneously between the scapulae. Briefly, the coat was shaved and the skin was sterilized by application of ethanol and iodine. A 1520-mm incision was made longitudinally between the scapulae, and a small cavity was made between the dermis of the skin and the fascia below to accommodate the constructs, which were 1020 mm in diameter. The incision was closed by two or three sutures and then sealed (Vetbond; 3M, St. Paul, MN, http://www.3m.com). After 5 days, the sutures were removed. After 10 days, the procedure was repeated using constructs that contained 106 cells at the same implantation site. Fourteen days thereafter, the animals were placed under anesthesia and euthanized by cardiac exsanguination, and serum was prepared from the blood. The implants with adjacent skin were removed for histology or genomic DNA (gDNA) extraction.
Immunohistochemistry
Surviving GFP-expressing MSCs were identified by fluorescent antibody labeling. Epifluorescent, DIC (differential interference contrast), and deconvolution microscopy was done using a Leica DM6000B microscope equipped with an automated x, y, z stage and a CCD (charge-coupled device) camera (Leica DFC350 FX; Leica Camera AG, Solms, Germany, http://www.leica.com). Images taken at 0.5-µm intervals were deconvoluted using commercial software (Leica FW4000 and Leica Deblur). Detailed immunohistochemistry methods are available online as supplemental information.
Polymerase Chain Reaction-Based GFP Assay
DNA was extracted from the recovered implants with a cell lysis buffer and phenol/chloroform/isoamyl alcohol as described [38]. The number of GFP-expressing cells within the implant was estimated using a modification of a previously described protocol [39]. Briefly, the GFP-encoding and 28S ribosome-encoding gDNA was amplified from the gDNA and was digoxygenin (DIG)-labeled simultaneously. Each reaction consisted of 44 µl of polymerase chain reaction (PCR) master mix (Invitrogen), 3 µl of PCR DIG labeling mix (Roche Diagnostics, Indianapolis, http://www.roche.com), and 2 µl (100 pmol of each) of the 28S ribosomal RNA amplimers described by Naito et al. [40] or 2 µl (100 pmol of each) of the eGFP amplimers (forward: GCTGACCCTGAAGTTCATCTGCA and reverse: TCTTCTGCTTGTCGGCCATGATA). Reactions were cycled to the following parameters: initial denature step at 95°C for 5 minutes for one cycle then denature 95°C for 30 seconds, anneal 54°C (for ribosome control) or 56°C (for eGFP) for 30 seconds, and extension at 72°C for 30 seconds for 30 cycles, followed by a final extension at 72°C for 5 minutes. The resultant fragments are approximately 300 and 480 bp for the ribosomal fragment and eGFP fragment, respectively. The apparent mass of the fragments can vary by up to 10% depending on the extent of labeling when analyzed by acrylamide or agarose gel electrophoresis. PCR enzyme-linked immunosorbent assay (ELISA) assays on 5 µl of the PCRs were carried out in accordance with Gregory et al. [36]. Both wild-type rat gDNA spiked with the eGFP-encoding plasmid pEGFPC1 (Clontech Co., Mountain View, CA, http://www.clontech.com) used to generate the transgenic rats [41, 42] and gDNA from the transgenic rats themselves were used as standards.
ELISA for Anti-FCS Immunoglobulin G
The assays were performed as previously described [27]. Immunoglobin standards for the assays were purified from the serum samples derived from the experimental animals using a modification of an affinity protocol previously described [43].
 |
RESULTS
|
|---|
hMSCs Can Be Expanded in Heterologous Human Serum with or Without Growth Factor Supplementation
Although 10% FCS is used widely for MSC propagation, we have found that 20% FCS is the optimal concentration for the expansion and maintenance of MSCs, especially at very low densities. For this reason, we have used 20% fetal bovine serum (FBS) as the positive control for all of our assays [13, 33]. To reduce the occurrence of donor-dependent variation, the MSCs (a total of four donors were used in the assays) were chosen at random from an archive containing MSCs that grew well in 20% FCS and exhibited trilineage differentiation into osteoblasts, adipocytes, and chondrocytes. We assumed also that two MSC lines standardized in this manner were sufficient to test the potential of allogenic human serum for the propagation of MSCs for each of the conditions tested. We compared the growth kinetics of hMSCs (n = 2) that were cultured in medium containing 20% FCS, 20% autologous serum, or 20% heterologous serum from one of three different donors (Fig. 1A, 1C).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 1. Proliferation of human MSCs in various media preparations. (A): Proliferation of cultures of MSCs derived from two donors (donor A [left] and donor D [right]) in FCS, or serum from four donors (A to D). (B): Proliferation of cultures of MSCs derived from two donors (donor E [left] and donor F [right]) in FCS, FCS+, or AHS+ prepared with serum from four donors (D+ to F+). (C): Final cell recoveries for growth curves in (A). (D): Final cell recoveries for growth curves in (B). Error bars represent SD from six measurements. The values on the y-axis represent the number of recovered cells per tissue culture growth area. Abbreviations: AHS, adult human serum; FCS, fetal calf serum; MSC, mesenchymal stem cell.
|
|
Cells were recovered from frozen stocks by culture for a brief period in CCM containing FCS. The cells were then transferred to six-well plates at an initial plating density of 100 cells per cm2 and allowed to adhere in the presence of CCM containing FCS for 4 days. The cultures were then transferred to the various media, and the proliferation was measured. MSC growth in 20% autologous or heterologous human serum was not significantly different from cell growth in 20% FCS. Furthermore, in the absence of growth factors, serum from one donor (donor C) demonstrated significantly increased cell growth compared with the other sera tested, including FCS (Fig. 1A, 1C). We then compared the growth kinetics of hMSCs (n = 2) grown in 20% FCS, 10% FCS supplemented with 10 ng ml1 EGF and 10 ng ml1 bFGF (FCS+), 10% autologous serum supplemented with 10 ng ml1 EGF and 10 ng ml1 bFGF, or 10% heterologous serum supplemented with 10 ng ml1 EGF and 10 ng ml1 bFGF (D+, E+ and F+ in Fig. 1B, 1D). For both donors examined, MSCs cultured in supplemented autologous or heterologous serum demonstrated significantly increased growth relative to MSC growth in 20% FCS (Fig. 1B, 1D). MSCs grown in FCS+ (10% FCS with growth factor supplements) demonstrated a significant increase in growth compared with cells from the same donor grown in 20% FCS (Fig. 1B, 1D), indicating that the addition of the growth factors was responsible for the observed growth increase. Preliminary data from our laboratory also demonstrated that hMSC lines can be derived from bone marrow aspirates solely expanded in heterologous AHS+. It should be noted, however, that due to limitations in serum, the cells were taken only to passage 2.
Growth of rMSCs Is Inhibited in Heterologous Serum Unless It Is Supplemented with Growth Factors
We also examined the growth kinetics of rMSCs (n = 2) cultured in 20% FCS, 20% heterologous rat serum, 10% FCS, or 10% heterologous rat serum that was supplemented with 10 ng ml1 EGF and with the lower concentration of 1 ng ml1 bFGF (ARS+) (Fig. 2A, 2B). Unlike hMSCs, rMSCs do not grow well in 10% species-specific serum supplemented with 10 ng ml1 EGF and 10 ng ml1 bFGF but do grow well in 10% species-specific serum supplemented with 10 ng ml1 EGF and 1 ng ml1 bFGF (ARS+) (data not shown). In contrast to the response of hMSCs cultured in 20% heterologous human serum, for both rMSC donors, cell growth in 20% FCS was significantly greater than cell growth in medium containing 20% heterologous rat serum (Fig. 2A, 2B). Cell growth was also significantly increased when rMSCs were cultured in ARS+ as compared with growth in 20% heterologous serum or 20% FCS (Fig. 2A, 2B).

View larger version (26K):
[in this window]
[in a new window]
|
Figure 2. Proliferation of rat MSCs in various media preparations. (A): Proliferation of cultures of MSCs derived from two rat donors (donor A [left] and donor B [right]) in FCS, FCS+, or ARS+ prepared with serum from 10 rat donors. (B): Final cell recoveries for growth curves in (A). Open bars represent rat donor, and gray shading represents rat donor B. Error bars represent SD (n = 6). The values on the y-axis represent the number of recovered cells per tissue culture growth area. Abbreviations: ARS, adult rat serum; FCS, fetal calf serum; MSC, mesenchymal stem cell.
|
|
Culture of hMSCs in Medium Containing Heterologous Human Serum Removes FCS Contamination
In a previous study [27], we demonstrated that medium containing 20% autologous human serum or 10% autologous human serum supplemented with EGF and bFGF could be used to remove FCS contamination from hMSCs that were previously cultured in 20% FCS. To examine the potential for heterologous human serum to remove FCS contamination from hMSCs, we incubated hMSCs in medium containing FITC-labeled 20% FCS (fFCS) for 2 days, washed the cells in PBS, and then cultured the cells for 6 days in serum-free medium (
-MEM, Dulbecco's modified essential medium), 20% FCS, FCS+, 20% heterologous AHS, or 10% heterologous adult human serum supplemented with 10 ng ml1 EGF and 10 ng ml1 bFGF (AHS+) (n = 2). Assaying fFCS contamination every 2 days, we observed that a significant amount of fFCS contamination was removed in 2 days, and further reduction occurred by 6 days (Fig. 3A, 3B). Incubation in either 20% heterologous AHS or heterologous AHS+ resulted in removal of fFCS contamination that was not significantly different from reduction in medium containing unlabeled 20% FCS or FCS+ (Fig. 3A, 3B). Similar to incubation in autologous human serum, growth of hMSCs in heterologous human serum for 6 days resulted in removal of 99.99% of FCS contamination (from more than 120 pg per cell to less than 0.5 pg per cell) (Fig. 3A, 3B).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3. Time course of fFCS depletion in cultures of donor A human mesenchymal stem cells pre-expanded in fFCS and then transferred to various autologous and heterologous media preparations. (A): Six-day time course (left) and rescaled (right) plot of the last 4 days of the time course. (B): Final fFCS contamination level after 6 days of culture. Error bars represent SD (n = 6). The values on the y-axis represent the amount of detected fFCS per recovered cell. Abbreviations: AHS, adult human serum; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; fFCS, fluorescein-conjugated fluorescent fetal calf serum; MEM, minimum essential medium.
|
|
Uptake of FCS Contamination Is an Active Process
Given that several recent reports have described the growth of MSCs and related cells from bone marrow in medium containing as low as 2% FCS and that 10% FCS is currently the preferred concentration for MSC generation in some clinical trials, we examined whether these culture methods would reduce the levels of FCS contamination to levels that would not generate an immune response (Fig. 4A). MSCs from two human donors were incubated in medium containing 20%, 10%, 5%, or 2% fFCS for 2 days. The cells were then washed with PBS and assayed for fFCS levels using a quantitative fluorescence-based assay [27]. By epifluorescence microscopy, we observed a punctuate pattern of fFCS within the hMSCs, even when cultured in 2% fFCS (Fig. 4A, inset). The uptake of fFCS appeared active given that the decrease in the levels that we measured did not reflect the relative decrease in the percent of fFCS that we included in the culture conditions (Fig. 4A). Incubation of hMSCs in medium containing 2% fFCS for 2 days resulted in the uptake of 2030 pg of FITC-FCS contamination per cell; the injection of 1 x 106 cells in vivo would carry an immunologic dose of 2030 µg, and even 105 cells would carry 2 µg of contaminant, a level that is potentially immunogenic.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 4. Uptake of fFCS and fAHS+ by hMSCs occurs at a range of serum concentrations by an apparently active mechanism. (A): hMSCs were incubated for 2 days in medium containing a range of fFCS concentrations. The cells were then subjected to assays of fFCS uptake. Contamination is disproportionately high even at low levels of serum exposure (inset: fluorescence microscopy of hMSC exposed to 2% [vol/vol] fFCS). Error bars represent SD (n = 6). The values on the y-axis represent the amount of detected fFCS per recovered cell. (B): Epifluorescence microscopy confirms that fAHS+ is also taken up by hMSCs. Abbreviations: EGF, epidermal growth factor; fAHS, fluorescein-conjugated fluorescent adult human serum; fFCS, fluorescein-conjugated fluorescent fetal calf serum; FGF, fibroblast growth factor; hMSC, human mesenchymal stem cell.
|
|
To determine whether human serum was taken up from the culture medium in a manner similar to that of FCS, we FITC-labeled adult human serum (fAHS) and cultured hMSCs for 4 days in medium containing 10% heterologous fAHS supplemented with 10 ng ml1 EGF and 10 ng ml1 bFGF. In both low- (50 cells per cm2) or high-density (5,000 cells per cm2) culture conditions (Fig. 4B), hMSCs exhibited a punctuate pattern of fAHS identical to that of fFCS that we observed in previous experiments (Fig. 3B, inset). Furthermore, although we did not assay fAHS levels quantitatively, high-density cultures demonstrated additional staining with fAHS, perhaps due to nonspecific binding of extracellular matrix (Fig. 4B).
Differentiation Potential of hMSCs Grown in Human Serum
To determine whether growth in human serum could alter the differentiation capacity of hMSCs as compared with growth in FCS, we performed quantitative assays of bone formation (mineralization) and fat formation (lipid production) during periods of 40 and 30 days, respectively. As assayed by Alizarin Red S staining, there was no significant difference in mineral (Ca2+) deposition between hMSCs grown in 20% AHS versus 20% FCS (Fig. 5A). The addition of 10 ng ml1 EGF and 10 ng ml1 bFGF to culture medium, although stimulating cell growth, resulted in a significant decrease in hMSC mineral production after 20 days for cells grown in either AHS+ or FCS+ (Fig. 5A).

View larger version (50K):
[in this window]
[in a new window]
|
Figure 5. Semiquantitative assays of osteogenic and adipogenic differentiation by hMSCs grown in various media preparations. (A): Time course of osteogenic differentiation by hMSCs pre-expanded in FCS, ARS, ARS+, or FCS+ and then transferred to osteogenic medium with FCS for up to 40 days. Error bars represent SD (n = 6). The values on the y-axis represent the amount of detected Alizarin S stain recovered per 10-cm2 growth area. (B): Time course of adipogenic differentiation by hMSCs pre-expanded in FCS, ARS, ARS+, or FCS+ and then transferred to adipogenic medium with FCS for up to 35 days. Error bars represent SD (n = 6). The values on the y-axis represent the concentration of detected oil red O stain recovered per 10-cm2 growth area. (C): The shape of constructs containing rMSCs cultured in standard, osteogenic, and adipogenic medium for 7 days. (D): Epifluorescence microscopy (x20 upper, x4 lower) of rMSCs in constructs cultured in the presence of FCS, ARS, or ARS+. (E): Proliferation of rMSCs in constructs cultured in FCS, ARS, or ARS+. The values on the y-axis represent the number of detected genomes per construct. Error bars are omitted for clarity, but the replicate cell counts (n = 6) deviated by less than 8%. (F): Alizarin Red S staining of histological sections of explanted constructs demonstrating the presence of mineralized tissue in FCS-treated constructs and to a far lesser extent in the ARS+-treated constructs. Abbreviations: AHS, adult human serum; ARS, adult rat serum; FBS, fetal bovine serum; FCS, fetal calf serum; h, host tissue; hMSC, human mesenchymal stem cell; HS, human serum; i, implant; OD, optical density; rMSC, rat mesenchymal stem cell.
|
|
In terms of lipid production as assayed by oil red O staining, hMSCs grown in 20% AHS did not differ in their capacity for adipogenesis when compared with cells grown in 20% FCS (Fig. 5B). Alternatively, cells grown in either AHS+ or FCS+ demonstrated a significant increase in oil red O staining as compared with cells grown without growth factor supplements (Fig. 5B). At the 30-day time point, cells grown in AHS+ exhibited significantly greater oil red O staining compared with hMSCs grown in FCS+ (Fig. 5B).
In Vivo Tests of Cell Survival in Fibrin Constructs
To test the in vivo viability of the rMSCs grown under various serum conditions, an engraftment assay was employed based on the subcutaneous implantation of the cells encapsulated in coagulated plasma fibrin. MSCs were initially expanded in FCS and then transferred to ARS+, ARS, or FCS for a further 5 days. The cells were then recovered by trypsinization and mixed with citrated rat plasma. Upon addition of thromboplastin C and calcium, the plasma coagulated with the cells. The appropriate growth medium was added to the constructs for further culture. Interestingly, in the presence of medium containing FBS, ARS, or ARS+, the MSCs caused the construct to shrink and become a dense, compact structure after approximately 4 days (Fig. 5C). When the constructs were cultured in the presence of medium with adipogenic or osteogenic supplements, the constructs became flat, laminar structures that were durable and could be manipulated easily with forceps (Fig. 5C; osteo or adipo). Upon microscopic inspection, it was apparent that the MSCs had spread within the constructs and formed a complex meshwork of processes (Fig. 5D) that formed after a few hours and became progressively complex over 7 days. Extraction of gDNA and quantification confirmed that proliferation occurred within the constructs in all media tested. ARS+ medium consistently provided the best proliferative conditions (Fig. 5E).
To examine the viability of the fibrin constructs in vivo, 20-mm-diameter constructs containing 300,000 GFP rMSCs were synthesized in adipogenic medium and cultured for 7 days in the presence of ARS, ARS+, or FCS. Adipogenic medium was chosen to preserve the shape of the construct and to reduce the tendency of the cells to differentiate into mineralizing tissue. The constructs were implanted into Sprague-Dawley rats subcutaneously, between the scapulae. There were no complications resulting from implantation, and the incisions healed after approximately 1 week. After 14 days, new constructs were reimplanted at the same site, this time containing 106 MSCs. Similarly, the constructs were well received by the hosts, and the implantation site healed after approximately 1 week. After 14 days, the implantation sites were removed and subjected to either DNA extraction for evaluation of cell number or immunohistochemistry and histology.
When the removed implants were examined macroscopically, the constructs were integrated into the surrounding tissue. Upon histological inspection, the fibrin could be readily visualized. Implants prepared using FCS, and to a lesser extent ARS, often became completely mineralized and stained densely with Alizarin Red S (Fig. 5F). In contrast, all but one of the constructs cultured in ARS+ did not mineralize, and in the instance where it was detectable, the maximal degree of calcification was less than 5% of the total volume (Fig. 5F). This is an observation consistent with the ex vivo differentiation data (Fig. 5A) indicating that the ARS+ suppressed mineralization of the constructs.
Immunohistochemical staining of the constructs for GFP confirmed the presence of many rMSCs surrounding the site of the implanted constructs that had been cultured in ARS and ARS+ (Fig. 6). The cells cultured in heterologous ARS or ARS+ retained their spindle-shaped morphology in vivo, but most had migrated to the periphery of the implant and had integrated into the surrounding host tissue (Fig. 6A6C). In some cases, the fibrin vector was completely clear of rMSCs, and all of them had migrated into the surrounding host tissue (data not shown). Numerous host lymphocytes that stained with an antibody against monocytes and macrophages were identified within the construct but did not appear to be attacking the MSCs grown in ARS or ARS+ (Fig. 6D). Because the macrophages/monocytes were detected in all of the constructs from all three groups and the cells were not seen to participate in the destruction of MSCs, it is possible that the monocyte/macrophage response was directed against the construct itself rather than the cells. MSCs that had migrated out of the construct labeled with antibodies against fibronectin (a fibroblast marker) and appeared to be engaged in helping to heal the host wound (Fig. 6E). At other sites outside the construct, migrating transplanted MSCs were negative for fibronectin and appeared instead to be associated with vascular elements (Fig. 6F). In agreement with the PCR ELISA data, only one of the implants from cells cultured in FCS contained cells that were identified by the GFP antibody (data not shown and Fig. 7).

View larger version (79K):
[in this window]
[in a new window]
|
Figure 6. Engraftment and migration of rMSCs cultured in heterologous species-specific serum and transplanted in fibrin constructs. (A): DIC image of tissue containing MSCs. Fibrin construct is no longer present. (B): Epifluorescence image of tissue shown in (A). GFP rMSCs (red, ALEXA 594 staining) remain engrafted 2 weeks after implantation. (C): GFP rMSCs migrating away from the fibrin construct (arrows). Autofluorescence is turned up to show the construct. (D): Monocyte/macrophage staining of construct localizes host-derived lymphocytes (green, ALEXA 488). Migrating rMSCs (red) are not under immune attack. (E): Some rMSCs (red) that stain for fibronectin, a fibroblast marker (green, ALEXA 488), appear to be engaged in wound repair of the host (arrows, double-positive cells). (F): A portion of the rMSCs (red) that migrate out of the construct are associated with blood vessels (RBCs, yellow autofluorescence) and are negative for fibronectin (green). Abbreviations: Auto, autofluorescence; DIC, differential interference contrast; EPI, epifluorescence; Fibro, fibronectin; GFP, green fluorescent protein; MM, monocyte/macrophage; MSC, mesenchymal stem cell; rMSC, rat mesenchymal stem cell.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
Figure 7. Immune responses generated against rMSCs cultured under different conditions and quantification of engraftment. (A): Levels of anti-fFCS IgG in serum before (pre) and after (post) implantation with constructs cultured in FCS, ARS, or ARS+ in three animals (AC) per condition. (B): Measurement of recovered eGFP-encoding DNA from explanted constructs cultured in FCS, ARS, or ARS+ (PLS on histogram) prior to implantation. The bars represent measurements from single animals, and the y-axis represents the number of eGFP copies detected per microgram of genomic DNA recovered from the implant. The lower plot is a rescaled logarithmic plot of the lower values. Error bars represent SD of three measurements (n = 3). Abbreviations: ARS, adult rat serum; eGFP, enhanced green fluorescent protein; FCS, fetal calf serum; IgG, immunoglobulin G; PLS, ARS+.
|
|
Because the probability of graft success in both the ARS and ARS+ groups was much higher than in the FCS control groups, but the macrophage response was present in all of the groups tested, it was hypothesized that an IgG-mediated response directed against FCS may account for the phenomenon. To examine this possibility, some of the rats were tested for immunoglobulins directed against contaminating FCS. As expected, rats that received constructs cultured in FCS generated high levels of anti-FCS IgG that probably accounted for the lack of engraftment. Constructs cultured in ARS or ARS+ did not elicit the IgG response, despite initial expansion in medium containing FCS (Fig. 7A).
A PCR ELISA-based quantification assay was employed to measure the degree of rMSC engraftment based on the presence of the eGFP gene. DNA was extracted from the implants, and a portion of the gene encoding 28S ribosomal RNA or eGFP was amplified in the presence of DIG-labeled deoxy nucleotides. The resultant fragments were denatured in alkali and renatured in the presence of a biotinylated oligonucleotide probe coding for a sequence corresponding to an internal stretch of the amplicon. The heteroduplexes were then immobilized on streptavidin-coated microtiter plates, and the DIG-labeled fragments were quantified by immunodetection. Using GFP rat gDNA containing an eGFP-encoding construct as a standard, the number of eGFP copies in the gDNA extracted from the implants could be quantified and related to the total DNA defined by the 28S ribosomal signal. The eGFP-labeled rMSCs could be detected in all of the explants containing constructs cultured in medium containing ARS or ARS+, but the degree of engraftment was variable (Fig. 7B), ranging from approximately 10 to 300 copies of eGFP per µg of recovered DNA (ARS n = 5, ARS+ n = 6). There was no significant difference between the viability of engrafted rMSCs between the ARS or ARS+ groups. In the case of the FCS-treated constructs, the range of engrafted cells was approximately 0.2 to 1 copies of eGFP per µg of recovered DNA for five of six animals (Fig. 7B), measurements that were very close to the threshold of the assay. The remaining animal from this group harbored 240 eGFP copies per µg of recovered DNA, and the reason for such high engraftment compared with the other animals in the FCS group is unclear.
 |
DISCUSSION
|
|---|
Our data demonstrate that hMSCs and rMSCs can be expanded efficiently when cultured in medium containing heterologous species-specific serum for a duration that is sufficient to remove most of the FCS contamination that accompanies the MSCs. Although we have not tested MSCs after multiple passages, a brief (up to 12 days) exposure to species-specific serum is sufficient to sustain or even improve proliferative capacity and in vivo viability. hMSCs grown in 20% heterologous human serum grow as well as in 20% FCS, and hMSCs grown in 10% heterologous human serum supplemented with 10 ng ml1 EGF and 10 ng ml1 bFGF expand significantly better than when cultured in 20% FCS. Furthermore, as we demonstrated previously for medium containing autologous species-specific serum [27], the heterologous conditions that we have defined here are useful for the removal of 99.99% of FCS contamination after a brief culture period. Reducing the FCS concentration in the medium to 10%, a standard clinical protocol for the expansion of MSCs, does not appreciably reduce the level of contamination. This suggests that the process is active or saturable, and there is therefore still a necessity for a preconditioning step in human serum. A recent study reported that hMSCs could be cultured and expanded effectively in autologous serum but not in heterologous human serum [30]. Although we cannot completely explain the negative outcome of this study, it is likely that the investigators either did not use the method reported here and previously to prepare the serum [27] or only used commercially available heterologous human serum. For reasons that are unclear, we were also unable to grow hMSCs in commercially available human serum [27].
Transplantation and survival of rMSCs in vivo demonstrates that growth of MSCs in medium containing species-specific serum can improve the probability of graft success probably by virtue of reduced immunogenicity of the cells. Furthermore, ARS+ prevents undesirable osteogenic differentiation of the MSCs after implantation. We have not determined whether growth in medium supplemented with EGF and bFGF promotes specification down other cell lineages, although adding the supplements to either FCS or AHS significantly improved the adipogenic potential of the cells. MSCs cultured in ARS and ARS+ survived and migrated from the constructs and appeared to engage in host wound repair both as fibronectin-positive fibroblasts and as other unidentified cell types. As expected, host-derived lymphocytes were present at the injury site but did not attack the MSCs grown in heterologous species-specific serum. Early innate immune rejection of implanted cells has been widely documented in the literature, even in immune compromised transplant models, but these observations are generally made when the implanted cells are considerably mismatched with the host (e.g., after xenotransplantation) [44, 45]. Graft rejection has also been documented in mice in which the cells and the host were mismatched for major histocompatibility complex (MHC) [46]. In this particular study, erythropoietin-expressing MSCs were rejected from MHC-mismatched hosts by a combination of innate and acquired immunity. In the case of this study, all of the MSCs were derived from Sprague-Dawley rats that are a genetically similar, but outbred, strain of rat and therefore could conceivably be mismatched for MHC antigens. This would be predicted to account for the destruction of many MSCs in the constructs but could not account for the increased probability of graft success when the cells and constructs were prepared in species-specific serum. Furthermore, migration of the MSCs out of the construct was observed, a factor that also could conceivably lead to a reduction of the number of detectable MSCs. The presence of a macrophage/monocyte response in all of the types of construct tested also suggests that the monocytes/macrophages may be mobilized against the material of the construct rather than to the cells themselves. Clotted fibrin is a known adhesion and survival factor of macrophages in vivo [47].
In contrast with the constructs grown in species-specific serum, all but one of the constructs cultured in FCS were destroyed by the host. Because the monocyte/macrophage response was universal across all three of the test groups, the greater frequency of graft failure in the FCS test group was probably mediated by an adaptive humoral response given that we detected antibodies against FCS in the blood of all of the animals we assayed that received FCS-cultured cells. Nevertheless, it is not unreasonable to suggest that the increased success of the engrafted constructs containing growth factor-expanded cells may also be due to enhanced viability through nonimmunological mechanisms. For instance, MSCs treated with growth factors and then extensively expanded may be susceptible to cytogenetic aberrancies or telomerase-mediated alterations in cell cycle regulation. Cytogenetic aberrancies, however, are unlikely; in this series of in vivo experiments, the MSCs were at passage 23 for a maximum of 10 days. Regardless of the presence of growth factors in the medium, the probability of a malignant cytogenetic aberrancy occurring in this study as well as with those aberrancies reported in Spees et al. [27] is not likely given that this is a very short duration for an aberrancy to occur and then to be selected for. Indeed, based on the proliferation data in this study, 10 days of culture in growth factor-supplemented medium can propagate a maximum of only nine cell doublings. In contrast, the presence of bFGF in growth medium has been documented to lead to enrichment of MSCs with longer telomere lengths even over very short periods of culture through clonal selection rather than enhanced telomerase activity [48]. Telomerase activity has been found to be insignificant in MSCs even after growth factor treatment [49]. In agreement with these observations, the MSCs treated by AHS+ in the study by Spees et al. [27] were found not to express telomerase upon microarray transcriptome analysis. It is likely, therefore, that the in vivo viability of the MSCs cultured in growth factors may be due to longer inherent telomere lengths but not malignant aberrancies at the level of telomerase or the chromatin.
 |
SUMMARY
|
|---|
The extent of the migration of the cells and their in vivo longevity is still under investigation, but these preliminary data suggest that fibrin vectors and species-specific culture conditions may provide an efficient strategy of MSC administration that maximizes viability and efficacy.
 |
DISCLOSURES
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
C.A.G. and J.L.S. contributed equally to this work. This work was funded by the National Institutes of Health (1P01HL075161 and HL077570-01), The Louisiana Gene Therapy Consortium, and HCA, The Health Care Company.
 |
REFERENCES
|
|---|
- Horwitz EM, Prockop DJ, Fitzpatrick LA et al. Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat Med 1999;5:309313.[CrossRef][Medline]
- Horwitz EM, Gordon PL, Koo WK et al. Isolated allogeneic bone marrow-derived mesenchymal cells engraft and stimulate growth in children with osteogenesis imperfecta: Implications for cell therapy of bone. Proc Natl Acad Sci U S A 2002;99:89328937.[Abstract/Free Full Text]
- Le Blanc K, Gotherstrom C, Ringden O et al. Fetal mesenchymal stem-cell engraftment in bone after in utero transplantation in a patient with severe osteogenesis imperfecta. Transplantation 2005;79:16071614.[CrossRef][Medline]
- Le Blanc K, Rasmusson I, Sundberg B et al. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004;363:14391441.[CrossRef][Medline]
- Lazarus HM, Koc ON, Devine SM et al. Cotransplantation of HLA-identical sibling culture-expanded mesenchymal stem cells and hematopoietic stem cells in hematologic malignancy patients. Biol Blood Marrow Transplant 2005;11:389398.[CrossRef][Medline]
- Chen SL, Fang WW, Ye F et al. Effect on left ventricular function of intracoronary transplantation of autologous bone marrow mesenchymal stem cell in patients with acute myocardial infarction. Am J Cardiol 2004;94:9295.[CrossRef][Medline]
- Mazzini L, Fagioli F, Boccaletti R et al. Stem cell therapy in amyotrophic lateral sclerosis: A methodological approach in humans. Amyotroph Lateral Scler Other Motor Neuron Disord 2003;4:158161.[CrossRef][Medline]
- Friedenstein AJ, Chailakhyan RK, Latsinik NV et al. Stromal cells responsible for transferring the microenvironment of the hemopoietic tissues. Cloning in vitro and retransplantation in vivo. Transplantation 1974;17:331340.[Medline]
- Friedenstein AJ, Gorskaja JF, Kulagina NN. Fibroblast precursors in normal and irradiated mouse hematopoietic organs. Exp Hematol 1976;4:267274.[Medline]
- Pereira RF, Halford KW, O'Hara MD et al. Cultured adherent cells from marrow can serve as long-lasting precursor cells for bone, cartilage, and lung in irradiated mice. Proc Natl Acad Sci U S A 1995;92:48574861.[Abstract/Free Full Text]
- Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143147.[Abstract/Free Full Text]
- Sekiya I, Vuoristo JT, Larson BL et al. In vitro cartilage formation by human adult stem cells from bone marrow stroma defines the sequence of cellular and molecular events during chondrogenesis. Proc Natl Acad Sci U S A 2002;99:43974402.[Abstract/Free Full Text]
- Sekiya I, Larson BL, Smith JR et al. Expansion of human adult stem cells from bone marrow stroma: Conditions that maximize the yields of early progenitors and evaluate their quality. STEM CELLS 2002;20:530541.[Abstract/Free Full Text]
- Prockop DJ. Marrow stromal cells as stem cells for non-hematopoietic tissues. Science 1997;276:711714.
- Gregory CA, Prockop DJ, Spees JL. Non-hematopoietic bone marrow stem cells: Molecular control of expansion and differentiation. Exp Cell Res 2005;306:330335.[CrossRef][Medline]
- Koç ON, Day J, Nieder M et al. Allogeneic mesenchymal stem cell infusion for treatment of metachromatic leukodystrophy (MLD) and Hurler syndrome (MPS-IH). Bone Marrow Transpl 2002;30:215222.[CrossRef][Medline]
- Koç ON, Gerson SL, Cooper BW et al. Allogeneic mesenchymal stem cell infusion for treatment of metachromatic leukodystrophy (MLD) and Hurler syndrome (MPS-IH). J Clin Oncol 2000;18:18241830.[Abstract/Free Full Text]
- Sotiropoulou PA, Perez SA, Salagianni M et al. Characterization of the optimal culture conditions for clinical scale production of human mesenchymal stem cells. STEM CELLS 2006;24:462471.[Abstract/Free Full Text]
- Sotiropoulou PA, Perez SA, Salagianni M et al. Response to the "Letter to the Editor" by Dr. Dimarakis et al, entitled: Cell culture medium composition and translational adult bone marrow-derived stem cell research. STEM CELLS 2006; [Epub ahead of print].
- Angoulvant D, Clerc A, Benchalal S et al. Human mesenchymal stem cells suppress induction of cytotoxic response to alloantigens. Biorheology 2004;41:469476.[Medline]
- Le Blanc K. Immunomodulatory effects of fetal and adult mesenchymal stem cells. Cytotherapy 2003;5:485489.[CrossRef][Medline]
- Le Blanc K, Tammik C, Rosendahl K et al. HLA expression and immunologic properties of differentiated and undifferentiated mesenchymal stem cells. Exp Hematol 2003;31:890896.[CrossRef][Medline]
- Devine SM, Cobbs C, Jennings M et al. Mesenchymal stem cells distribute to a wide range of tissues following systemic infusion into nonhuman primates. Blood 2003;101:29993001.[Abstract/Free Full Text]
- Mackensen A, Dräger R, Schlesier M et al. Presence of IgE antibodies to bovine serum albumin in a patient developing anaphylaxis after vaccination with human peptide-pulsed dendritic cells. Cancer Immunol Immunother 2000;49:152156.[CrossRef][Medline]
- Selvaggi TA, Walker RE, Fleisher TA. Development of antibodies to fetal calf serum with arthus-like reactions in human immunodeficiency virus-infected patients given syngeneic lymphocyte infusions. Blood 1997;89:776779.[Abstract/Free Full Text]
- Tuschong L, Soenen SL, Blaese RM et al. Immune response to fetal calf serum by two adenosine deaminase-deficient patients after T cell gene therapy. Hum Gene Ther 2002;13:16051610.[CrossRef][Medline]
- Spees JL, Gregory CA, Singh H et al. Internalized antigens must be removed to prepare hypo-immunogenic mesenchymal stem cells for cell and gene therapy. Mol Ther 2004;9:747756.[CrossRef][Medline]
- Stute N, Holtz K, Bubenheim M et al. Autologous serum for isolation and expansion of human mesenchymal stem cells for clinical use. Exp Hematol 2004;12:12121225.
- Kim SJ, Cho HH, Kim YJ et al. Human adipose stromal cells expanded in human serum promote engraftment of human peripheral blood hematopoietic stem cells in NOD/SCID mice. Biochem Biophys Res Commun 2005;329:2531.[CrossRef][Medline]
- Shahdadfar A, Frønsdal K, Haug T et al. In vitro expansion of human mesenchymal stem cells: Choice of serum is a determinant of cell proliferation, differentiation, gene expression, and transcriptome stability. STEM CELLS 2005;23:13571366.[Abstract/Free Full Text]
- Anselme K, Broux O, Noel B et al. In vitro control of human bone marrow stromal cells for bone tissue engineering. Tissue Eng 2002;8:941953.[CrossRef][Medline]
- Doucet C, Ernou I, Zhang Y et al. Platelet lysates promote mesenchymal stem cell expansion: A safety substitute for animal serum in cell-based therapy applications. J Cell Physiol 2005;205:228236.[CrossRef][Medline]
- Colter DC, Class R, DiGirolamo CM et al. Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci U S A 2000;97:32133218.[Abstract/Free Full Text]
- Phinney DG, Kopen G, Righter W et al. Donor variation in the growth properties and osteogenic potential of human marrow stromal cells. J Cell Biochem 1999;75:424436.[CrossRef][Medline]
- Javazon EH, Colter DC, Schwarz EJ et al. Rat marrow stromal cells are more sensitive to plating density and expand more rapidly from single-cell-derived colonies than human marrow stromal cells. STEM CELLS 2001;19:219225.[Abstract/Free Full Text]
- Gregory CA, Gunn WG, Piester A et al. An Alizarin red based method for the assay of mineralization by adherent cells in culture. Comparison with cetylpyridinium chloride extraction. Anal Biochem 2004;329:7784.[CrossRef][Medline]
- Gregory CA, Perry AS, Reyes E et al. Dkk-1 derived synthetic peptides and lithium chloride for the control and recovery of adult stem cells from bone marrow. J Biol Chem 2005;280:23092323.[Abstract/Free Full Text]
- Ausubel FM. Current Protocols in Molecular Biology. In: Brent R, Kingston RE, Moore DD, eds. Hoboken, NJ: John Wiley and Sons, Inc.,1998;914.
- Gregory CA, Rigg GP, Illidge CM et al. Quantification of Escherichia coli genomic DNA contamination in recombinant protein preparations by polymerase chain reaction and affinity-based collection. Anal Biochem 2001;296:114121.[CrossRef][Medline]
- Naito E, Dewa K, Ymanouchi H et al. Ribosomal ribonucleic acid (rRNA) gene typing for species identification. J Forensic Sci 1991;37:396403.
- Okabe M, Ikawa M, Kominami K et al. Green mice as a source of ubiquitous green cells. FEBS Lett 1997;407:313319.[CrossRef][Medline]
- Ito T, Suzuki A, Imai E et al. Bone marrow is a reservoir of repopulating mesangial cells during glomerular remodeling. J Am Soc Nephrol 2001;12:26252635.[Abstract/Free Full Text]
- Gregory CA, Singh H, Perry AS et al. Dkk-1 is required for re-entry into the cell cycle of human adult stem cells from bone marrow stroma (hMSCs). J Biol Chem 2003;278:2806728078.[Abstract/Free Full Text]
- Grinnemo KH, Mansson A, Dellgren G et al. Xenoreactivity and engraftment of human mesenchymal stem cells transplanted into infarcted rat myocardium. J Thorac Cardiovasc Surg 2004;127:12931300.[Abstract/Free Full Text]
- Xia Z, Ye H, Choong C et al. Macrophagic response to human mesenchymal stem cell and poly(epsilon-caprolactone) implantation in nonobese diabetic/severe combined immunodeficient mice. J Biomed Mater Res A 2004;71:538548.[CrossRef][Medline]
- Eliopoulos N, Stagg J, Lejeune L et al. Allogeneic marrow stromal cells are immune rejected by MHC class I- and class II-mismatched recipient mice. Blood 2005;106:40574065.[Abstract/Free Full Text]
- Brodbeck WG, Colton E, Anderson JM. Effects of adsorbed heat labile serum proteins and fibrinogen on adhesion and apoptosis of monocytes/macrophages on biomaterials. J Mater Sci Mater Med 2003;14:671675.[CrossRef][Medline]
- Bianchi G, Banfi A, Mastrogiacomo M et al. Ex vivo enrichment of mesenchymal cell progenitors by fibroblast growth factor 2. Exp Cell Res 2003;287:98105.[CrossRef][Medline]
- Banfi A, Bianchi G, Notaro R et al. Replicative aging and gene expression in long-term cultures of human bone marrow stromal cells. Tissue Eng 2002;8:901910.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
D. J. Weiss, J. K. Kolls, L. A. Ortiz, A. Panoskaltsis-Mortari, and D. J. Prockop
Stem Cells and Cell Therapies in Lung Biology and Lung Diseases
Proceedings of the ATS,
July 15, 2008;
5(5):
637 - 667.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Locatelli, R. Maccario, and F. Frassoni
Mesenchymal stromal cells, from indifferent spectators to principal actors. Are we going to witness a revolution in the scenario of allograft and immune-mediated disorders?
Haematologica,
July 1, 2007;
92(7):
872 - 877.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Mannello and G. A. Tonti
Concise Review: No Breakthroughs for Human Mesenchymal and Embryonic Stem Cell Culture: Conditioned Medium, Feeder Layer, or Feeder-Free; Medium with Fetal Calf Serum, Human Serum, or Enriched Plasma; Serum-Free, Serum Replacement Nonconditioned Medium, or Ad Hoc Formula? All That Glitters Is Not Gold!
Stem Cells,
July 1, 2007;
25(7):
1603 - 1609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Heiskanen, T. Satomaa, S. Tiitinen, A. Laitinen, S. Mannelin, U. Impola, M. Mikkola, C. Olsson, H. Miller-Podraza, M. Blomqvist, et al.
N-Glycolylneuraminic Acid Xenoantigen Contamination of Human Embryonic and Mesenchymal Stem Cells Is Substantially Reversible
Stem Cells,
January 1, 2007;
25(1):
197 - 202.
[Abstract]
[Full Text]
[PDF]
|
 |
|