Stem Cells
Vol. 24 No.
11
November 2006, pp.
2406
-2411
doi:10.1634/stemcells.2005-0587; www.StemCells.com
© 2006 AlphaMed Press
TISSUE-SPECIFIC STEM CELLS |
The Simultaneous Treatment of MMP-2 Stimulants in Retinal Transplantation Enhances Grafted Cell Migration into the Host Retina
Takuya Suzukia,
Michiko Mandaib,
Masayuki Akimotob,
Nagahisa Yoshimuraa,
Masayo Takahashib
aDepartment of Ophthalmology and Visual Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan;
bDepartment of Experimental Therapeutics, Translational Research Center, Kyoto University Hospital, Kyoto, Japan
Key Words. MMP-2 • Concanavalin A • 17 ß-Estradiol • Retinal transplantation
Correspondence: Michiko Mandai, M.D., Ph.D., Department of Experimental Therapeutics, Translational Research Center, Kyoto University Hospital, Kyoto 606-8507, Japan. Telephone: +81-75-751-4717; Fax: +81-75-751-4731; e-mail: manf{at}kuhp.kyoto-u.ac.jp
Received on November 23, 2005;
accepted for publication on June 27, 2006.
 |
ABSTRACT
|
|---|
The success of functional retinal cell transplantation has been limited by the low efficiency of the transplanted cell integration into the host retina. Given that the extracellular matrix (ECM) is thought to inhibit entry and axonal outgrowth of grafted neural cells into the host retina, modulation of the ECMs in the host environment may overcome this limitation. Here, we demonstrate that matrix metalloprotease-2 (MMP-2) expression is associated with the high migratory potential of adult rat hippocampus-derived neural stem cells compared with retinal progenitor cells. In addition, MMP-2, as well as its reported inducers concanavalin A and 17ß-estradiol, can trigger the migration of retinal progenitor cells into explanted retinas. Inhibitors of MMP-2 suppressed these effects. Intense cell migration is not required for photoreceptor transplantation; however, the environment that allows the transplanted cells to integrate is most important. Migration of the transplanted cells is a good index of the acceptance of grafted cell of the host tissue. Strategies modulating the environment by MMP-2 stimulation may provide an advance in the development of retinal transplantation.
 |
INTRODUCTION
|
|---|
Neural cell transplantation is a promising therapeutic option to replace dysfunctional cells in degenerative diseases of the central nervous system (CNS), including retina. Retinal transplantation, however, has achieved only limited success as yet [19]. Successful retinal transplantation requires incorporation of the graft cells, proper synapse formation between host and grafted neural cells, and long-term survival of the functional grafted cells.
The primary obstacle in retinal transplantation has been poor incorporation of the grafted cells into the retina, the initial step in transplantation. Kinouchi et al. recently demonstrated that elimination of the intermediate filaments of reactive Müller cells or astrocytes within the retina permitted neuronal integration in retinal transplantation of glial fibrillary acidic protein (GFAP)/vimentin/ mice [9]. This result suggested that removal of the extracellular matrix (ECM) barrier produced by reactive glial cells in the damaged host retina is important in encouraging the acceleration of graft cell migration.
A member of the matrix metalloproteinases (MMPs), a family of zinc-dependent proteases that can degrade components of the ECM, is a potential candidate for this purpose [10, 11]. MMP expression is associated with tumor invasion and metastatic potential [1012]. MMPs also contribute to oligodendrocyte neurite outgrowth in the CNS or axonal growth in peripheral nerves by inhibition of factors, such as chondroitin sulfate proteoglycan, and modulation of the ECM. In previous studies, we observed the migration and incorporation of adult rat hippocampus-derived neural stem cells (AHSCs) (clone PZ5) into the developing retina and into the damaged retinas of adult rats [1316]. Although incorporated AHSCs mimic retinal cells morphologically, they do not express retinal cell markers after settlement [1719]. In contrast, retinal progenitor cells express retinal markers after transplantation, but the efficiency of grafted cell incorporation into the host retina is too low for practical use in transplantation [20, 21].
In this study, we showed for the first time that MMP-2 might be responsible for the invasive nature of the grafted progenitor cells and that the manipulation of host environment with MMP-2 or its stimulator facilitate the migration of retinal progenitor cells into explanted retinas. Although the photoreceptors exist in the outermost layer of the retina, the transplanted photoreceptor cells should be incorporated with host retina and extend their processes into it. To evaluate this ability of integration, we adapted the migration ratio of the transplanted cells as an index.
 |
MATERIALS AND METHODS
|
|---|
Animals
All experimental procedures in this study adhered to the Guidelines for Animal Experimentation of Kyoto University (Kyoto, Japan). Animals were maintained in a constant environment on a 14/10-hour light-dark cycle. Animals were provided with water and food ad libitum.
Reverse Transcription-Polymerase Chain Reaction
Total RNA was isolated from both embryonic day 19 (E19) retina of Fisher rats and cultured AHSCs using the guanidine isothiocyanate-based TRIzol reagent (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). First-strand cDNA was synthesized using a First-Strand cDNA Synthesis Kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK, http://www.gehealthcare.com) in accordance with the manufacturer's protocol. The polymerase chain reaction (PCR) was performed with Advantage 2 Taq polymerase (Clontech, Mountain View, CA, http://www.clontech.com) and the following primers:
MMP-2: TGCACCATCGCCCATCATCAAGTT (sense),
AAGGCCCGAGCAAAAGCATCATCC (antisense);
MMP-7: TTGGGGGACTGCAGACATCATAAT (sense),
GCTCAGGAAGGGCGTTTGCTCAT (antisense);
MMP-9: GCCCACAGCTCCTCCCACTATG (sense),
TTGCGCCCAGAGAAGAAGAAAATC (antisense);
RX: GCTACTCGCCCCTGCTATCC (sense),
AGGGCGGTGGCGGCGTGTA (antisense); and
PAX6: CCGGGAAAGACTAGCAGCCAAAAT (sense),
TGTGCGGAGGGGTGTAGGTATCAT (antisense).
In the PCRs, an initial denaturation at 94°C (1 minute) was followed by amplification with 28 cycles of denaturation at 94°C (30 seconds), annealing at 58°C (30 seconds), and extension at 68°C (30 seconds).
Coculture of Retinal Progenitor Cells with Retinal Explant
Retinal explant cultures were performed as described [22, 23]. Briefly, eyes of adult Fisher rats were enucleated (Shimizu Laboratory Supplies, Kyoto, Japan, http://web.kyoto-inet.or.jp/people/simizu/index.htm); each neural retina was removed from the remaining tissue and placed on a Millicell-CM chamber filter (30-mm diameter, 0.4-µm culture plate insert; Millipore, Billerica, MA, http://www.millipore.com) with the ganglion cell layer facing up. The Millicell-CM chamber filter was then moved to a six-well culture plate (Millipore), each well of which contained 1 ml culture medium (50% minimum essential medium with HEPES [Invitrogen], 25% Hanks' balanced salt solution [Invitrogen], 25% heat-inactivated horse serum, 200 µM L-glutamine, and 5.75 mg/ml glucose) with the following additives when indicated: active MMP-2 (ex vivo MMP-2 group; Chemicon, Temecula, CA, http://www.chemicon.com), 20 µg/ml concanavalin A (Con A) (ex vivo Con A group), 20 µg/ml Con A and MMP-2 inhibitor (ex vivo Con A/ MMP-2 inhibitor group), 1010 M 17ß-estradiol (E2) (ex vivo E2 group), 1010 M E2 and MMP-2 inhibitor (ex vivo E2/MMP-2 inhibitor group), 20 µg/ml Con A and 1010 M E2 (ex vivo Con A/E2 group), 20 µg/ml Con A, 1010 M E2, MMP-2 inhibitor (ex vivo Con A/E2/MMP-2 inhibitor group), 20 µg/ml MMP-2 inhibitor (ex vivo MMP-2 inhibitor group), or no additional substances (control group). For ex vivo transplantation, retinal cells from P0-P2 green fluorescent protein (GFP) transgenic mice (the kind gift of M. Okabe, Osaka University, Osaka, Japan) were dissociated using the Papain Dissociation System (Worthington Biochemical Corporation, Lakewood, NJ, http://www.worthington-biochem.com). Two microliters of cell suspension (1.0 x 105 cells per microliter) were placed between the host retina and the chamber filter (subretinal space). Explants were cultured at 34°C in 5% CO2, with a change of media every other day; samples were harvested and processed for histology approximately 1 week later.
Tissue Processing
To prepare retinal sections, animals were sacrificed with an overdose of pentobarbital sodium 4 weeks after surgery. Animals were perfused transcardially first with phosphate-buffered saline (PBS), followed by 4% paraformaldehyde (PFA) (Merck, Darmstadt, Germany, http://www.merck.com) in 0.1 M phosphate buffer. The posterior segments of the enucleated eyes were immersed in fresh 4% PFA at 4°C for 16 hours, then in 25% sucrose-PBS for cryoprotection. After being embedded in an optimal cutting temperature compound (Bayer Corp., Emeryville, CA, http://www.bayer.com), consecutive 1216-µm frozen sections were generated on a cryostat.
Immunohistochemistry
After washing in PBS, sections were preincubated in blocking solution (PBS containing 20% skim milk and 0.3% Triton X-100) for 30 minutes, then incubated overnight at 4°C with one of the following antibodies diluted as specified in 5% skim milk and 0.3% Triton X-100 in PBS (staining buffer): mouse or rabbit anti-GFP antibody (1:500; Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com). Subsequent immunofluorescence staining used goat anti-mouse immunoglobulin G (IgG) (H+L) (AlexaFluor 488; Molecular Probes Inc.) or goat anti-rabbit IgG (H+L) (AlexaFluor 594; Molecular Probes Inc.), as appropriate, each diluted 1:500 in the staining buffer. GFP was visualized either directly or indirectly by staining using mouse or rabbit anti-GFP (1:500; Molecular Probes Inc.).
Tissue Analysis
Sections containing cocultured cells were examined with a laser-scanning confocal microscope (Leica Microsystems GmbH, Wetzlar, Germany, http://www.leica-microsystems.com). Cells were counted within an average of every 10th section, sampled across the entire host retina. Each experiment was performed in three retinal explants (n = 3). The number of GFP+ cells migrating into the host retina was compared with the total number of GFP+ cells in each section to give the percentage of cells migrating into the host retina. The numbers of counted cells are presented as means ± SD. All of the group data were subjected to the Student's t test. p values less than .05 were considered to be statistically significant.
 |
RESULTS
|
|---|
The Function of MMP-2 Expression by AHSCs in Cell Migration
Of all of the MMPs examined by preliminary reverse transcription-PCR analysis, only MMP-2 was upregulated in AHSCs in comparison with the levels observed in embryonic retinal cells (E19) (Fig. 1). Neither MMP-7 nor MMP-9 mRNA was expressed in both cell types (data not shown).

View larger version (28K):
[in this window]
[in a new window]
|
Figure 1. The secretion of MMP-2 from AHSCs is important in the migratory plasticity of retinal and/or retinal progenitor cells transplanted into a host retina. (A): Reverse transcription-polymerase chain reaction (RT-PCR) analysis of retinal cells and AHSCs. Total RNA was extracted from both E19 retinas of C57Bl/6 mice and cultured AHSCs cells, then analyzed by RT-PCR. (B, C): Sections of retinal explants untreated (B) or treated with an MMP-2 inhibitor (C). One week after cell transplantation, the explants were examined by immunohistochemistry using an anti-ß-gal (green). Note the extensive migration of AHSCs (green) into the retina (B) in comparison with that seen in (C). Scale bars = 20 µm. Abbreviations: AHSC, adult rat hippocampus-derived neural stem cell; E19, embryonic day 19; GCL, ganglion cell layer; INL, inner nuclear layer; MMP-2, matrix metalloprotease-2; ONL, outer nuclear layer; SUB, subretina.
|
|
To investigate the role of MMP-2 in the migratory capacity of AHSCs during retinal transplantation, we examined whether exogenous MMP-2 inhibitors affected the migration of AHSCs into the host retina using retinal organ culture. Seven days after ex vivo transplantation, AHSCs migrated well into the entirety of the host retina. In contrast, addition of an MMP-2 inhibitor abrogated AHSCs migration into the host retina nearly completely. This result indicates that MMP-2 functions in the migration of AHSCs (Fig. 1).
Effects of MMP-2 on Retinal Progenitor Cell Migration in Retinal Explants
Next, we used dissociated retinal cells derived from newborn GFP+ mice as donor cells to investigate whether exogenous MMP-2 stimulates cell migration into the host retina in ex vivo transplantation. In the ex vivo MMP-2 group, 18.43% ± 1.60% of the total GFP+ cells migrated into host retina (Fig. 2), a significantly greater proportion than observed in the ex vivo control group (2.46% ± 0.54%, p < .01) (Fig. 2). We then examined the effect of Con A, E2, and the combination of both stimuli on cell migratory potential. These substances enhance MMP-2 activity by protein activation and transcriptional upregulation, respectively. The application of Con A, E2, or both increased the percentages of migrating cells (15.68% ± 2.86%, 12.88% ± 2.29%, and 17.72% ± 2.43%, respectively; Figs. 2 and 3). These increases were statistically significant (p < .05, ex vivo Con A group vs. ex vivo control group; p < .01, ex vivo E2 group vs. ex vivo control group). Although there was no additive effect on the percentage of the migrated cells when the Con A and E2 treatments were given together, the cells increasingly migrated into the inner retina after combined treatment (Fig. 3D; Table 1).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 2. The effect of exogenous MMP-2 on the migratory plasticity of retinal and/or retinal progenitor cells. (A, B): Sections of retinal explants in the absence (A) or presence (B) of active MMP-2. One week after cell transplantation, explants were subjected to immunohistochemistry labeled with anti-green fluorescent protein antibody (green). The transplanted cells in the MMP-2 group (B) exhibited improved migration in comparison with the control group (A). Scale bars = 20 µm. (C): The number of transplanted cells in each group which migrated to the host retina were quantified 1 week after transplantation. In comparison with the control group, the MMP-2 group exhibited a significant increase in the ratio of transplanted cells that migrated into the host retina. ** p < .01 versus control. Error bars indicate mean ± SD. Abbreviations: GCL, ganglion cell layer; INL, inner nuclear layer; MMP-2, matrix metalloprotease-2; ONL, outer nuclear layer; SUB, subretina.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Figure 3. The effect of MMP-2 inducers on the migratory plasticity of green fluorescent protein+ retinal and/or retinal progenitor cells. (A, B): Sections of retinal explants in the absence (A) or presence of Con A (B), E2 (C), or the combination (D) treatment. One week after cell transplantation, explants were subjected to immunohistochemistry. Scale bars = 20 µm. (E): The transplanted cells in each group which migrated into the host retina were quantified at 1 week after transplantation. Significant differences between the control and treatment groups were identified by Student's t test. * p < .05, ** p < .01 versus control. Error bars indicate mean ± SD. Abbreviations: Con A, concanavalin A; E2, 17ß-estradiol; GCL, ganglion cell layer; INL, inner nuclear layer; MMP-2, matrix metalloprotease-2; ONL, outer nuclear layer; SUB, subretina.
|
|
To investigate whether these effects were mediated by MMP-2, we added an MMP-2 inhibitor into these ex vivo transplantation conditions (Fig. 4; Table 1). When an MMP-2 inhibitor was added, the ratio of migrated cells in each condition decreased (7.54% ± 0.55%, 5.82% ± 1.06%, and 11.71% ± 1.66% for the ex vivo Con A/MMP-2 inhibitor, ex vivo E2/MMP-2 inhibitor, and ex vivo Con A/E2/MMP-2 inhibitor groups, respectively).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 4. Altered migratory plasticity of green fluorescent protein+ retinal and/or retinal progenitor cells after treatment with an MMP-2 inhibitor in the presence of Con A, E2, or the combination. (AD): Sections of retinal explants after treatment with an MMP-2 inhibitor alone (A), Con A and an MMP-2 inhibitor (B), E2 and an MMP-2 inhibitor (C), or Con A, E2, and an MMP-2 inhibitor (D). One week after cell transplantation, explants were subjected to immunohistochemistry. Note the reduction in migratory plasticity of the transplanted cells in the group with MMP-2 inhibitor in comparison with those without it. Scale bars = 20 µm. (EH): Quantification of the numbers of transplanted cells in each group which migrated into the host retina at 1 week after transplantation. Statistical significance: * p < .05, Con A/MMP inhibitor group versus Con A group (F) and E2/MMP inhibitor group versus E2 group (G). Data are expressed as the means ± SD. Abbreviations: Con A, concanavalin A; E2, 17ß-estradiol; GCL, ganglion cell layer; INL, inner nuclear layer; MMP-2, matrix metalloprotease-2; ONL, outer nuclear layer; SUB, subretina.
|
|
 |
DISCUSSION
|
|---|
To achieve the functional recovery of a damaged CNS by cell transplantation, the donor transplant cells must migrate and integrate into the neural circuit at the damaged site. Grafted stem cells appear to have the ability to migrate toward damaged sites, taking their cue from a chemoattractant produced at the site [24, 25]. Degradation of the ECM appears to be necessary for the grafted cells to integrate into a host tissue packed with cells. We observed that the migration ratio (percentage of transplanted cells entering the retina) differs significantly among the various types of neural stem/progenitor cells. Prestoz et al. also observed this phenomenon, reporting that differences in integrin signaling contributed to the differential migratory abilities [26]. Thus, the migration of transplanted cells are significantly influenced by the ECM. The robust neuronal integration in retinal transplantation seen in GFAP/vimentin/ mice also supports this viewpoint [9].
MMPs are proteolytic enzymes that degrade ECM molecules, including collagen, fibronectin, laminin, and a variety of proteoglycans. These proteases have been widely implicated in tumor invasion and metastasis [1012]. Recently, the role of MMPs in the generation of the CNS and peripheral nervous system has been increasingly recognized. MMP-2 and MMP-9 expression increases at sites of peripheral nerve injury or degeneration and enhances neural promoting activity, partially by downregulating the chondroitin sulfate proteoglycan activity that may inhibit neural outgrowth [12, 13]. In the CNS, MMP-9 contributes to process outgrowth by oligodendrocytes in the initial phase of myelination that occurs during development or during remyelination after pathologic damage [14, 15]. The efficient migratory potential and axonal outgrowth of AHSCs hinted to us that factors degrading the ECM may facilitate the invasive nature of these cells. We found that the expression of MMP-2 is higher in AHSCs than in embryonic retinal progenitor cells. The migratory potential of AHSCs could be abrogated by treatment with an MMP2 inhibitor, indicating an important role for MMP-2 in the migration of AHSCs during retinal transplantation. In ex vivo transplantation, exogenous activation of MMP-2 enhanced the migration of retinal protenitor cells into the retinal explant, suggesting that the activation of MMP-2 in situ may trigger migration and enhance the incorporation of grafted cells into the host retina.
MMP-2 activity can be regulated at three levels: gene transcription, proenzyme activation by membrane-type metalloproteinases (MT-MMP), and inhibition by naturally occurring tissue inhibitors of metalloproteinases (TIMPs) [27]. Phorbol esters, interleukin-1, tumor necrosis factor-
, transforming growth factor ß-1, and E2 are all stimulants of MMP-2 gene transcription. Sp1, Sp3, AP-2, and Smad4 are transcription factors reported to upregulate MMP-2 mRNA levels [2832]. MMP-2 is initially expressed as an inactive proenzyme, which is activated by MT-MMP cleavage of the propeptide, rendering the enzyme fully active. TIMPs form a complex with both pro-MMP-2 and active MMP-2, which controls the rate of MMP-2 activation in a complicated manner [27].
The plant lectin Con A, a carbohydrate-binding protein, induces MT1-MMP expression, subsequently activating MMP-2 [33]. Pretreatment of myoblasts with Con A increased the intramuscular migration of transplanted myoblasts in an MMP-2-dependent manner [34, 35]. Con A was also implicated as a neuronal modulator, as the extracellular domains of many receptors for neurotransmitters, growth factors, or other neuromodulators are glycosylated, leading to ligation by lectins such as Con A [36, 37]. E2 regulates the expression of MMP-2 by activating estrogen receptors in a dose-dependent fashion in both in vivo and in vitro systems [31, 32]. In the CNS, E2 induces synaptogenesis in the hippocampus and dendritic spine formation in hippocampal neurons in a brain-derived neurotrophic factor-dependent pathway [38, 39].
In this study, the migratory activity of transplanted cells was enhanced by adding Con A, E2, or the combination to the culture medium; these effects could be significantly suppressed by the addition of an MMP-2 inhibitor. This result suggested that Con A and E2 may facilitate grafted cell migration by activating MMP-2 in situ. The fact that we did not observe any additive effects on the percentage of migrating cells after treatment with both stimuli indicates that both of these factors affect the same pathway. Interestingly, combined treatment resulted in a significantly different distribution of the migrated cells within the retinal explant, indicating the potential existence of an additive effect of these two factors on a pathway independent from MMP-2. Simultaneous treatment of retinal progenitor cells with Con A and E2 also enhanced the migration of grafted cells into the retinas of mice exhibiting retinal degeneration. This is the first report conclusively demonstrating that stimulation of MMP-2 activity can enhance the incorporation of grafted cells during neuronal transplantation.
The recovery of retinal function depends primarily on the efficiency of grafted cell integration into the host retina. Intense cell migration is not required for photoreceptor transplantation; however, the environment that allows the transplanted cells to integrate is most important. Migration of the transplanted cells is a good index of the acceptance of grafted cells of the host tissue. Strategies modulating the environment by MMP-2 stimulation may provide an advance in the development of retinal transplantation therapy.
 |
DISCLOSURES
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) Japan (the Leading Project).
 |
REFERENCES
|
|---|
- Ehinger B, Bergstrom A, Seiler M et al. Ultrastructure of human retinal cell transplants with long survival times in rats. Exp Eye Res 1991;53:447460.[CrossRef][Medline]
- Gouras P, Du J, Kjeldbye H et al. Long-term photoreceptor transplants in dystrophic and normal mouse retina. Invest Ophthalmol Vis Sci 1994;35:31453153.[Abstract/Free Full Text]
- Zucker CL, Ehinger B, Seiler M et al. Ultrastructural circuitry in retinal cell transplants to rat retina. J Neural Transpl Plast 1994;5:1729.[Medline]
- Aramant RB, Seiler MJ. Fiber and synaptic connections between embryonic retinal transplants and host retina. Exp Neurol 1995;133:244255.[CrossRef][Medline]
- Litchfield TM, Whiteley SJ, Lund RD. Transplantation of retinal pigment epithelial, photoreceptor and other cells as treatment for retinal degeneration. Exp Eye Res 1997;64:655666.[CrossRef][Medline]
- Seiler MJ, Aramant RB. Intact sheets of fetal retina transplanted to restore damaged rat retinas. Invest Ophthalmol Vis Sci 1998;39:21212131.[Abstract/Free Full Text]
- Ghosh F, Bruun A, Ehinger B. Graft-host connections in long-term full-thickness embryonic rabbit retinal transplants. Invest Ophthalmol Vis Sci 1999;40:126132.[Abstract/Free Full Text]
- Ghosh F, Johansson K, Ehinger B. Long-term full-thickness embryonic rabbit retinal transplants. Invest Ophthalmol Vis Sci 1999;40:133142.[Abstract/Free Full Text]
- Kinouchi R, Takeda M, Yang L et al. Robust neural integration from retinal transplants in mice deficient in GFAP and vimentin. Nat Neurosci 2003;6:863868.[CrossRef][Medline]
- Bergers G, Coussens L. Extrinsic regulators of epithelial tumor progression: Metalloproteinases. Curr Opin Genet 2000;10:120127.[CrossRef][Medline]
- Kleiner DE, Stetler-Stevenson WG. Matrix metalloproteinases and metastasis. Cancer Chemother Pharmacol 1999;43:4251.[CrossRef]
- Belien AT, Paganetti PA, Schwab ME. Membrane-type-1 matrix metalloprotease (MT1-MMP) enables invasive migration of glioma cells in central nervous system white matter. J Cell Biol 1999;144:373384.[Abstract/Free Full Text]
- Zuo J, Hernandez YJ, Muir D. Chondroitin sulfate proteoglycan with neurite-inhibiting activity is up-regulated following peripheral nerve injury. J Neurobiol 1998;34:4154.[CrossRef][Medline]
- Zuo J, Ferguson TA, Hernandez YJ. Neuronal matrix metalloproteinase-2 degrades and inactivates a neurite-inhibiting chondroitin sulfate proteoglycan. J Neurosci 1998;18:52035211.[Abstract/Free Full Text]
- Oh LY, Larsen PH, Krekoski CA et al. Matrix metalloproteinase-9/gelatinase B is required for process outgrowth by oligodendrocytes. J Neurosci 1999;19:84648475.[Abstract/Free Full Text]
- Uhm JH, Dooley NP, Oh LYS et al. Oligodendrocytes utilize a matrix metalloproteinase, MMP-9, to extend processes along an astrocyte extracellular matrix. Glia 1998;22:5363.[CrossRef][Medline]
- Takahashi M, Palmer TD, Takahashi J et al. Widespread integration and survival of adult-derived neural progenitor cells in the developing optic retina. Mol Cell Neurosci 1998;12:340348.[CrossRef][Medline]
- Young MJ, Ray J, Whiteley SJ et al. Neuronal differentiation and morphological integration of hippocampal progenitor cells transplanted to the retina of immature and mature dystrophic rats. Mol Cell Neurosci 2000;16:197205.[CrossRef][Medline]
- Nishida A, Takahashi M, Tanihara H et al. Incorporation and differentiation of hippocampus-derived neural stem cells transplanted in injured adult rat retina. Invest Ophthalmol Vis Sci 2000;41:42684274.[Abstract/Free Full Text]
- Akagi T, Haruta M, Akita J et al. different characteristics of rat retinal progenitor cells from different culture periods. Neurosci Lett 2003;341:213216.[CrossRef][Medline]
- Klassen HJ, Ng TF, Kurimoto Y et al. Multipotent retinal progenitors express developmental markers, differentiate into retinal neurons, and preserve light-mediated behavior. Invest Ophthalmol Vis Sci 2004;45:41674173.[Abstract/Free Full Text]
- Hatakeyama J, Kageyama R. Retrovirus-mediated gene transfer to retinal explants. Methods 2002;28:387395.[CrossRef][Medline]
- Akita J, Takahashi M, Hojo M et al. Neuronal differentiation of adult rat hippocampus-derived neural stem cells transplanted into embryonic rat explanted retinas with retinoic acid pretreatment. Brain Res 2002;954:286293.[CrossRef][Medline]
- Zhang H, Vutskits L, Pepper MS et al. VEGF is a chemoattractant for FGF-2-stimulated neural progenitors. J Cell Biol 2003;163:13751384.[Abstract/Free Full Text]
- Imitola J, Raddassi K, Park KI et al. Directed migration of neural stem cells to sites of CNS injury by the stromal cell-derived factor 1alpha/CXC chemokine receptor 4 pathway. Proc Natl Acad Sci U S A 2004;101:1811718122.[Abstract/Free Full Text]
- Prestoz L, Relvas JB, Hopkins K et al. Association between integrin-dependent migration capacity of neural stem cells in vitro and anatomical repair following transplantation. Mol Cell Neurosci 2001;18:473484.[CrossRef][Medline]
- Yong VW, Krekoski CA, Forsyth PA et al. Matrix metalloproteinases and diseases of the CNS. Trends Neurosci 1998;21:7580.[CrossRef][Medline]
- Matsumoto K, Abiko S, Ariga H. Transcription regulatory complex including YB-1 controls expression of mouse matrix metalloportinase-2 gene in NIH3T3 cells. Biol Pharm Bull 2005;28:15001504.[CrossRef][Medline]
- Lin HY, Yang Q, Wang HM et al. Involvement of SMAD4, but not of SMAD2, in transforming growth factor-beta1-induced trophoblast expression of matrix metalloproteinase-2. Front Biosci 2006;11:637646.[Medline]
- Hanemaaifer R, Koolwijk P, Le Clercq L et al. Regulation of matrix metalloproteinase expression in human vein and microvascular endothelial cells. Effects of tumour necrosis factor alpha, interleukin 1 and phobol ester. Biochem J 1993;296:803809.[Medline]
- Guccione M, Silbiger S, Lei J et al. Estradiol upregulates mesangial cell MMP-2 activity via the transcription factor AP-2. Am J Physiol Renal Physiol 2002;282:164169.
- Marin-Castaño ME, Elliot SJ, Potier M et al. Regulation of estrogen receptors and MMP-2 expression by estrogens in human retinal pigment epithelium. Invest Ophthalmol Vis Sci 2003;44:5059.[Abstract/Free Full Text]
- Jiang A, Lehti K, Wang X et al. Regulation of membrane-type matrix metalloproteinase 1 activity by dynamin-mediated endocytosis. Proc Natl Acad Sci U S A 2001;98:1369313698.[Abstract/Free Full Text]
- Ito H, Hallauer PL, Hastings KE et al. Prior culture with concanavalin A increases intramuscular migration of transplanted myoblast. Muscle Nerve 1998;21:291297.[CrossRef][Medline]
- Fahime EE, Torrente Y, Caron NJ et al. In vivo migration of transplanted myoblasts requires matrix metalloproteinase activity. Exp Cell Res 2000;258:279287.[CrossRef][Medline]
- Farmer LM, Hagmann J, Dagan D et al. Directional control of neurite outgrowth from cultured hippocampal neurons is modulated by the lectin concanavalin A J Neurobiol 1992;23:354363.
- Lin SS, Levitan IB. Concanavalin A: A tool to investigate neuronal plasticity. Trends Neurosci 1991;14:273277.[CrossRef][Medline]
- Kretz O, Fester L, Wehernberg U et al. Hippocampal synapses depend on hippocampal estrogen synthesis. J Neurosci 2004;24:59135921.[Abstract/Free Full Text]
- Murphy DD, Cole NB, Segal M. Brain-derived neurotrophic factor mediates estradiol-induced dendritic spine formation in hippocampal neurons. Proc Natl Acad Sci U S A 1998;95:1141211417.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. V. Johnson and K. R. Martin
Development and Characterization of an Adult Retinal Explant Organotypic Tissue Culture System as an In Vitro Intraocular Stem Cell Transplantation Model
Invest. Ophthalmol. Vis. Sci.,
August 1, 2008;
49(8):
3503 - 3512.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. D. Bull, G. A. Limb, and K. R. Martin
Human Muller Stem Cell (MIO-M1) Transplantation in a Rat Model of Glaucoma: Survival, Differentiation, and Integration
Invest. Ophthalmol. Vis. Sci.,
August 1, 2008;
49(8):
3449 - 3456.
[Abstract]
[Full Text]
[PDF]
|
 |
|