| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TISSUE-SPECIFIC STEM CELLS |
aCenter for Gene Therapy, Tulane University Health Sciences Center, New Orleans, Louisiana, USA;
bDepartment of Medicine, Cardiovascular Research Institute, University of Vermont, Colchester, Vermont, USA
Key Words. Adult bone marrow stem cells • Stem cell culture • Mesenchymal stem cells • Immune system • Experimental models • Ex vivo expansion • Engraftment
Correspondence: Carl A. Gregory, Ph.D., Center for Gene Therapy, Tulane University Health Sciences Center, 1430 Tulane Avenue, New Orleans, Louisiana 70112, USA. Telephone: 504-988-7176; Fax: 504-988-7710; e-mail: cgregory{at}tulane.edu
Received on December 5, 2005;
accepted for publication on May 30, 2006.
First published online in STEM CELLS EXPRESS June 8, 2006.
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
-minimal essential medium (MEM) with 10%–20% fetal calf serum (FCS), and to date, all U.S. Food and Drug Administration (FDA)-approved clinical trials have employed hMSCs expanded in FCS under FDA-approved protocols [1, 15, 17]. The use of FCS to expand MSCs for clinical use is also acceptable in Europe [18, 19]. Although hMSCs themselves are not highly immunogenic [20–23], when expanded in FCS they are likely to generate immune responses in some patients on first administration. More patients are predicted to respond adversely if repeated administrations are required; anaphylactic reactions have been noted in several patients who received repeated administrations of dendritic cells or lymphocytes cultured in FCS [24–26]. Furthermore, in one clinical trial for the treatment of osteogenesis imperfecta, a patient was identified with antibodies against bovine serum proteins after treatment with hMSCs grown in medium containing FCS; this patient did not exhibit successful cellular engraftment [2]. Previously, we reported that by fluorescence-based assay, 7–30 mg of internalized FCS is associated with 108 hMSCs, a dosage that will probably be needed for therapy [27]. We also found that a brief culture with 20% adult human serum (AHS) or 10% AHS with growth factors (AHS+) reduced the contamination by more than 99.9% [27]. Subsequently, the utility of human serum in MSC expansion has been confirmed by other investigators [28–30], and the potential of plasma has also been demonstrated [31, 32].
In this study, we have now extensively characterized species-specific culture conditions for hMSCs and rat MSCs (rMSCs). We show that hMSC and rMSC expansion is possible using heterologous species-specific serum for periods sufficient to significantly deplete FCS contamination. The resulting MSCs are phenotypically similar to those grown in standard conditions with FCS. We also demonstrate that uptake of FCS by MSCs is an active process that leads to an intracellular accumulation of bovine antigens even when significantly lower concentrations of FCS are used in the expansion medium (2% FCS). Finally, we describe a rat-based assay of subcutaneous MSC engraftment involving the pre-encapsulation of the cells in a fibrin matrix. With this assay, we show that MSCs exhibit enhanced long-term viability when cultured to remove bovine contaminants. The culture conditions reported in this study provide a means to propagate MSCs and efficiently sustain their survival in immunocompetent models of adult stem cell engraftment. The method has the potential to significantly improve human cellular and genetic therapies using hMSCs.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
Fluorescent Serum Preparation
Fluorescein-conjugated fluorescent FCS (fFCS) and AHS (fAHS) were prepared as described previously [27]. Briefly, the FCS was diafiltered into sodium bicarbonate buffer at pH 9.0, labeled with fluorescein isothiocyanate (FITC), and extensively diafiltered into phosphate-buffered saline (PBS) to remove unreacted FITC. The labeled FCS was then adjusted back to the original protein concentration.
Tissue Culture
hMSCs were prepared and grown as described previously by the Tulane Health Sciences Center stem cell distribution facility [13, 33]. To safeguard against the inclusion of poor MSC preparations that occasionally occur [34] in the stem cell archive, the cells are prequalified for proliferative and trilineage differentiation potential using parameters designed for clinical grade MSC preparation. rMSCs from Sprague-Dawley rats (Charles River Laboratories, Inc.) and from Sprague-Dawley enhanced green fluorescent protein (eGFP) transgenic rats (kindly provided by M. Okabe, Genome Information Research Center, Osaka University, Japan) were prepared as described previously [35]. hMSCs and rMSCs were initially expanded in a complete culture medium (CCM) consisting of -MEM (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) with 20% FCS (lot selected for rapid growth of MSCs; Atlanta Biologicals, Norcross, GA), 100 U/ml penicillin, 100 µg/ml streptomycin, and 1 mM L-glutamine (Invitrogen). The hMSCs and rMSCs were expanded in FCS-containing medium until passage 2 or 3, respectively, then frozen down until required. For assays of cell proliferation, cells were quantified by fluorescent labeling of nucleic acids (CyQuant dye; Invitrogen). hMSCs were plated at 100 cells per cm2 into 10-cm2 wells (Corning Life Sciences, Acton, MA, http://www.corning.com/lifesciences) and allowed to grow for 4 days. The cells were washed with PBS, and medium was added that contained the indicated concentration of serum and growth factors. The cells were recovered by trypsinization, washed in PBS, and added to the fluorescent labeling mix. Fluorescence measurements were carried out using a microplate fluorescence reader (FLX800; BioTek Instruments, Inc., Winooski, VT, http://www.biotek.com) set to 480 nm excitation and 520 nm emission. Data were statistically analyzed using Student's t test (two-tailed). Experiments were repeated using hMSCs from at least two donors. Uptake experiments with fFCS and fAHS were done as described previously [27]. For fAHS uptake experiments, cells grown in 20% FCS were incubated in medium containing 10% heterologous FITC-labeled human serum supplemented with 10 ng ml–1 epidermal growth factor (EGF) and 10 ng ml–1 basic fibroblast growth factor (bFGF) for 4 days prior to two PBS washes and digital imaging. For FCS uptake experiments, cells were seeded into 10-cm2 plates (Corning Life Sciences) at 100 cells per cm2 and allowed to grow in complete medium containing 20% FCS for 4 days before replacement with medium containing the indicated concentration of fFCS for 2 days. After two PBS washes, in addition to quantification of fFCS as above (FLX800; BioTek Instruments, Inc.), the cells were visualized by phase-contrast and epifluorescence microscopy (Nikon Eclipse TE200; Nikon, Tokyo, http://www.nikon.com) and documented by digital imaging.
Osteogenic Differentiation and Quantification of Alizarin Red S Staining
For standard osteogenic differentiation, confluent monolayers of hMSCs were incubated in medium supplemented with 10–8 M dexamethasone (Decadron; Merck & Co., Inc., Whitehouse Station, NJ, http://www.merck.com), 50 µg ml–1 ascorbic acid, and 5 mM ß-glycerol phosphate (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) for 40 days with changes of medium every 5 days. Quantification of staining was carried out using a previously described dye extraction procedure [36].
Adipogenic Differentiation and Quantification of Oil Red O Staining
All reagents were purchased from Sigma-Aldrich. Confluent monolayers of hMSCs in six-well plates (10 cm2 per well) were incubated in medium supplemented with 10–8 M dexamethasone, 5 x 10–8 M isobutylmethylxanthine, and 5 x 10–7 M indomethacin. After 30 days, the adipogenic cultures are fixed in 10% formalin for 15 minutes and stained with fresh oil red O solution in 60% (vol/vol) isopropanol in PBS for 20 minutes. Quantification of staining was carried out using a previously described procedure [37].
Fibrin Constructs
Blood was recovered from adult Sprague-Dawley rats as described above. The blood was drawn into a 10-ml syringe containing 1.5 ml 200 mM sodium citrate (pH 7.4) (Sigma-Aldrich). The resultant plasma was recovered from the blood by centrifugation at 3,000g for 30 minutes (approximately 0.8 of the total volume of the draw), and then the supernatant was subjected to further centrifugation for 20 minutes at 3,500g. rMSCs were pre-expanded in CCM and then cultured for a further 2 days in the appropriate experimental medium preparation: CCM, osteogenic medium, or adipogenic medium. Cells were recovered by trypsinization, washed in PBS, and then added to the appropriate volume of rat plasma. The plasma/cell suspension was then aliquoted into wells of a 12-well (1 ml) or 24-well (0.5 ml) tissue culture plate (Corning Life Sciences). To initiate clotting, an equal volume of thromboplastin was added (Plastinex; Corning Life Sciences) followed by 0.1 volumes of a 1 M solution of tissue culture grade CaCl2. Clotting was allowed to proceed for 2–4 hours, and then the appropriate experimental medium preparation was added to cover the solid construct. The constructs were cultured in CCM for a further 8 days with a change of medium every 2 days. For assays of cell proliferation within the construct, total DNA was quantified by fluorescent labeling of nucleic acids (CyQuant dye; Invitrogen) as described above. DNA recovery was normalized to cell number, and baseline values were acquired from unseeded constructs.
Implantation of Constructs Created Under Different Cell Expansion Conditions
Adult age-matched male Sprague-Dawley rats were separated into three groups of six animals. Before implantation of the constructs, three animals of each group had 0.5 ml of blood drawn from the tail vein under anesthesia. Serum was recovered from the blood as described [27]. Implants containing 300,000 GFP-labeled MSCs pre-expanded in 20% FCS, 20% ARS, or ARS+ were cultured in 24-well plates for 7 days at 37°C in humidified air containing 5% CO2. Under anesthesia, the fibrin constructs were implanted subcutaneously between the scapulae. Briefly, the coat was shaved and the skin was sterilized by application of ethanol and iodine. A 15–20-mm incision was made longitudinally between the scapulae, and a small cavity was made between the dermis of the skin and the fascia below to accommodate the constructs, which were 10–20 mm in diameter. The incision was closed by two or three sutures and then sealed (Vetbond; 3M, St. Paul, MN, http://www.3m.com). After 5 days, the sutures were removed. After 10 days, the procedure was repeated using constructs that contained 106 cells at the same implantation site. Fourteen days thereafter, the animals were placed under anesthesia and euthanized by cardiac exsanguination, and serum was prepared from the blood. The implants with adjacent skin were removed for histology or genomic DNA (gDNA) extraction.
Immunohistochemistry
Surviving GFP-expressing MSCs were identified by fluorescent antibody labeling. Epifluorescent, DIC (differential interference contrast), and deconvolution microscopy was done using a Leica DM6000B microscope equipped with an automated x, y, z stage and a CCD (charge-coupled device) camera (Leica DFC350 FX; Leica Camera AG, Solms, Germany, http://www.leica.com). Images taken at 0.5-µm intervals were deconvoluted using commercial software (Leica FW4000 and Leica Deblur). Detailed immunohistochemistry methods are available online as supplemental information.
Polymerase Chain Reaction-Based GFP Assay
DNA was extracted from the recovered implants with a cell lysis buffer and phenol/chloroform/isoamyl alcohol as described [38]. The number of GFP-expressing cells within the implant was estimated using a modification of a previously described protocol [39]. Briefly, the GFP-encoding and 28S ribosome-encoding gDNA was amplified from the gDNA and was digoxygenin (DIG)-labeled simultaneously. Each reaction consisted of 44 µl of polymerase chain reaction (PCR) master mix (Invitrogen), 3 µl of PCR DIG labeling mix (Roche Diagnostics, Indianapolis, http://www.roche.com), and 2 µl (100 pmol of each) of the 28S ribosomal RNA amplimers described by Naito et al. [40] or 2 µl (100 pmol of each) of the eGFP amplimers (forward: GCTGACCCTGAAGTTCATCTGCA and reverse: TCTTCTGCTTGTCGGCCATGATA). Reactions were cycled to the following parameters: initial denature step at 95°C for 5 minutes for one cycle then denature 95°C for 30 seconds, anneal 54°C (for ribosome control) or 56°C (for eGFP) for 30 seconds, and extension at 72°C for 30 seconds for 30 cycles, followed by a final extension at 72°C for 5 minutes. The resultant fragments are approximately 300 and 480 bp for the ribosomal fragment and eGFP fragment, respectively. The apparent mass of the fragments can vary by up to 10% depending on the extent of labeling when analyzed by acrylamide or agarose gel electrophoresis. PCR enzyme-linked immunosorbent assay (ELISA) assays on 5 µl of the PCRs were carried out in accordance with Gregory et al. [36]. Both wild-type rat gDNA spiked with the eGFP-encoding plasmid pEGFPC1 (Clontech Co., Mountain View, CA, http://www.clontech.com) used to generate the transgenic rats [41, 42] and gDNA from the transgenic rats themselves were used as standards.
ELISA for Anti-FCS Immunoglobulin G
The assays were performed as previously described [27]. Immunoglobin standards for the assays were purified from the serum samples derived from the experimental animals using a modification of an affinity protocol previously described [43].
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
|
Growth of rMSCs Is Inhibited in Heterologous Serum Unless It Is Supplemented with Growth Factors
We also examined the growth kinetics of rMSCs (n = 2) cultured in 20% FCS, 20% heterologous rat serum, 10% FCS, or 10% heterologous rat serum that was supplemented with 10 ng ml–1 EGF and with the lower concentration of 1 ng ml–1 bFGF (ARS+) (Fig. 2A, 2B). Unlike hMSCs, rMSCs do not grow well in 10% species-specific serum supplemented with 10 ng ml–1 EGF and 10 ng ml–1 bFGF but do grow well in 10% species-specific serum supplemented with 10 ng ml–1 EGF and 1 ng ml–1 bFGF (ARS+) (data not shown). In contrast to the response of hMSCs cultured in 20% heterologous human serum, for both rMSC donors, cell growth in 20% FCS was significantly greater than cell growth in medium containing 20% heterologous rat serum (Fig. 2A, 2B). Cell growth was also significantly increased when rMSCs were cultured in ARS+ as compared with growth in 20% heterologous serum or 20% FCS (Fig. 2A, 2B).
|
-MEM, Dulbecco's modified essential medium), 20% FCS, FCS+, 20% heterologous AHS, or 10% heterologous adult human serum supplemented with 10 ng ml–1 EGF and 10 ng ml–1 bFGF (AHS+) (n = 2). Assaying fFCS contamination every 2 days, we observed that a significant amount of fFCS contamination was removed in 2 days, and further reduction occurred by 6 days (Fig. 3A, 3B). Incubation in either 20% heterologous AHS or heterologous AHS+ resulted in removal of fFCS contamination that was not significantly different from reduction in medium containing unlabeled 20% FCS or FCS+ (Fig. 3A, 3B). Similar to incubation in autologous human serum, growth of hMSCs in heterologous human serum for 6 days resulted in removal of 99.99% of FCS contamination (from more than 120 pg per cell to less than 0.5 pg per cell) (Fig. 3A, 3B).
|
|
Differentiation Potential of hMSCs Grown in Human Serum
To determine whether growth in human serum could alter the differentiation capacity of hMSCs as compared with growth in FCS, we performed quantitative assays of bone formation (mineralization) and fat formation (lipid production) during periods of 40 and 30 days, respectively. As assayed by Alizarin Red S staining, there was no significant difference in mineral (Ca2+) deposition between hMSCs grown in 20% AHS versus 20% FCS (Fig. 5A). The addition of 10 ng ml–1 EGF and 10 ng ml–1 bFGF to culture medium, although stimulating cell growth, resulted in a significant decrease in hMSC mineral production after 20 days for cells grown in either AHS+ or FCS+ (Fig. 5A).
|
In Vivo Tests of Cell Survival in Fibrin Constructs
To test the in vivo viability of the rMSCs grown under various serum conditions, an engraftment assay was employed based on the subcutaneous implantation of the cells encapsulated in coagulated plasma fibrin. MSCs were initially expanded in FCS and then transferred to ARS+, ARS, or FCS for a further 5 days. The cells were then recovered by trypsinization and mixed with citrated rat plasma. Upon addition of thromboplastin C and calcium, the plasma coagulated with the cells. The appropriate growth medium was added to the constructs for further culture. Interestingly, in the presence of medium containing FBS, ARS, or ARS+, the MSCs caused the construct to shrink and become a dense, compact structure after approximately 4 days (Fig. 5C). When the constructs were cultured in the presence of medium with adipogenic or osteogenic supplements, the constructs became flat, laminar structures that were durable and could be manipulated easily with forceps (Fig. 5C; osteo or adipo). Upon microscopic inspection, it was apparent that the MSCs had spread within the constructs and formed a complex meshwork of processes (Fig. 5D) that formed after a few hours and became progressively complex over 7 days. Extraction of gDNA and quantification confirmed that proliferation occurred within the constructs in all media tested. ARS+ medium consistently provided the best proliferative conditions (Fig. 5E).
To examine the viability of the fibrin constructs in vivo, 20-mm-diameter constructs containing 300,000 GFP rMSCs were synthesized in adipogenic medium and cultured for 7 days in the presence of ARS, ARS+, or FCS. Adipogenic medium was chosen to preserve the shape of the construct and to reduce the tendency of the cells to differentiate into mineralizing tissue. The constructs were implanted into Sprague-Dawley rats subcutaneously, between the scapulae. There were no complications resulting from implantation, and the incisions healed after approximately 1 week. After 14 days, new constructs were reimplanted at the same site, this time containing 106 MSCs. Similarly, the constructs were well received by the hosts, and the implantation site healed after approximately 1 week. After 14 days, the implantation sites were removed and subjected to either DNA extraction for evaluation of cell number or immunohistochemistry and histology.
When the removed implants were examined macroscopically, the constructs were integrated into the surrounding tissue. Upon histological inspection, the fibrin could be readily visualized. Implants prepared using FCS, and to a lesser extent ARS, often became completely mineralized and stained densely with Alizarin Red S (Fig. 5F). In contrast, all but one of the constructs cultured in ARS+ did not mineralize, and in the instance where it was detectable, the maximal degree of calcification was less than 5% of the total volume (Fig. 5F). This is an observation consistent with the ex vivo differentiation data (Fig. 5A) indicating that the ARS+ suppressed mineralization of the constructs.
Immunohistochemical staining of the constructs for GFP confirmed the presence of many rMSCs surrounding the site of the implanted constructs that had been cultured in ARS and ARS+ (Fig. 6). The cells cultured in heterologous ARS or ARS+ retained their spindle-shaped morphology in vivo, but most had migrated to the periphery of the implant and had integrated into the surrounding host tissue (Fig. 6A–6C). In some cases, the fibrin vector was completely clear of rMSCs, and all of them had migrated into the surrounding host tissue (data not shown). Numerous host lymphocytes that stained with an antibody against monocytes and macrophages were identified within the construct but did not appear to be attacking the MSCs grown in ARS or ARS+ (Fig. 6D). Because the macrophages/monocytes were detected in all of the constructs from all three groups and the cells were not seen to participate in the destruction of MSCs, it is possible that the monocyte/macrophage response was directed against the construct itself rather than the cells. MSCs that had migrated out of the construct labeled with antibodies against fibronectin (a fibroblast marker) and appeared to be engaged in helping to heal the host wound (Fig. 6E). At other sites outside the construct, migrating transplanted MSCs were negative for fibronectin and appeared instead to be associated with vascular elements (Fig. 6F). In agreement with the PCR ELISA data, only one of the implants from cells cultured in FCS contained cells that were identified by the GFP antibody (data not shown and Fig. 7).
|
|
A PCR ELISA-based quantification assay was employed to measure the degree of rMSC engraftment based on the presence of the eGFP gene. DNA was extracted from the implants, and a portion of the gene encoding 28S ribosomal RNA or eGFP was amplified in the presence of DIG-labeled deoxy nucleotides. The resultant fragments were denatured in alkali and renatured in the presence of a biotinylated oligonucleotide probe coding for a sequence corresponding to an internal stretch of the amplicon. The heteroduplexes were then immobilized on streptavidin-coated microtiter plates, and the DIG-labeled fragments were quantified by immunodetection. Using GFP rat gDNA containing an eGFP-encoding construct as a standard, the number of eGFP copies in the gDNA extracted from the implants could be quantified and related to the total DNA defined by the 28S ribosomal signal. The eGFP-labeled rMSCs could be detected in all of the explants containing constructs cultured in medium containing ARS or ARS+, but the degree of engraftment was variable (Fig. 7B), ranging from approximately 10 to 300 copies of eGFP per µg of recovered DNA (ARS n = 5, ARS+ n = 6). There was no significant difference between the viability of engrafted rMSCs between the ARS or ARS+ groups. In the case of the FCS-treated constructs, the range of engrafted cells was approximately 0.2 to 1 copies of eGFP per µg of recovered DNA for five of six animals (Fig. 7B), measurements that were very close to the threshold of the assay. The remaining animal from this group harbored 240 eGFP copies per µg of recovered DNA, and the reason for such high engraftment compared with the other animals in the FCS group is unclear.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
Transplantation and survival of rMSCs in vivo demonstrates that growth of MSCs in medium containing species-specific serum can improve the probability of graft success probably by virtue of reduced immunogenicity of the cells. Furthermore, ARS+ prevents undesirable osteogenic differentiation of the MSCs after implantation. We have not determined whether growth in medium supplemented with EGF and bFGF promotes specification down other cell lineages, although adding the supplements to either FCS or AHS significantly improved the adipogenic potential of the cells. MSCs cultured in ARS and ARS+ survived and migrated from the constructs and appeared to engage in host wound repair both as fibronectin-positive fibroblasts and as other unidentified cell types. As expected, host-derived lymphocytes were present at the injury site but did not attack the MSCs grown in heterologous species-specific serum. Early innate immune rejection of implanted cells has been widely documented in the literature, even in immune compromised transplant models, but these observations are generally made when the implanted cells are considerably mismatched with the host (e.g., after xenotransplantation) [44, 45]. Graft rejection has also been documented in mice in which the cells and the host were mismatched for major histocompatibility complex (MHC) [46]. In this particular study, erythropoietin-expressing MSCs were rejected from MHC-mismatched hosts by a combination of innate and acquired immunity. In the case of this study, all of the MSCs were derived from Sprague-Dawley rats that are a genetically similar, but outbred, strain of rat and therefore could conceivably be mismatched for MHC antigens. This would be predicted to account for the destruction of many MSCs in the constructs but could not account for the increased probability of graft success when the cells and constructs were prepared in species-specific serum. Furthermore, migration of the MSCs out of the construct was observed, a factor that also could conceivably lead to a reduction of the number of detectable MSCs. The presence of a macrophage/monocyte response in all of the types of construct tested also suggests that the monocytes/macrophages may be mobilized against the material of the construct rather than to the cells themselves. Clotted fibrin is a known adhesion and survival factor of macrophages in vivo [47].
In contrast with the constructs grown in species-specific serum, all but one of the constructs cultured in FCS were destroyed by the host. Because the monocyte/macrophage response was universal across all three of the test groups, the greater frequency of graft failure in the FCS test group was probably mediated by an adaptive humoral response given that we detected antibodies against FCS in the blood of all of the animals we assayed that received FCS-cultured cells. Nevertheless, it is not unreasonable to suggest that the increased success of the engrafted constructs containing growth factor-expanded cells may also be due to enhanced viability through nonimmunological mechanisms. For instance, MSCs treated with growth factors and then extensively expanded may be susceptible to cytogenetic aberrancies or telomerase-mediated alterations in cell cycle regulation. Cytogenetic aberrancies, however, are unlikely; in this series of in vivo experiments, the MSCs were at passage 2–3 for a maximum of 10 days. Regardless of the presence of growth factors in the medium, the probability of a malignant cytogenetic aberrancy occurring in this study as well as with those aberrancies reported in Spees et al. [27] is not likely given that this is a very short duration for an aberrancy to occur and then to be selected for. Indeed, based on the proliferation data in this study, 10 days of culture in growth factor-supplemented medium can propagate a maximum of only nine cell doublings. In contrast, the presence of bFGF in growth medium has been documented to lead to enrichment of MSCs with longer telomere lengths even over very short periods of culture through clonal selection rather than enhanced telomerase activity [48]. Telomerase activity has been found to be insignificant in MSCs even after growth factor treatment [49]. In agreement with these observations, the MSCs treated by AHS+ in the study by Spees et al. [27] were found not to express telomerase upon microarray transcriptome analysis. It is likely, therefore, that the in vivo viability of the MSCs cultured in growth factors may be due to longer inherent telomere lengths but not malignant aberrancies at the level of telomerase or the chromatin.
|
SUMMARY |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
|
DISCLOSURES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionSummaryDisclosuresAcknowledgmentsReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  D. J. Weiss, J. K. Kolls, L. A. Ortiz, A. Panoskaltsis-Mortari, and D. J. Prockop Stem Cells and Cell Therapies in Lung Biology and Lung Diseases Proceedings of the ATS, July 15, 2008; 5(5): 637 - 667. [Full Text] [PDF]
|
|
|
|
 |
|
 F. Locatelli, R. Maccario, and F. Frassoni Mesenchymal stromal cells, from indifferent spectators to principal actors. Are we going to witness a revolution in the scenario of allograft and immune-mediated disorders? Haematologica, July 1, 2007; 92(7): 872 - 877. [Full Text] [PDF]
|
|
|
|
 |
|
 F. Mannello and G. A. Tonti Concise Review: No Breakthroughs for Human Mesenchymal and Embryonic Stem Cell Culture: Conditioned Medium, Feeder Layer, or Feeder-Free; Medium with Fetal Calf Serum, Human Serum, or Enriched Plasma; Serum-Free, Serum Replacement Nonconditioned Medium, or Ad Hoc Formula? All That Glitters Is Not Gold! Stem Cells, July 1, 2007; 25(7): 1603 - 1609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Heiskanen, T. Satomaa, S. Tiitinen, A. Laitinen, S. Mannelin, U. Impola, M. Mikkola, C. Olsson, H. Miller-Podraza, M. Blomqvist, et al. N-Glycolylneuraminic Acid Xenoantigen Contamination of Human Embryonic and Mesenchymal Stem Cells Is Substantially Reversible Stem Cells, January 1, 2007; 25(1): 197 - 202. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
