Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online August 17, 2006
Stem Cells Vol. 24 No. 12 December 2006, pp. 2677 -2684
doi:10.1634/stemcells.2005-0452; www.StemCells.com
© 2006 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0452v1
24/12/2677    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ware, C. B.
Right arrow Articles by Blau, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ware, C. B.
Right arrow Articles by Blau, C. A.

EMBRYONIC STEM CELLS: CHARACTERIZATION SERIES

A Comparison of NIH-Approved Human ESC Lines

Carol B. Warea, Angelique M. Nelsona, C. Anthony Blaub

aDepartment of Comparative Medicine and
bDivision of Hematology, Department of Medicine, University of Washington, Seattle, Washington, USA

Key Words. Human embryonic stem cell • Doubling time • Cloning • Transfection

Correspondence: Carol B. Ware, Ph.D., University of Washington, Box 357190, Seattle, Washington 98195, USA. Telephone: 206-616-5143; Fax: 206-685-3006; e-mail: cware{at}u.washington.edu

Received on September 16, 2005; accepted for publication on July 27, 2006.

First published online in STEM CELLS EXPRESS  August 17, 2006.

    ABSTRACT
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
In October 2003, the NIH established three extramural "Exploratory Centers for Human Embryonic Stem Cell Research." Our center acquired 15 of the 22 NIH-approved cell lines. Lines were tested for: (a) freedom from mycoplasma contamination; (b) appropriate pattern of gene expression during self-renewal and differentiation; (c) ability to adapt to uniform culture conditions; (d) ability to grow at clonal densities; (e) karyotype; (f) growth efficiency; and (g) efficiency of stable transfection following electroporation. One line harbored mycoplasma. Ten lines were converted to uniform conditions. Nine lines were fully characterized. Human ESC (hESC) lines varied markedly with respect to growth efficiency as measured by the amount of time it took to plate and double (31–57 hours), cloning efficiency (0.8%–9.2%), and stable transfection rates following electroporation (0%–53% relative to a standard mouse ESC line). One hESC line had an unstable karyotype at an early passage. Modifications of the proposed Material Transfer Agreements with hESC suppliers were required to improve accessibility to hESC lines by local researchers. The NIH-approved hESC lines vary in their behavior in culture. Many hESC lines can be maintained using culture conditions less onerous than those recommended by their suppliers. Intellectual property issues pose a significant obstacle to research using NIH-approved hESC lines.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Human ESCs (hESCs) offer unprecedented opportunities for research in developmental biology, drug discovery, and possibly, for developing a new generation of cell therapies. Since their initial description [1], hESC lines have been established under various conditions. Current in vitro culture conditions are cumbersome, and optimal conditions have not been defined. In this context, a major question within the hESC field is the extent to which the various lines differ in their biological behavior. This question is actively being addressed through the International Stem Cell Initiative [2] and has been addressed through expression array [3] and transcriptome [4] analysis.

In October 2003, the NIH established three extramural "Exploratory Centers for Human Embryonic Stem Cell Research," with the goal of broadening hESC expertise using the NIH-approved lines. NIH-approved hESC lines are those derived prior to August 9, 2001, and 22 eligible lines were listed on the NIH Stem Cell Registry website (http://stemcells.nih.gov/research/registry/) at the time of this study. An Exploratory Center shared by the University of Washington (UW) and the Fred Hutchinson Cancer Research Center generated an infrastructure for improving access to hESCs by local researchers, and our Core Laboratory has uncovered biological differences among the 15 NIH-approved lines acquired. These experiences should be useful for other institutions engaging in hESC research.


    METHODS
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
ESC Culture
The hESC culture method used was that previously described [5], with slight variations. Briefly, cells were cultured in Dulbecco's modified Eagle's medium/Ham's F-12 medium containing GlutaMax supplemented with 20% serum replacer (SR), 1 mM sodium pyruvate, 0.1 mM nonessential amino acids, 50 U/ml penicillin, 50 µg/ml streptomycin (all from Invitrogen, Carlsbad, CA, http://www.invitrogen.com), 0.1 mM ß-mercaptoethanol (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), and 2 ng/ml basic fibroblast growth factor (Peprotech, Rocky Hill, NJ, http://www.peprotech.com). hESCs were grown on primary mouse embryonic fibroblasts (MEFs) from E12.5 CD-1 mice or, when antibiotic resistance was required, from neo-resistant C57BL/6 x 129 mice following the protocol of Abbondanzo et al. [6]. Briefly, heads and red tissue (heart and liver) were discarded, and the rest of the fetus was disrupted by passage through a 25-gauge needle and plated as passage 0. Passages 4 to 6 MEFs were {gamma}-irradiated with 3,000 rads and plated at 104 cells per cm2. All hESC lines were initially passaged according to the recommendations of their suppliers. To convert to enzymatic passage, cells were washed with phosphate-buffered saline (PBS) (Invitrogen) and exposed to 1.2 U/ml dispase (Invitrogen) dissolved in PBS supplemented with 10% fetal bovine serum (FBS) (Schenk Packing, Stanwood, WA, http://www.schenkpacking.com) or embryonic stem-qualified FBS (Invitrogen). Once colonies began to lift from the plate, the cell layer was washed off using a pipette, collected in a centrifuge tube containing culture medium, washed once by centrifugation, mechanically dispersed to ~100-µm diameter clusters using a 5-ml pipette, and washed again before plating. When converting ES Cell International (ESI) cell lines to enzyme passage, 1 mg/ml collagenase Type IV (Invitrogen) in hESC medium was used, and the cells were monitored closely for lifting of the colony edges. Once converted to enzyme passage, ESI lines were switched to dispase passage. For generating a single-cell suspension, trypsin-EDTA (Invitrogen) was used.

Immunohistochemistry
Maintainence of an undifferentiated phenotype was established by immunohistochemistry using antibodies for Oct-4 (1:200 dilution) (R&D Systems Inc., Minneapolis, http://www.rndsystems.com) and SSEA-4 (1:50 dilution) (Chemicon, Temecula, CA, http://www.chemicon.com) and by staining for alkaline phosphatase (AP) activity using a Black Alkaline Phosphatase Substrate Kit II (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). For immunolabeling, the clusters were visualized using a biotinylated secondary antibody included in the Universal Quick Kit using Nova Red (both from Vector Laboratories).

Expression Analysis by Reverse Transcription- Polymerase Chain Reaction
To test differentiation ability, hESCs were either collected as undifferentiated cells or removed from MEFs and cultured on gelatinized 10-cm plates in the medium described above, except 10% FBS was substituted for SR. Cells were allowed to differentiate for 10 or 21 days and then washed twice with PBS and lysed on the plate, and whole RNA was isolated according to the manufacturer's recommendations (RNeasy; Qiagen, Valencia, CA, http://www1.qiagen.com). Contaminating genomic DNA was removed from the RNA preps using DNA-free (Ambion, Austin, TX, http://www.ambion.com). cDNA synthesis was performed using a kit (Protoscript; New England Biolabs, Ipswich, MA, http://www.neb.com), and the resultant cDNA was treated with RNase included in the kit. Reverse transcription-polymerase chain reaction (RT-PCR) was used to determine expression of {alpha}-fetoprotein (AFP) (endoderm), neurofilament heavy chain (NFH) (ectoderm), renin (mesoderm), Oct-4, Nanog (undifferentiated), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using the following primers: AFP forward, AGAACCTGTCACAAGCTGTG (680 bp); AFP reverse, GACAGCAAGCTGAGGATGTC; NFH forward, TGAACACAGA-CGCTATGCGCTCAG (400 bp); NFH reverse, CACC-TTTATGTGAGTGGACACAGAG; renin forward, AGTCG-TCTTTGACACTGGTTCGTCC (590 bp); renin reverse, GGTAGAACCTGAGATGTAGGATGC; Oct-4 forward, GA-GCAAAACCCGGAGGAGT (309 bp); Oct-4 reverse, TTC-TCTTTCGGGCCTGCAC; Nanog forward, GCTTGCGCTTTGAAGCA (255 bp); Nanog reverse, TTCTTGACTGGGAC-CTTGTC; GAPDH forward, TGATGACATCAAGAAG-CTGGTGAAG (240 bp); and GAPDH reverse, TCCTTGGAGGCCATGTGGGCCAT.

Mycoplasma Detection
A luminometer-based kit was used for detection of mycoplasma (MycoAlert; Cambrex, Walkersville, MD, http://www.cambrex.com). When mycoplasma was detected, it was verified using a polymerase chain reaction (PCR)-based test (Stratagene, La Jolla, CA, http://www.stratagene.com).

Karyotype
G-banded karyotype was analyzed by the Cytogenetics Laboratory at UW.

Growth Efficiency
Cell numbers were determined after dispase dispersal followed by trypsinization of an aliquot of the resulting cluster suspension for a hemacytometer count. Cells were plated in clusters at a density of 105 cells per 35-mm plate on feeders. Each trial was plated in duplicate. Cells were allowed to grow for 72 hours and then trypsinized and counted using a hemacytometer. Growth efficiency for all lines was measured three times. Growth efficiency reflects a combination of plating efficiency and doubling time and is a reflection of expected expansion time. This is measured as the amount of time in hours to double once.

Cloning Efficiency
Cells were dispersed to primarily single-cell suspension using trypsin, counted using a hemacytometer, and plated in duplicate 10-cm plates at 100, 1,000, and 10,000 cells per plate. The plates were fluid changed at least twice weekly, and colonies were counted when large enough to visualize macroscopically (15–18 days). Cloning efficiency for each line was measured at least three times.

Transfection Efficiency
All hESC lines were compared with an equivalent number of mouse ESCs (mESCs). hESCs were dispersed with dispase, and mESCs were dispersed with trypsin. Two million cells were placed into 0.4-cm cuvettes (Bio-Rad, Hercules, CA, http://www.bio-rad.com) in PBS containing 1 µg of a linearized PGK-neo construct. They were exposed to a pulse of 250 V, 500 µF (Gene Pulser II; Bio-Rad). Following electroporation, hESCs were plated onto single 10-cm plates seeded with neomycin-resistant MEF feeders. mESCs were plated without feeders on two gelatinized 10-cm plates in medium containing 103 U/ml leukemia inhibitory factor and 15% ES-qualified FBS rather than serum replacer. One-hundred eighty µg/ml neomycin (G418; Invitrogen) was added 24 hours later to the mESC cultures and 48 hours later to the hESC cultures. Plates were fluid changed at least twice weekly and counted when colonies could be visualized (10–13 days for mESCs and 15–18 days for hESCs). Transfections were performed on the Bio-Rad Gene Pulser II electroporator at least three times for each cell line. In addition, one million each of H1, BG02, and BG03 cells were transfected with linearized PGK-neo using a Nucleofector II device and the Mouse ES Cell Nucleofector Kit (Amaxa Biosystems, Koeln, Germany) using program A13. For stable expression comparison, mouse ESCs (105) were transfected using the same kit and a different program, A23. The nucleofection protocol recommended by the manufacturer was followed for both the mouse and human ES lines. Cells were selected as described above. Only one trial for three human lines was run on the Nucleofector II device as a means of determining whether relative differences seen between lines on the Bio-Rad device held true on the Amaxa device.

Cryopreservation
The method used for cryopreservation has been described previously [5].


    RESULTS
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Acquisition of NIH-Approved hESC Lines
Significant barriers to research using NIH-approved hESC lines include a cost of $5,000–$6,000 per line per laboratory. Cost on the WiCell lines has recently been reduced to $500 per line. Typical Material Transfer Agreement (MTA) provisions required by suppliers of the cell lines prevent distribution to researchers outside the laboratory designated in the MTA. On an institution-wide scale, the cost of providing all investigators access to all NIH-approved lines would be prohibitive. To address these obstacles, our center, assisted by the University of Washington Office of Technology Transfer, developed a model that improves access to hESC lines purchased by our Core Laboratory. First, MTA provisions were modified to allow local investigators to access all hESC lines for preliminary experimentation, with the purpose of identifying those lines best suited for their experiments. MTA provisions require that these preliminary studies be conducted in the Core Laboratory. After the optimal lines are identified, rights to use the desired lines must be purchased by the investigator directly from the suppliers. The flexibility of allowing outside researchers an opportunity to gain exposure to different hESC lines within our laboratory was resisted by a number of the suppliers, but eventually, all five suppliers of hESC lines purchased by the Core Laboratory agreed to these conditions. One consequence of this organizational structure is that it promotes a prolonged period of training, which appears to be necessary to acquire expertise in hESC culture. A second proposed mechanism for improving access would allow the Core Laboratory to directly distribute hESCs to local researchers, provided that the researchers then make a significantly reduced payment directly to the corresponding hESC supplier. Of the five hESC suppliers we contacted with this proposal, only Bresagen agreed to these terms, which allow local researchers to obtain the Bresagen lines directly from our Core Laboratory at a 50% reduced fee, paid directly to Bresagen, following the acceptance of the MTA. This reflects significant cost savings to the supplier and the investigator, whereas the Core Laboratory receives no portion of the fee for performing this aspect of its mission.

Preliminary Characterization
All cell lines except three from Bresagen were received frozen. Note that in some cases, provider codes are used for the lines and in others the NIH code was the accepted name (Table 1). The number of cells provided and their viability following cryopreservation by the provider differed significantly between suppliers. Fewer than 10 clusters were recovered from most of the frozen lines. HSF-6 was a notable exception. Receipt of actively growing lines (Bresagen) facilitated establishment and subsequent cryostorage of the lines. Survival of rare cells following freeze that take 2–3 weeks to appear as clusters suggests that the survivors may represent subclones of the parent culture. Conversely, all the hESC lines are able to survive freezing with an efficiency of >50% if frozen using embryo methods. Following a slow-cooling protocol [2], the cells have shown no long-term degradation in liquid nitrogen storage after 2 years, and there appear to be no striking differences between cell lines with regard to surviving cryopreservation both short term and long term.


View this table:
[in this window]
[in a new window]

 
Table 1. Experience with thaw and survival of shipped human embryonic stem cells

 
Adaptation of hESCs to Uniform Culture Conditions
To maintain hESCs in an undifferentiated state, cultures were performed on an underlayer of MEFs. Cells were initially cultured in accordance with the recommendations of the suppliers; however, most suppliers recommended some type of mechanical passage, involving the microscopic partitioning of individual hESC colonies, followed by transfer of colony sections to a new culture dish. Although these methods for microscopic dissection may maintain the karyotypic integrity of hESCs better than enzymatic digestion [7, 8], mechanical passage is extremely labor-intensive and is impractical for expanding hESC cultures to high cell numbers. Therefore, after an initial period of expansion to build a reserve of cryopreserved cells, we attempted to convert 14 hESC lines to enzymatic passage, and we have succeeded in 12 cases to date (Table 2). Single-cell suspensions are associated with poor survival and the emergence of karyotypic abnormalities; therefore, we used enzymes and methods that allow cells to be passaged as aggregates. Dispase or collagenase was used to lift colonies from plates with minimal disruption of intercellular connections.


View this table:
[in this window]
[in a new window]

 
Table 2. Summary of NIH-approved human ESC line characteristics

 
Conventional Parameters of hESC Phenotype and Function
All NIH-approved hESC lines were analyzed for four parameters prior to distribution. These parameters are normal G-banded karyotype, display of markers that indicate lack of differentiation when cultured under self-renewing conditions, ability to differentiate into all three embryonic germ lineages, and absence of mycoplasma contamination. Using these four parameters, we looked at nine hESC lines that were successfully converted to our culture conditions. All nine lines maintained their "normal" characteristics at the passage number shown in Table 2.

Maintenance of an Undifferentiated Phenotype.   Immunohistochemistry for SSEA-4 and Oct-4 and detection of AP activity showed the expected patterns, indicating an undifferentiated state in all nine lines. Within healthy cultures, loss of these markers can be seen in whole or partial colonies (Fig. 1, arrows at SSEA-4 [H13], Oct-4 [H9], and AP[BG03]), indicating an inherent propensity to differentiate. Oct-4 patterns vary among the cell lines, in that not all cells label with Oct-4 in H1, H9, and BG01 clusters, whereas the other lines appear to label uniformly. Because this pattern is not consistently reproducible, this may be an artifact of both quality of passage of the sample and density of Oct-4 nuclear staining. The downregulation of AP activity that accompanies the initial stages of hESC differentiation makes this a rapid and unambiguous method of culture assessment.


Figure 1
View larger version (128K):
[in this window]
[in a new window]

 
Figure 1. Analysis of human ESC lines for self-renewal. Nine lines were analyzed for SSEA-4, Oct-4, and alkaline phosphatase (AP) activity. SSEA-4 and Oct-4 were compared with a secondary antibody-only control. Arrow indicates areas of differentiation in SSEA-4 (H13), Oct-4 (H9), and AP (BG03).

 

Differentiation Ability.   To confirm the ability of an hESC line to form the three embryonic germ lineages, in vitro differentiation was performed, followed by RT-PCR using primers to detect transcripts associated with endoderm (AFP), ectoderm (NFH), and mesoderm (renin) formation. The protocol relied upon undirected differentiation. These results were compared with those of equivalent cells cultured to prevent differentiation using primers for Oct-4 and Nanog. For all 10 lines examined, cells allowed to differentiate for 10 or 21 days expressed RNA for the three germ lineages (data not shown). Some lines expressed differentiation markers for renin (BG01, BG02, and ES04) and NFH (H7, H13, H14, BG01, BG02, BG03, and hSF6) prior to induction of differentiation, indicating that they were carrying detectable differentiation when cultured under self-renewal conditions. RNA for Oct-4 and Nanog was assessed among the lines prior to differentiation and following 21 days of differentiation (Fig. 2). Oct-4 and Nanog expression persisted in H7 and BG03, suggesting that they retain undifferentiated cells despite the differentiation culture conditions, whereas H9, BG02, and hSF6 had Oct-4-positive but Nanog-negative cells following differentiation. A faint Nanog band was seen in the differentiated H13 culture with no apparent Oct-4. This needs to be explored further and may be an artifact. Overall, other means must be used to confirm comparison of lines for the persistence of stem cells, whereas robustness of contribution to specific lineages will need to be compared using protocols directing the cells down specific pathways.


Figure 2
View larger version (27K):
[in this window]
[in a new window]

 
Figure 2. Markers of self-renewal in human ESCs. Reverse transcription-polymerase chain reaction comparison of RNA levels. Abbreviations: d, differentiated for 21 days; Gapdh, glyceraldehyde-3-phosphate dehydrogenase; u, undifferentiated.

 

Mycoplasma Detection.   Mycoplasma testing was carried out on all 15 lines using a luminometer-based test. Although 14 lines were free from contamination, one line harbored mycoplasma upon receipt, as determined with the cooperation of the supplier and confirmed using PCR. This provided an opportunity to examine the microscopic appearance of mycoplasma contamination (Fig. 3). This contamination, representing either Mycoplasma hyorhinis or Mycoplasma orale, excluded this line from further evaluation.


Figure 3
View larger version (124K):
[in this window]
[in a new window]

 
Figure 3. Mycoplasma contamination of a human ESC (hESC) line. (A): Results from the luminometer-based (left) and PCR-based (right) tests. Absence of mycoplasma gives a luminometer ratio of <1.0. PCR results: lane 1, supernatant from a contaminated line; lanes 2 and 3, supernatants from uncontaminated lines; lane 4, positive control; lane 5, negative control; lane, internal control (kit). (B): Photomicrographs of the appearance of a mycoplasma-contaminated culture. a, 2 days after plating, the edges of the hESC colony lifted (arrow); b, feeders adjoining the colony showed small blebs (arrow); c, feeders close to but not touching the colony blebbed and became spindly (arrow); d, normal feeder 2 days after exposure to contaminated hESCs (arrow indicates an adherent senescent giant cell with clear stress fibers indicating normal attachment); e, a distant feeder cell showed some blebbing 2 days after plating of infected hESCs; f, all feeder cells showed signs of mycoplasma contamination after 5 days in the presence of contaminated hESCs. The feeder layer then looked poorly adherent, and blebs were easily seen along the cell wall of the processes. Abbreviations: bp, base pair; kB, kilobase; PCR, polymerase chain reaction.

 

G-Banded Karyotype.   All lines were karyotypically stable to the passage number shown in Table 2. However, within roughly 20 passages from receipt, two of five chromosomal spreads from H13 (passage 36) cells contained a trisomy 17. By passage 39, all five chromosomal spreads of the H9 line contained a trisomy X. Thus, both abnormalities likely confer a growth advantage [7]. Table 3 provides a summary of all karyotype data collected.


View this table:
[in this window]
[in a new window]

 
Table 3. Summary of all karyotype data

 
Measurements of Growth Efficiency, Cloning Efficiency, and Transfection Efficiency

Growth Efficiency.   Cell growth efficiency was determined following plating of 105 cells on a MEF feeder, growth for 3 days, and a hemacytometer count of trypsinized cells. Using this method, differences between lines can be caused by a number of different parameters, including plating efficiency, tendency to differentiate, and relative growth response between the lines to culture density, whereas true doubling time takes into account that growth rate follows a curve. This method measures relative growth between lines. Other means are required to measure the individual factors that cause the comparative growth differences. Doubling times ranged from ~31 hours for HSF-6 and BG03 to ~56 hours for H13 and BG02 (Table 2). While making these measurements, other cell line-specific differences were noted. For example, on several occasions during routine culture, we observed an abrupt increase in the rate of cell proliferation. H9 grows very slowly when plated at low density and noticeably more rapidly when plated at high cell density. For instance, H9 was karyotyped following an increased growth rate with reduced differentiation and was found to be abnormal (passages 49 and 60; Table 3). Cell growth efficiency is influenced by a number of parameters, including medium composition, the presence of MEFs, karyotype integrity, survival following passage, and cell density. Values reported in Table 2 reflect growth as measured by the time it took to double when cells were seeded at uniform and optimal density on MEFs. A relatively high SEM was observed between trials. Because of this, a comparison of results between growth efficiency for HSF-6 (31.3 ± 3.7 hours) versus H13 (57.0 ± 12.0 hours) approached significance following three trials (p = .12; t test) and can only be regarded as a trend.

Cloning Efficiency.   The frequency with which single cells form colonies ranged from 0.8% ± 0.1% for BG02 to 9.2% ± 4.7% for H13 (p = .22, t test). By comparison, standard cloning efficiencies for the mouse cell line R1 are typically in the range of 10%. Again, variability between trials prevents ability to reach significance and suggests that improvements in culture conditions will likely affect reproducibility. hESC clones frequently acquired karyotypic abnormalities. For example, of three H7 clones analyzed, two had a normal 46XX karyotype, whereas the other acquired a trisomy 17; only two of three clones of H14 were normal, and two of two BG03 clones carried a trisomy 17 (Table 3).

Transfection Efficiency.   Developing mechanistic insight into hESC function requires methods for genetic manipulation. We compared nine hESC lines for their ability to be stably transfected via electroporation using the Bio-Rad electroporation system. Relative to the murine ESC line, R1, hESC lines displayed a widely variable efficiency of stable transfection, ranging from 0% for BG02 to 53% ±23 for BG03 (p = .11; t-test) (Table 2). This relative ranking of transfection efficiency changed in a trial transfection using the Amaxa nucleofection system. Using the Amaxa, the first two BG02 neo-resistant colonies were created, BG03 efficiency dropped from 53% to 2%, and the transfection efficiency of H1 improved from 7% to 17%. Since transfection efficiency increases approximately 10-fold in mouse ESCs using Amaxa-based nucleofection (A.M. Nelson and C.B. Ware, unpublished observation), the H1 line is very efficiently transfected by nucleoporation. There is variability between experiments, and the nucleoporation comparison was run only once, but it reveals differences between the transfection systems that highlight the need to devise optimal conditions for each line. The mouse line used as a standard can also show transfection variability from run to run. We generally expect 100 mouse ES colonies when two million cells are transfected. There are likely many variables that can affect efficiency that hinge on the quality of the culture, but the number of times the construct is frozen and thawed before use will also make a clear difference. Standardizing the human line to a mouse for each trial should remove this variable.


    DISCUSSION
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
The results described here point to biological differences among the various NIH-approved hESC lines. It is important to note that one experienced technician did all of the culture for cell growth efficiency, cloning efficiency, and stable transfection efficiency analysis. These parameters varied 2-, 11-, and 53-fold, respectively, among the different lines. In collaboration with other laboratories, we have also found differences among hESC lines in their abilities to form various tissues (K.-H. Chang, T. Papayannopoulou, D. Lamba, and T. Reh, unpublished observations). These inherent differences underscore the possibility that any given hESC line may possess a repertoire of capabilities that is unique. The variable behavior of the NIH-approved hESC lines may reflect some aspect of the way these cells were derived or, alternatively, more fundamental biological properties inherent to the cells themselves, and it emphasizes the need to derive and study additional hESC lines.

During routine culture, embryonic stem cells are in dynamic balance between undifferentiated expansion versus a drive toward differentiation. In addition, they are exquisitely sensitive to environmental conditions. This sensitivity could be either an inherent attribute or a reflection of inadequate culture conditions. The combination of inherent attributes and currently uncontrollable culture variables is the likely cause of the relatively large standard errors observed in this study. For instance, the tendency for a culture to differentiate could dramatically change the overall culture ability in these trials. Interestingly, the longer it took the cells to plate and grow, the higher the cloning efficiency; and the higher the transfection efficiency, the larger the variability between runs. It is not apparent that slow growth is preferable in an hESC, but increased cloning and transfection efficiencies are desirable and not reliably achieved, according to the results presented here.

The recommended hESC culture conditions vary widely among the different suppliers. After attending three different training courses (WiCell, University of California San Francisco [UCSF], and ESI), we established our ability to generate stocks of cells that had been cultured as recommended by the suppliers before attempting to convert each line to a uniform set of culture conditions. Our effort to generate a uniform, simplified method for culturing hESCs is pragmatically based. Mechanical passage of individual colonies is impractical for experiments requiring large numbers of cells. Variability in adapting to our simplified culture conditions further highlights the biological differences between the lines. Although we are not yet able to establish methods for enzymatic passage of 2 of the 14 cell lines tested, there remains the expectation that we will eventually be successful.

Another key difference among the various cell lines tested here is an apparent propensity of some cell lines to acquire karyotype abnormalities over time. An increase in doubling time with a decrease in background differentiation can be a warning sign that the karyotype is abnormal. It has been noted that when plates are so dense that colonies begin to grow together, growth characteristics alter (information learned the hESC training courses at UCSF and ESI). Another means of inducing increased rate of growth is by subcloning from a single-cell suspension [8] (our observations). Transgenic clones appear to be more karyotypically stable if they are allowed to divide before applying antibiotic selection pressure, presumably because they are never in a single-cell state. Clonal growth from single cells is likely to be a means of selecting for growth advantage and potential abnormality. Some lines are inherently less karyotypically stable than others [8, 9]. Using our culture conditions, H9 and H13 have a tendency to develop problems even when handled by an experienced technician, whereas ES04, hSF6, BG01, BG02, H1, H7, and H14 appear relatively stable. Overgrowth of cells with a growth advantage is rapid and can be a serious problem when studying self-renewal culture conditions. Some suppliers send frozen cultures with only a few viable cells. When cryopreserved cells survive poorly, there must be an advantage for those that do survive, which may represent another inadvertent means of selecting for karyotype change. Poor survival on thaw means starting a line with only a few clusters that are unlikely to adequately represent the prefreeze culture. Initiating a culture with only a few cells also increases the passage number before cells can be stored, making it difficult to establish a margin of safety for the number of frozen samples at low passage of karyotypically normal cells. Consequently, distributors of frozen hESCs should use freezing protocols to maximize consistency.

The differences among the various hESC lines described here indicate that some cell lines are likely better suited for particular applications than others. It is therefore important that researchers be able to choose the appropriate cell lines for their application. In this regard, intellectual property issues pose a significant roadblock to NIH-funded hESC research [10], with a cost of $500–$6,000 per line and MTA provisions that prevent the transfer of hESC lines between laboratories. We have attempted to address these obstacles in two ways. First, we reached agreements with all five hESC suppliers that allow local investigators access to all hESC lines purchased by the Core Laboratory to perform preliminary studies before purchasing the optimal line directly from the supplier. Our agreement requires that preliminary studies be conducted in the Core Laboratory. However, one beneficial consequence of this arrangement is that it places investigators new to hESC research in prolonged contact with Core Laboratory personnel, and prolonged training appears necessary for gaining expertise in hESC culture techniques. A second barrier to hESC research is the prohibition against transferring hESC lines between laboratories. For example, our laboratory has recently described an improved technique for freezing hESCs [2] but is prevented from distributing hESCs frozen in this manner to outside laboratories. To date, only Bresagen has agreed to allow our Core Laboratory to distribute their hESCs to local investigators, provided that the investigators then make a substantially reduced payment directly to Bresagen.

In summary, NIH-approved hESCs exhibit differences in cell culture. The development of uniform culture conditions will facilitate comparisons between these and other hESC lines. A fundamental restructuring of MTA provisions is necessary to broaden the accessibility of NIH-funded hESC research.


    DISCLOSURES
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
We thank Michael Corn and Natalie Brewster from the Office of Technology Transfer at the University of Washington for their patience and expertise in negotiating the MTAs, as well as welcome advice on the wording of the manuscript. This work was supported by Grant GM069983-01 from the National Institute of General Medicine Sciences of the NIH.


    REFERENCES
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 

  1. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  2. Andrews PW, Benvenisty N, McKay R et al. The International Stem Cell Initiative: Toward benchmarks for human embryonic stem cell research. Nat Biotechnol 2005;23:795–797.[CrossRef][Medline]

  3. Bhattacharya B, Miura T, Brandenberger R et al. Gene expression in human embryonic stem cell lines: Unique molecular signature. Blood 2004;103:2956–2964.[Abstract/Free Full Text]

  4. Li H, Liu Y, Shin S et al. Transcriptome coexpression map of human embryonic stem cells. BMC Genomics 2006;7:103.[CrossRef][Medline]

  5. Ware CB, Nelson AM, Blau CA. Controlled-rate freezing of human ES cells. Biotechniques 2005;38:879–883.[Medline]

  6. Abbondanzo SJ, Gadi I, Stewart CL. Derivation of embryonic stem cell lines. Methods Enzymol 1993;225:803–823.[Medline]

  7. Draper JS, Smith K, Gokhale P et al. Recurrent gain of chromosomes 17q and 12 in cultured human embryonic stem cells. Nat Biotechnol 2004;22:53–54.[CrossRef][Medline]

  8. Buzzard JJ, Gough NM, Crok JM et al. Karyotype of human ES cells during extended culture. Nat Biotechnol 2004;22:381–382.[CrossRef][Medline]

  9. Mitalipova MM, Rao RR, Hoyer DM et al. Preserving the genetic integrity of human embryonic stem cells. Nat Biotechnol 2005;23:19–20.[CrossRef][Medline]

  10. Rabin S. The gatekeepers of the hES cell products. Nat Biotechnol 2005;23:817–819.[CrossRef][Medline]




This article has been cited by other articles:


Home page
Stem CellsHome page
M. Bar, S. K. Wyman, B. R. Fritz, J. Qi, K. S. Garg, R. K. Parkin, E. M. Kroh, A. Bendoraite, P. S. Mitchell, A. M. Nelson, et al.
MicroRNA Discovery and Profiling in Human Embryonic Stem Cells by Deep Sequencing of Small RNA Libraries
Stem Cells, October 1, 2008; 26(10): 2496 - 2505.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C. S. Navara, J. D. Mich-Basso, C. J. Redinger, A. Ben-Yehudah, E. Jacoby, E. Kovkarova-Naumovski, M. Sukhwani, K. Orwig, N. Kaminski, C. A. Castro, et al.
Pedigreed Primate Embryonic Stem Cells Express Homogeneous Familial Gene Profiles
Stem Cells, November 1, 2007; 25(11): 2695 - 2704.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. Ilancheran, A. Michalska, G. Peh, E. M Wallace, M. Pera, and U. Manuelpillai
Stem Cells Derived from Human Fetal Membranes Display Multilineage Differentiation Potential
Biol Reprod, September 1, 2007; 77(3): 577 - 588.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
C. Ellerstrom, R. Strehl, K. Noaksson, J. Hyllner, and H. Semb
Facilitated Expansion of Human Embryonic Stem Cells by Single-Cell Enzymatic Dissociation
Stem Cells, July 1, 2007; 25(7): 1690 - 1696.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0452v1
24/12/2677    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ware, C. B.
Right arrow Articles by Blau, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ware, C. B.
Right arrow Articles by Blau, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS