| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TISSUE-SPECIFIC STEM CELLS |
aRenal Section and
cDepartment of Histopathology, Division of Medicine, Imperial College London, Hammersmith Campus, London, United Kingdom;
bHistopathology Unit and
dMolecular Population Genetics Laboratory, Cancer Research UK, London Research Institute, London, United Kingdom
Key Words. Adult bone marrow stem cells • Mouse • Experimental models • Bone marrow transplantation
Correspondence: Evangelia Prodromidi, MSc, Renal Section, Division of Medicine, Imperial College London, Hammersmith Campus, Du Cane Road, W12 0NN, London, United Kingdom. Telephone: +44-20-8383-3936; Fax: +44-208-8383-2062; e-mail: evangelia.prodromidi{at}imperial.ac.uk
Received on April 9, 2006;
accepted for publication on July 11, 2006.
First published online in STEM CELLS EXPRESS July 27, 2006.
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
3 chain of collagen IV (Col43–/–) develop progressive glomerular damage leading to renal failure. The proposed mechanism is that podocytes fail to synthesize normal glomerular basement membrane, so the collagen IV network is unstable and easily degraded. We used this model to study whether bone marrow (BM) transplantation can rectify this podocyte defect by correcting the deficiency in Col43. Female C57BL/6 Col43–/– (–/–) mice were transplanted with whole BM from male wild-type (+/+) mice. Control female –/– mice received BM from male –/– littermates. Serum urea and creatinine levels were significantly lower in recipients of +/+ BM compared with those of –/– BM 20 weeks post-transplant. Glomerular scarring and interstitial fibrosis were also significantly decreased. Donor-derived cells were detected by in situ hybridization (ISH) for the Y chromosome, and fluorescence and confocal microscopy indicated that some showed an apparent podocyte phenotype in mice transplanted with +/+ BM. Glomeruli of these mice showed small foci of staining for 3(IV) protein by immunofluorescence. 3(IV) mRNA was detectable by reverse transcription-polymerase chain reaction and ISH in some mice transplanted with +/+ BM but not –/– BM. However, a single injection of mesenchymal stem cells from +/+ mice to irradiated –/– recipients did not improve renal disease. Our data show that improved renal function in Col43–/– mice results from BM transplantation from wild-type donors, and the mechanism by which this occurs may in part involve generation of podocytes without the gene defect.
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
The study of AS has been greatly assisted by the use of animal models. Models of the autosomal recessive type of AS have been developed in mice; they involve mutations of the murine Col43 gene [5–7]. Miner and Sanes [8] generated a mutation in the Col43 gene in 129Sv mice. Three exons of the noncollagenous 1 (NC1) domain were deleted in the targeting vector and replaced by a neo cassette [8]. This mutation was chosen because the NC1 domain is essential for assembly of collagen IV network [8]. More recently, Andrews et al. [7] described the same mutation on a C57BL/6 mouse background. In end-stage renal disease (ESRD), kidneys from both strains manifested the same histological findings: extensive glomerular damage, including a thickened GBM and fibrocellular material in Bowman's space, along with tubulo-interstitial fibrosis and inflammation. However, C57BL/6 Col43–/– mice showed a longer survival of up to 6 months, with later onset and slower advancement of renal disease than 129Sv Col43–/– mice, which survived up to 3 months [7].
The kidney has an intrinsic ability to regenerate tubular epithelium after injury. However, in recent years, a contribution from cells within the bone marrow (BM) has been recognized, an ability termed "plasticity" [9]. Numerous reports have shown that BM can be a source of cells contributing to regeneration of different renal cells especially after renal injury, including tubular epithelial [10–12], mesangial [13–15], and endothelial [16–18] cells. In some models, these BM cells can attenuate renal disease [19, 20]. Our group has already reported that glomerular podocytes can be BM-derived in vivo in the absence of tissue injury [21]. Moreover, mesenchymal stem cells (MSCs) isolated from mouse BM may be renotropic and capable of contributing to renal repair after acute renal failure caused by toxin administration [22, 23]. However, very little is known about whether BM transplantation could functionally benefit the injured kidney in genetic renal disease.
In this study, we investigated whether adult BM could contribute to regeneration of podocytes and improve renal disease in a mouse model of AS. Donor BM-derived cells and MSCs were identified in sex-mismatched BM-transplanted mice. Only cells from whole BM produced the 3 chain of collagen IV [3(IV)], which the recipient mice lacked, and led to improvement in disease phenotype. This study provides further evidence for the plasticity of adult whole BM towards glomerular epithelium and suggests that cell therapy may be a promising approach to treatment of inherited renal glomerular disease.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
3–/– mice has been described previously [8]. Male and female C57BL/6 Col43–/– mice were generated at Hammersmith Hospital, London, by initially crossing male C57BL/6 Col43+/– mice, kindly donated by Dr J. Miner (Washington University, St. Louis), with inbred female C57BL/6+/+ mice. Col43–/– animals were generated by intercrossing Col43+/– mice or Col43+/– with Col43–/– mice. Male C57BL/6+/+ littermates (6–8 weeks old) were used as BM donors in transplantation experiments. All mice were housed with free access to food and water and were kept in a specific pathogen-free environment, according to institutional guidelines.
BM and MSC Transplantation
Female C57BL/6 Col43–/– recipient mice (6–8 weeks old) were irradiated with 8 Gy to ablate their BM and were then immediately administered whole BM (107 cells) intravenously from male C57BL/6+/+ mice or Col43–/– controls. Cultured MSCs (5 x 105) from male wild-type (+/+) animals were transplanted together with female whole Col43–/– (–/–) BM (106 cells) into Col43–/– mice (n = 6). Details of the donor mice used, culture techniques, and extensive characterization of MSCs were described recently [24]. Following transplant, mice were housed in individually ventilated cages with acidified water and autoclaved diet for 20 weeks.
Polymerase Chain Reaction for Genotyping Col43 Mice
Mouse tail tip samples were digested with lysis buffer containing proteinase K (10 mg/ml) overnight at 55°C. Proteinase K was then inactivated by heating at 75°C for 15 minutes. Details of the primers and conditions used for the wild-type and Col43 PCRs are described by Miner and Sanes [8].
Proteinuria with Dipstick Analysis
Urine from mice was assessed for proteinuria by dipstick analysis (Bayer, Tarrytown, NY, http://www.bayerdiag.com). Results were graded by color development ranging from 0 to ++++.
Serum Urea and Creatinine Measurements
Blood samples were centrifuged at 5,000g for 10 minutes at 4°C, and the supernatant was stored at –80°C. Levels of both of these compounds were measured on an Olympus AU2700 analyzer (Olympus Diagnostics, London, http://www.olympus.co.uk/diagnostica) to assess the severity of renal disease. Urea was measured using Olympus urea reagent and an enzymatic method (urease and glutamate dehydrogenase). Creatinine was measured using Olympus creatinine reagent and a kinetic Jaffe method (alkaline picrate). All samples were analyzed in a single batch, so differences between groups are valid.
Histology
Kidney tissues from all animals were fixed in neutral-buffered formalin overnight and then transferred to 70% ethanol before being embedded in paraffin. For histological examination, 4-µm sections were stained with periodic acid-Schiff (PAS). Glomerular injury was assessed at an overall magnification of x200 using consecutive and nonoverlapping fields of PAS-stained specimens. The percentage of abnormal scarred glomeruli was estimated without knowledge of each experimental group.
Picrosirius Red
To quantify the degree of fibrosis in renal tissues, paraffin sections were stained with picrosirius red. Slides were quickly blot-dried, immersed in xylene, and mounted with DePeX (VWR International, Lutterworth, UK, http://www.wwr.com). Ten nonoverlapping fields, mainly in the cortex of each kidney were examined without knowledge of the experimental group under white or polarized light with an Olympus BX51 microscope. The area fraction of the staining, excluding blood vessels, was measured under polarized light using Image Pro Plus 5.0 software (Media Cybernetics U.K., Berkshire, U.K., http://www.mediacybernetics.co.uk). The mean fibrosis scores for each mouse represented the average score of the 10 fields examined.
DNA ISH (Y Chromosome)
To detect donor-derived cells in recipient kidneys, ISH for the Y chromosome was performed in chimeric mice. Tissue sections were incubated in 1 M sodium thiocyanate (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) for 10 minutes at 80°C, washed in phosphate-buffered saline (PBS), and then digested in 0.4% wt/vol pepsin (Sigma-Aldrich) in 0.1 M HCl for 10 minutes at 37°C. The reaction was quenched in 0.2% glycine in double concentration PBS, and the sections were then rinsed in PBS, post-fixed in 4% paraformaldehyde in PBS, dehydrated through graded alcohols, and air-dried. A fluorescein-isothiocyanate (FITC)-labeled mouse Y chromosome paint (1189-YMF-01; Cambio Ltd., Cambridge, U.K., http://www.cambio.co.uk) was used in the supplier's hybridization mix. The probe mixture was added to the sections, sealed under glass with rubber cement, heated to 60°C for 10 minutes, and incubated overnight at 37°C. Negative controls were incubated with the hybridization mix alone without the probe added. All slides were washed briefly in 0.5x standard saline citrate (SSC) and then twice again in 0.5x SSC for 5 minutes at 37°C. For indirect observation, slides were then washed with PBS and incubated with peroxidase-conjugated antifluorescein antibody (Boehringer Mannheim, Indianapolis, http://www.roche-applied-science.com) diluted 1:250 in PBS for 60 minutes at room temperature. Slides were developed with 3,3'-diaminobenzidine and 0.3% H2O2, counterstained with hematoxylin, and mounted in DePeX. For direct observation, 15 µl of Vectashield Hard Set mounting medium with 4',6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com) was added to the slides, which were coverslipped and then visualized under the microscope. Sections were examined using an Olympus BX61 epifluorescence microscope system with SmartCaptureX software (Digital Scientific, Cambridge, U.K., http://www.digitalscientific.co.uk) to generate composite images from multichannel monochrome captures. This technique allows clear visualization of structures within unstained formalin-fixed paraffin-embedded tissues by virtue of the autofluorescence present in several channels, and it allows the colocalization of the Y chromosome paint to be seen more clearly than in conventional microscopy. Images were also acquired in three channels with a Zeiss LSM 510 confocal microscope (Carl Zeiss Ltd., Hertfordshire, U.K., http://www.zeiss.co.uk). One channel revealed FITC fluorescence of the Y chromosome paint (green) and autofluorescence was also seen in red and infrared channels (blue). Approximately 20 optical sections were captured with a typical z-axis increment of 0.4 µm, and scans were presented as z-projections.
Immunofluorescence for 3(IV) Collagen
Freshly dissected kidneys were immersed in OCT compound and snap-frozen in isopentane. Six-micrometer sections were cut on a cryostat and fixed in cold acetone for 10 minutes. Sections were treated with KCl-HCl (1 M) for 10 minutes at room temperature. Rat monoclonal antibody H31 (a kind gift from Dr Y. Sado, Shigei Medical Research Institute, Shigei, Okayama, Japan) was used to stain specifically 3(IV) collagen [25]. After blocking in 10% goat serum (Dako U.K. Ltd., Ely, U.K., http://www.dako.co.uk), H31 diluted 1:10 in PBS containing 1% bovine serum albumin was applied for 1 hour at room temperature. After washing in PBS, FITC-conjugated goat anti-rat secondary antibody (55760; Cappel ICN Pharmaceuticals Inc., Aurora, OH, http://www.icnbiomed.com) diluted 1:50 in PBS containing 5% normal mouse serum was applied for 30 minutes at room temperature. Negative controls were incubated directly with the secondary antibody. Slides were then washed twice in PBS, mounted in Vectashield Hard Set medium, and examined under an Olympus BX61 fluorescence microscope using different filter cubes (DAPI, aqua, FITC, Cy3, and Cy5).
Reverse Transcription-PCR
The Col43–/– mouse was created by deleting three exons and introducing a Neo cassette [6]. To detect expression of the wild-type allele specifically, we carried out reverse transcription-polymerase chain reaction (RT-PCR) using a forward primer (AAACGTGCACATGGACAAGA) located within the first deleted exon, and a reverse primer (CTCAGAGCCTGCACTTGTGA) complementary to sequence 254–234 bases proximal to the stop codon, that would generate a 339-base pair (bp) product from wild-type mRNA and a 2,424-bp product from wild-type genomic DNA but would be unable to generate specific products from Col43–/– mouse mRNA or genome.
Kidney tissue (
50 mg) was homogenized in 1 ml of TRIzol reagent (Gibco, Paisley, U.K., http://www.invitrogen.com) using a 2-ml glass-Teflon homogenizer (VWR International). RNA from homogenized samples was extracted by a chloroform/isopropanol protocol and washed with 70% ethanol. Genomic DNA contamination was removed using an RNeasy mini kit (Qiagen, Crawley, U.K., http://www1.qiagen.com) according to the manufacturer's instructions. Optical densities were measured in a spectrophotometer to determine final RNA concentration. For RT-PCR, oligo(dT)-primed cDNA was reverse transcribed from 50 µg of total RNA. One µl of Superscript II reverse transcriptase (Invitrogen, Paisley, U.K., http://www.invitrogen.com) was added to the final reaction mixture. A control PCR for the housekeeping gene mouse ß-actin was conducted with the following primers: mouse ß-actin forward (F), 5'-CGAGCGTGGCTACAGCTTCA-3'; mouse ß-actin reverse (R), 5'-GAGCCACCGATCCACACAGA-3'. The primers used for Col43 were as follows: Col43 F, 5'-AAACGTGCACATGGACAAGA-3'; Col43 R, 5'-CTCAGAGCCTGCACTTGTGA-3'. A 50-µl reaction was set up and run for 40 cycles at 94°C for 45 seconds, 60°C for 45 seconds, and 72°C for 1 minute.
mRNA ISH
The 339-bp amplicon generated by RT-PCR was cloned into pGEM-3Z vector (Promega, Madison, WI, http://www.promega.com). This was linearized with BamHI to make a riboprobe capable of detecting only wild-type 3(IV) mRNA. The region of sequence that was used to produce the Col43 riboprobe did not show significant homology to other mouse sequences (http://www.ncbi.nlm.nih.gov/BLAST). The methods for pretreatment, hybridization, washing, and dipping slides in Ilford K5 emulsion for autoradiography were as described by Jeffery et al. [26]. The presence of hybridizable mRNA in kidney tissues was established in nearby serial sections using an antisense ß-actin probe. Autoradiography was performed at 4°C (two exposures per section; 10 and 18 days for 3(IV) mRNA and 10 days for ß-actin mRNA), before developing in Kodak D19 (1464593; Eastman Kodak Supplies, Rochester, NY, http://www.kodak.com) and counterstaining by the Giemsa method. Slides were examined under conventional or reflected-light dark-field conditions (Nikon ME600; Nikon U.K. Ltd., Kingston Upon Thames, U.K., http://www.nikon-instruments.com) that allowed individual autoradiographic silver grains to be seen as bright objects on a dark background.
Statistical Analysis
All results were expressed as mean ± SE for n animals. Data were analyzed using the Mann-Whitney U test. A probability less than .05 was considered to be significant. Statistical analysis was carried out using GraphPad Prism 3.02 (GraphPad Software, Inc., San Diego, http://www.graphpad.com).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
Proteinuria Score.
Disease assessment with dipstick analysis showed that Col43–/– animals transplanted with –/– BM developed severe proteinuria, whereas animals given +/+ BM had mild proteinuria 20 weeks post-transplant (Table 1).
|
Serum Urea and Creatinine Measurements.
To assess renal function, urea and creatinine were measured in the terminal blood serum of all mice. At 20 weeks post-transplant, serum urea levels were significantly lower in Col43–/– mice transplanted with +/+ BM than in littermates transplanted with –/– BM (Fig. 1A). Likewise, levels of serum creatinine were also significantly reduced at the same time point (Fig. 1B).
|
Renal Histology.
Renal scarring was also significantly less in Col43–/– animals that received +/+ BM than in those transplanted with –/– BM, as demonstrated by reduced picrosirius red staining in the interstitium (Figs. 1C, 2A–2F). At 20 weeks post-transplant, animals that received +/+ BM showed less glomerular damage and tubulointerstitial fibrosis than animals transplanted with –/– BM, which had shrunken and sclerosed glomeruli accompanied by damaged tubules with cast formation (Fig. 2G, 2H).
|
BM-Derived Cells Contribute to Podocyte Regeneration in Alport Mice
BM-derived cells were detected in all recipients by the presence of a Y chromosome in cell nuclei (Fig. 3A). No Y chromosome was detected in female +/+ tissues (Fig. 3B). Fluorescence microscopy revealed that there were occasional Y-positive cells with the characteristic morphology and location of podocytes in glomeruli of Col43–/– mice given +/+ BM. Autofluorescence of kidney tissue was used to structurally identify podocytes in these mice (Fig. 3C). Confocal microscopy confirmed these results (Fig. 3D; supplemental online Video 1).
|
3(IV) collagen showed positive immunoreactivity for 3(IV) in almost all recipients of +/+ BM 20 weeks post-transplant. Focal staining of glomeruli for 3(IV), mainly in the GBM and periphery of Bowman's capsule, was observed in these mice, but no staining was found in the kidneys of mice that received –/– BM (Fig. 4). Kidney sections did not show any staining when the primary antibody layer was omitted, demonstrating the specificity of the immunostaining technique. Interestingly, no 3(IV) staining in the tubular basement membranes was observed in mice that received +/+ or –/– BM.
|
3(IV) mRNA was detected by RT-PCR of mRNA extracted from whole kidneys of Col43–/– mice in two animals transplanted with +/+ BM 20 weeks post-transplant. No expression was detected in the group of mice that received –/– BM (Fig. 5A).
|
3 deleted in the Col43–/– mice showed rare specific 35S labeling for podocytes in some recipients of +/+ BM at 20 weeks post-transplant. Glomeruli of mice that received –/– BM were not labeled with 35S (Fig. 5B–Fig. 5G). |
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
3 deficiency in a genetically defined mouse model of autosomal AS. Renal function was improved in Col43–/– animals transplanted with +/+ BM after 20 weeks, as evidenced by decreased serum urea and creatinine, reduced interstitial fibrosis, and improved renal histology. Indeed, these animals survived for 20 weeks, in contrast to those transplanted with –/– BM, of which two died from kidney failure before 20 weeks, which emphasizes the beneficial effect of +/+ BM transplantation.
Our aim was to establish proof of the principle that BM transplantation could result in improvement of disease in which expression of a gene was absent in the kidney. We chose to study AS since it has a well-known etiology and pathogenesis that have been modeled in a number of genetically modified mouse strains. We chose to use C57BL/6 Col43–/– mice for all experiments in preference to the original Sv129 Col43–/– mouse model [6] because the BL/6 background gives almost double the life span before Col43–/– mice reach ESRD [7]. This was important for this study because mice had to live long enough to be BM-transplanted and to be monitored for the disease development. We reasoned that if BM cells were to have any functional benefit for the recipient animals, they would need time to repopulate the damaged kidney.
Our hypothesis was that BM transplantation would improve renal function by repopulation of glomerular podocytes by cells producing 3(IV) collagen. Unlike mesangial and endothelial cells, which readily proliferate after injury, podocytes exhibit high expression of cyclin-dependent kinase inhibitors and normally have minimal capacity to proliferate [27]. BM-derived cells have been shown previously by our group to contribute to the population of glomerular podocytes in vivo after irradiation of mice [21], and Perry et al. reported that BM cells differentiate into podocytes in vitro when grown on type IV collagen matrices [28]. Our results suggest that there was indeed replacement of podocytes from the BM and that this led to intraglomerular synthesis of 3(IV) collagen. We demonstrated this by a number of techniques. Confocal microscopy strongly suggested that BM-derived cells homed to the injured glomerulus, and in some recipients of +/+ BM, these cells adopted a podocyte phenotype. Immunofluorescence for 3(IV) protein expression by a specific monoclonal antibody revealed focal staining in glomeruli of animals transplanted with +/+ BM, whereas glomeruli of recipients of –/– BM were negative. RT-PCR used to detect expression of +/+ 3(IV) mRNA showed expression of the wild-type allele in two of five mice that received +/+ BM but not in control animals that received –/– BM. The failure to detect 3(IV) in all recipients of +/+ BM probably reflects the fact that we have used mRNA prepared from whole kidney, to which podocytes would make only a very small contribution. In addition, we found +/+ 3(IV) mRNA in a podocyte location by ISH only in animals transplanted with +/+ BM.
The mechanisms underlying repopulation of glomerular podocytes by BM-derived cells are not yet clear. We did not perform any experiments to investigate whether the mechanism of podocyte regeneration was due to transdifferentiation of BM-derived cells or cell-cell fusion, mainly because of lack of reliable double labeling for both the origin and 3(IV) status of engrafted cells. Recently, Held et al. reported that tubular regeneration in FAH–/– mice occurred principally via a cell fusion mechanism. This study demonstrated up to 50% replacement of tubular epithelium with cells of BM origin but did not consider the origin of podocytes [29]. Previously, we reported the presence of recipient cells on the periphery of the glomerulus bearing two X and two Y chromosomes, potentially podocytes of recipient origin, in a female patient transplanted with a kidney from a male donor [30]. Future studies will assess whether the mechanism of podocyte regeneration requires cell-cell fusion.
Our results demonstrate podocyte regeneration with synthesis of 3(IV) collagen associated with a marked reduction in renal histological and functional damage. However, the extent of podocyte cell engraftment by BM cells was low, consistent with other studies [19], and this raises the possibility that some other effect of BM transplantation may contribute to the functional disease amelioration. We detected no benefit of administered MSCs, suggesting that the effective component of whole BM was derived from the hematopoietic stem cell (HSC) population. In addition, the beneficial effects of whole BM may also partly be due to paracrine action of donor-derived cells, which have been shown to exert renoprotective effects in a mouse model of ischemic injury after MSC transplantation [31].
Other recent studies have reported that simple BM transplantation of Col43–/– mice with +/+ BM prolongs their survival, although no evidence of 3(IV) expression in the recipient kidneys was shown [32]. In addition, since our submission, Sugimoto et al., using a similar model, reported that whole BM restores Col43 expression to Alport mice, but they too were unable to demonstrate simultaneously podocyte cell phenotype and origin, nor did they investigate whether HSCs or MSCs were responsible for rescue of disease [33].
For adult stem cells to be used for therapeutic purposes, high levels of cell engraftment after transplantation would probably have to be established. BM transplantation followed by administration of growth factors, such as hepatocyte growth factor [34], granulocyte-colony stimulating factor [12–35], vascular endothelial growth factor [36], platelet-derived growth factor [37], or cytokines, such as stromal cell-derived factor 1 [38], which have been reported to accelerate renal recovery and increase stem cell mobilization and homing to damaged organs, could also increase the frequency rate of incorporation of BM-derived cells into organs.
In conclusion, this proof-of-principle study shows that in a mouse model of AS, transplantation of whole BM may act as a source of extrarenal cells that replace defective podocytes, leading to amelioration of glomerular disease, at least in part, by restoring glomerular 3(IV) expression. This is the first study to report a beneficial effect of BM-derived cells in a model of AS and provides support to the concept that BM-derived stem cells could be appropriate for treatment of other genetic renal diseases.
|
DISCLOSURES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
3+/– mice and the primer sequences for the genotyping of the mice, and Phill Muckett and Alex Stepney (Hammersmith Hospital, London, U.K.) for their help in welfare and genotyping of mice. We are grateful to Yoshikazu Sado (Shigei Medical Research Institute, Okayama, Japan) for the kind gift of antibodies against (IV) chains and to Paul Killen (University of Michigan, Ann Arbor, Michigan, USA) and Hans Baelde (Leiden University Medical Centre, Leiden, the Netherlands) for their kindness in providing plasmid DNA for chain-specific collagen IV mRNAs. We also thank Malcolm Alison (Cancer Research U.K.) for inspiring discussions on this study and Toby Hunt and Pooja Seedhar (Cancer Research U.K.) for excellent technical assistance. Finally we are indebted to George Elia and his team (Histopathology Unit, Cancer Research U.K.) for their help with tissue embedding and cutting. This work was supported by a Kidney Research U.K. Ph.D. studentship (E.I.P.) and by Cancer Research U.K. |
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresAcknowledgmentsReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  D. R. Abrahamson, B. G. Hudson, L. Stroganova, D.-B. Borza, and P. L. St. John Cellular Origins of Type IV Collagen Networks in Developing Glomeruli J. Am. Soc. Nephrol., July 1, 2009; 20(7): 1471 - 1479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Heidet and M.-C. Gubler The Renal Lesions of Alport Syndrome J. Am. Soc. Nephrol., June 1, 2009; 20(6): 1210 - 1215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Gross, D.-B. Borza, H.-J. Anders, C. Licht, M. Weber, S. Segerer, R. Torra, M.-C. Gubler, L. Heidet, S. Harvey, et al. Stem cell therapy for Alport syndrome: the hope beyond the hype Nephrol. Dial. Transplant., March 1, 2009; 24(3): 731 - 734. [Full Text] [PDF]
|
|
|
|
 |
|
 D. Macconi, F. Sangalli, M. Bonomelli, S. Conti, L. Condorelli, E. Gagliardini, G. Remuzzi, and A. Remuzzi Podocyte Repopulation Contributes to Regression of Glomerular Injury Induced by Ace Inhibition Am. J. Pathol., March 1, 2009; 174(3): 797 - 807. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Ronconi, C. Sagrinati, M. L. Angelotti, E. Lazzeri, B. Mazzinghi, L. Ballerini, E. Parente, F. Becherucci, M. Gacci, M. Carini, et al. Regeneration of Glomerular Podocytes by Human Renal Progenitors J. Am. Soc. Nephrol., February 1, 2009; 20(2): 322 - 332. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Appel, D. B. Kershaw, B. Smeets, G. Yuan, A. Fuss, B. Frye, M. Elger, W. Kriz, J. Floege, and M. J. Moeller Recruitment of Podocytes from Glomerular Parietal Epithelial Cells J. Am. Soc. Nephrol., February 1, 2009; 20(2): 333 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Poulsom and M. H. Little Parietal Epithelial Cells Regenerate Podocytes J. Am. Soc. Nephrol., February 1, 2009; 20(2): 231 - 233. [Full Text] [PDF]
|
|
|
|
|
|
J. Chen, H. Li, F. Addabbo, F. Zhang, E. Pelger, D. Patschan, H.-C. Park, M.-C. Kuo, J. Ni, G. Gobe, et al. Adoptive Transfer of Syngeneic Bone Marrow-Derived Cells in Mice with Obesity-Induced Diabetes: Selenoorganic Antioxidant Ebselen Restores Stem Cell Competence Am. J. Pathol., February 1, 2009; 174(2): 701 - 711. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Katayama, M. Kawano, I. Naito, H. Ishikawa, Y. Sado, N. Asakawa, T. Murata, K. Oosugi, M. Kiyohara, E. Ishikawa, et al. Irradiation Prolongs Survival of Alport Mice J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1692 - 1700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. S. LeBleu and R. Kalluri Stem Cell-Based Therapy for Glomerular Diseases: An Evolving Concept J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1621 - 1623. [Full Text] [PDF]
|
|
|
|
|
|
M. Albaqumi and L. Barisoni Current Views on Collapsing Glomerulopathy J. Am. Soc. Nephrol., July 1, 2008; 19(7): 1276 - 1281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Schmitt and L. G. Cantley The impact of aging on kidney repair Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1265 - F1272. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Mazzinghi, E. Ronconi, E. Lazzeri, C. Sagrinati, L. Ballerini, M. L. Angelotti, E. Parente, R. Mancina, G. S. Netti, F. Becherucci, et al. Essential but differential role for CXCR4 and CXCR7 in the therapeutic homingof human renal progenitor cells J. Exp. Med., February 18, 2008; 205(2): 479 - 490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Boor, K. Sebekova, T. Ostendorf, and J. Floege Treatment targets in renal fibrosis Nephrol. Dial. Transplant., December 1, 2007; 22(12): 3391 - 3407. [Full Text] [PDF]
|
|
|
|
|
|
E. Lazzeri, C. Crescioli, E. Ronconi, B. Mazzinghi, C. Sagrinati, G. S. Netti, M. L. Angelotti, E. Parente, L. Ballerini, L. Cosmi, et al. Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure J. Am. Soc. Nephrol., December 1, 2007; 18(12): 3128 - 3138. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
