|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
EMBRYONIC STEM CELLS |
a Department of Ophthalmology, The Hadassah Human Embryonic Stem Cell Research Center of the Goldyne Savad Institute of Gene Therapy, and the
b Departments of Gynecology,
c Neurology, and
d Pathology, Hadassah-Hebrew University Medical Center, Jerusalem, Israel
Key Words. Human embryonic stem cells • Differentiation • Retina • Transplantation • Photoreceptors
Correspondence: Benjamin Reubinoff, M.D., Ph.D., The Hadassah Human Embryonic Stem Cell Research Center, The Goldyne Savad Institute of Gene Therapy & Department of Gynecology, Hadassah University Hospital, P.O. Box 12,000, Ein-Kerem, Jerusalem 91120, Israel. Telephone: +972-2-6778589; Fax: +972-2-6430982; e-mail: reubinof{at}md.huji.ac.il
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Cell therapy is considered a potential therapeutic approach that may restore or sustain retinal function and prevent blindness in patients with retinal degeneration [5]. As such, retinal engraftment of embryonic or fetal retinal tissue, brain-derived neural precursors (NPs), nonhuman primate and rodent embryonic stem cells (ESCs), bone marrowderived stem cells, and retinal progenitors have been attempted [1, 616]. It has been shown in a number of animal models that survival, differentiation, and even limited connectivity of such grafts with the host retina can be achieved, thus supporting the concept of cell therapy for the injured or degenerating retina. Effective clinical application of this approach is as yet unrealized, mainly because of the difficulty in achieving functional integration of grafted tissue.
Whereas the use of human fetal tissue is limited by ethical considerations and insufficient supply, human ESCs (hESCs) may serve as an unlimited source of neural cells for retinal transplantation therapy. We have developed methods that allow the derivation of highly enriched (>95%), expandable populations of developmentally competent NPs from hESCs [17]. In this study, we examined their integration, differentiation after intraocular transplantation, as well as their potential to adopt a retinal fate. We show that the NPs express key regulatory genes of ocular and retinal differentiation in vitro. Furthermore, after transplantation into the subretinal space, the NPs differentiate into cells expressing retina- and photoreceptor-specific markers. To the best of our knowledge, this is the first report showing the potential of hESCs to differentiate toward a photoreceptor fate.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(EF1
) promoter, according to our described protocol [19]. The percentage of infected cells and intensity of transgene expression were analyzed on a FACS Calibur system (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). To induce neural differentiation, clumps of undifferentiated hESCs were plated on fresh mitotically inactivated mouse feeders and cultured for 8 days in medium comprised of Dulbeccos modified Eagles medium (DMEM) (Gibco-BRL, Gaithersburg, MD, http://www.gibcobrl.com) containing glucose 4.5 g/l without sodium pyruvate, supplemented with 10% fetal bovine serum (HyClone, Logan, UT, http://www.hyclone.com), 0.1 mM beta-mercaptoethanol, 1% nonessential amino acids, 2 mM glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin (Gibco-BRL), and 500 ng/ml noggin (R&D Systems Inc., Minneapolis, http://www.rndsystems.com). The cells were then further cultured in the same medium in the absence of noggin for an additional 5 days. At this time, 70%90% of the colonies differentiated almost uniformly into tightly packed small cells with a uniform gray opaque appearance under dark-field stereomicroscopy. Patches containing approximately 150 cells each were dissected from the gray opaque areas using a razor blade (surgical blade no. 15) and replated in serum-free medium that consisted of DMEM/F12 (1:1), B27 supplementation (1:50), glutamine 2 mM, penicillin 50 U/ml, and streptomycin 50 µg/ml (Gibco-BRL) and that was supplemented with 20 ng/ml human recombinant epidermal growth factor (EGF) and 20 ng/ml basic fibroblast growth factor (bFGF) (R&D Systems Inc.). The clusters of cells developed into round spheres that were subcultured once a week as previously described [17]. The medium was replaced twice a week.
Immunofluorescent Studies In Vitro
Standard protocols were used for the immunophenotyping of disaggregated progenitor cells and differentiated cells after fixation with 4% paraformaldehyde. Primary antibodies were detected by using goat anti-mouse immunoglobulin M (IgM) conjugated to Texas Red (1:100), goat anti-rabbit Ig conjugated to Texas Red (1:500), goat anti-mouse IgG conjugated to CyTH3 (1:500), rhodamine RedTM-conjugated donkey anti-goat IgG (1:500; all from Jackson ImmunoResearch Laboratories, Inc, West Grove, PA, http://www.jacksonimmuno.com), and swine anti-rabbit Ig conjugated to fluorescein isothiocyanate (FITC) (1:50; DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.dk). Proper controls for primary and secondary antibodies were used to rule out nonspecific staining or cross-reactivity between antibodies.
To characterize the immunophenotype of cells within the aggregates, spheres cultivated for 4 weeks were partially disaggregated by mechanical means, and the resulting small clumps and single cells were plated in serum-free medium, as described above, on poly-D-lysine (3070 kDa, 10 µg/ml) and laminin (4 µg/ml; both from Sigma, St. Louis, http://www.sigmaaldrich.com). The cells were fixed after 18 hours and examined for the expression of NCAM (mouse IgG 1:10; DakoCytomation), nestin (rabbit antiserum, 1:25, a kind gift of Dr. Ron McKay, or rabbit anti-human 1:100200; Chemicon International, Inc., Temecula, CA, http://www.chemicon.com), A2B5 (mouse clone 105 1:20; American Type Culture Collection, Manassas, VA, http://www.atcc.org), and polysialic acid (PSA)NCAM (mouse undiluted; Developmental Studies Hybridoma Bank, Iowa City, IA, http://www.uiowa.edu/~dshbwww, or mouse IgM 1:200; Chemicon International, Inc.).
To induce differentiation, spheres that were 4 weeks in culture were disaggregated into small clumps and plated on poly-D-lysine and laminin in serum-free growth medium (as described above) without supplementation of growth factors for 23 weeks. The medium was supplemented with the survival factors neurotrophin-3 (NT3) 10 ng/ml, NT4 20 ng/ml, and brain-derived neurotrophic factor (BDNF) 10 ng/ml (all human recombinants from R&D Systems Inc.) when the expression of retinal progenitor markers was examined. Differentiated cells were analyzed for the expression of ß-tubulin III (mouse IgG 1:2,000; Sigma), neurofilament 70 (mouse IgG1, 1:50; Dako-Cytomation), neurofilament 160 (mouse IgG1, 1: 50; Chemicon International, Inc.), microtubule-associated protein 2ab (MAP2ab) (rabbit polyclonal, 1:100; Chemicon International, Inc.), glial fibrillary acidic protein (GFAP) (rabbit polyclonal, 1:200; DakoCytomation),
-aminobutyric acid (GABA) (rabbit polyclonal, 1:500; Sigma), glutamate (rabbit polyclonal, 1:2,000; Sigma), Pax6 (mouse monoclonal IgG1, 1:100; Developmental Studies Hybridoma Bank), Chx10 (rabbit polyclonal, 1:500, kindly provided by Roderick R. McInnes, Toronto), cone-rod homeobox (CRX) (rabbit polyclonal, 1:2,500, kindly provided by Cheryl Y. Gregory-Evans, London), rhodopsin (mouse IgG1 1:500; Lab Vision Corporation, Fremont, CA, http://www.labvision.com), blue-sensitive opsin (goat polyclonal, 1:500; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, http://www.scbt.com), neural retina leucine zipper (NRL) (rabbit polyclonal, 1:2,000; generously donated by Dr. Anand Swaroop, University of Michigan, Ann Arbor, MI), serotonin (rabbit polyclonal, 1:1,000; Sigma), and tyrosine hydroxylase (TH) (mouse IgG1, 1:500; Sigma). For quantitative analysis of marker expression, 200500 cells were scored within random fields (at x400) for the expression of the markers, and the experiments were repeated at least three times.
Reverse TranscriptionPolymerase Chain Reaction Analysis
Total RNA was extracted from (a) hESCs grown under serum-free conditions (1 week after passage), (b) free-floating spheres after 4 weeks in culture, and (c) differentiated cells growing from the spheres at 2 weeks after plating in differentiation-inducing conditions, as detailed above. The medium used to induce differentiation was supplemented with a combination of ascorbic acid 400 µM (Sigma) and the survival factors NT3 10 ng/ml, NT4 20 ng/ml, and BDNF 10 ng/ml (all human recombinants from R&D Systems Inc.). Total RNA was isolated using RNA STAT-60 solution (Tel-Test, Friendswood, TX, http://www.isotexdiagnostics.com) or TRI-reagent (Sigma) followed by treatment with RNase-free DNase (Ambion, Inc., Austin, TX, http://www.ambion.com). cDNA synthesis was carried out using Moloney murine leukemia virus reverse transcription (RT) and oligo (dT) as a primer, according to the manufacturers instructions (Promega Corporation, Madison, WI, http://www.promega.com). To analyze relative expression of different mRNAs, the amount of cDNA was normalized based on the signal from glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. Levels of different mRNAs expressed by neural spheres and differentiated cells were compared with that in undifferentiated hESCs. Polymerase chain reaction (PCR) was carried out using standard protocols with Taq DNA Poly-merase (Gibco-BRL). Amplification conditions were as follows: denaturation at 94°C for 15 seconds, annealing at 55°C64°C for 30 seconds, and extension at 72°C for 45 seconds. The number of cycles varied between 18 and 40, depending on particular mRNA abundance. Primer sequences (forward and reverse 5'3') and the length of the amplified products were as follows:
Oct4 (CGTTCTCTTTGGAAAGGTGTTC, ACACTCGGACCACGTCTTTC; 320 bp)
Six3 (CAAGTCCACACACACTCCCAC, CGTCATGCAGGTGGGGTGC; 254 bp)
Six6 (CCTGCAGGATCCATACCCTA, TGATGGAGATGGCTGAAGTG; 272 bp)
Rx (CTGAAAGCCAAGGAGCACATC, CTCCTGGGAATGGCCAAGTTT; 408 bp)
Pax6 (AACAGACACAGCCCTCACAAACA, CGGGAACTTGAACTGGAACTGAC; 274 bp)
Lhx2 (CCAAGGACTTGAAGCAGCTC, TGCCAGGCACAGAAGTTAAG; 285 bp)
Chx10 (GGCGACACAGGACAATCTTT, ATCCTTGGCTGACTTGAGGA; 281 bp)
Crx (GTGTGGATCTGATGCACCAG, TGAGATGCCCAGAGGGTCT; 352 bp)
Nrl (AGAGCGCCTTCTGGTCCTAG, GCATCTCGGATAGAGGTCCT; 421 bp)
Recoverin (TGTGTTCCGCAGCTTCGATT, TGAGGCTCAAACTGGATCAG; 368 bp)
OpsinB (GGTCACTGGCCTTCCTGG, TGCAGGCCCTCAGGGATG; 176 bp)
GAPDH (AGCCACATCGCTCAGACACC, GTACTCAGCGCCAGCATCG; 301 bp).
Subretinal Transplantation of NPs
Animals. A total of 23 adult (body weight 230250 g) and 38 newborn (23 days old) outbred Sabra rats were used in the present study, in three separate experimental cycles. All animal experiments were conducted according to the ARVO (Association for Research in Vision and Ophthalmology) Statement for the Use of Animals in Ophthalmic and Vision Research and approved by the institutional committee for animal research. Newborn rats were kept with their mothers until 34 weeks of age.
For intraocular injections, adult animals were anesthetized with Ketamine HCl (100 mg/kg Ketalar; Parke Davis, U.K., http://www.parke-davis.com), injected intraperitoneally in combination with the relaxing agent Xylazine (2.0 mg/kg). Local anesthetic drops (Benoxinate HCl 0.4%; Fischer Pharmaceuticals, Tel Aviv, Israel, http://www.dr-fischer.com) were administered. In newborn rats, injections were executed under ether anesthesia (ether absolute; Bio-Lab Ltd., Jerusalem, Israel, http://www.bio-lab.co.il) in combination with local anesthetic drops. The pupils were dilated with Tropicamide 0.5% (Mydramide; Fisher Pharmaceuticals, Tel Aviv, Israel) and Phenylephrine HCl 2.5% (Fisher Pharmaceuticals, Israel). Animals were kept warm during and after the procedure, using a heating lamp. After transplantation, all animals received the immunosuppressive agent cyclosporine A (50 mg/ml Sandimmune; Novartis Pharma AG, Basel, Switzerland, http://www.novartis.com) in their drinking water at a concentration of 210 mg/l.
Intraocular Injections. Glass capillaries were pulled from filaments (1.2 x 0.68 mm; A-M Systems, Inc., Everett, WA, http://www.a-msystems.com) on a P97 Flaming/Brown micropipette puller (Sutter Instrument Company, Novato, CA, http://www.sutter.com). After systemic and local anesthesia, eyes were exposed; in newborns, gentle dissection was performed to separate the closed eyelids. Under visualization of a dissecting microscope (Stemi SV 11; Carl Zeiss, Jena, Germany, http://www.zeiss.com), the glass capillary, coupled to a pneumatic Pico-injector (PLI-100; Medical System Corp., Greenvale, NY, http://www.medicalsystems.com), was inserted via a transscleral, transchoroidal approach, and 13 µl of neural progenitor cell suspension at a concentration of 25,00075,000 cells per µl was injected into the subretinal or vitreal space. Fellow, noninjected eyes served as one type of control. As an additional control, four newborn and four adult eyes were injected with saline (Sodium Chloride Injection BP, 0.9%; B. Braun Melsungen AG, Melsungen, Germany, http://www.bbraun.com). During and after injection, no choroidal bleeding was observed.
Histology
At 1 week, 2 weeks, and 1, 1.5, 2, 3, and 4 months postinjection, animals were sacrificed and eyes were enucleated for histological and immunohistochemical examination. After transcardial perfusion with 4% paraformaldehyde in 0.1 M phosphate buffer, eyes were embedded in paraffin and sectioned at 4-µm serial sections. Each fifth slide was stained with hematoxylin and eosin for histomorphologic evaluation.
Immunohistological Studies
Specimens were de-parafinized in xylene and dehydrated in graded alcohols, rinsed with phosphate-buffered saline (PBS, pH 7.4), and incubated with 10 mM citrate buffer (pH 6.0) at 110°C for 4 minutes. After washing with PBS, specimens were blocked for 1 hour at room temperature with PBS solution containing 1% bovine serum albumin, 0.1% triton-x100, and 3% normal goat serum. When necessary, goat serum was replaced by donkey serum in the blocking solution. Subsequently, sections were incubated for 48 hours at 4°C in a humidified chamber with one of the following primary antibodies: anti-GFP (rabbit polyclonal, 1:100; Santa Cruz Biotechnology, Inc.), anti-rhodopsin (mouse monoclonal, 1:100; Lab Vision Corporation), anti-human mitochondria (mouse monoclonal, 1:20; Lab Vision Corporation), antiblue-sensitive opsin (goat polyclonal, 1:100; Santa Cruz Biotechnology, Inc.), anti-NRL (rabbit polyclonal, 1:2,000; generously donated by Dr. Swaroop), antiGFAP (rabbit polyclonal, 1:100; DakoCytomation), antineurofilament 70 (mouse monoclonal, 1:100; Chemicon International, Inc.), antiß-tubulin III (mouse monoclonal, 1:400; Sigma), anti-human KI-67 antigen (mouse monoclonal, 1:50; DakoCytomation), anti-synaptophysin (mouse monoclonal, 1:20; DakoCytomation), and antiCaspase-3 (rabbit polyclonal, 1:50; Santa Cruz Bio-technology, Inc.). After washing in PBS, specimens were incubated for 1 hour at room temperature with one of the following secondary antibodies: Texas Redconjugated goat anti-mouse IgG (1:100), CyTM2-conjugated goat anti-rabbit IgG (1:200), CyTM2-conjugated goat anti-mouse IgG (1:200), CyTM5-conjugated goat anti-rabbit IgG (1:200), and rhodamine RedTM-Xconjugated donkey anti-goat IgG (1:200; all from Jackson ImmunoResearch Laboratories, Inc.). Nuclei were counterstained with 4, 6-diamidino-2-phenylindole (DAPI)containing mounting medium (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com). To determine the specificity of the antigenantibody reaction, corresponding negative controls with an irrelevant isotype-matched antibody were performed. A Zeiss Axiovert 200 microscope equipped with Sensi Cam 12 Bit imaging was used for fluorescent and light microscopy imaging. Confocal images were acquired using a Zeiss LSM 410 confocal laser scanning system attached to a Zeiss Axiovert 135 M inverted microscope. Channels for rhodamine, Cy2, Cy5, and UV fluorescence were used, in addition to Nomarsky optics. All double-labeled cells were analyzed at multiple consecutive planes to ensure the colocalization of nuclear, cytoplasmic, or membranal signals to the same cell.
Quantification
The number of engrafted cells was counted in a total of eight eyes (four with subretinal grafts, 816 weeks after transplantation and four with intravitreal grafts, 4 weeks after transplantation) using methods previously published [20]. Briefly, the area and borders of the grafts were defined by anti-GFP staining, and nuclei of hESC-derived cells were counted in sequential 4-µm sections, 60 µm apart, using a computerized image analysis system (Image-Pro version 4.1; Media Cybernetics, Silver Spring, MD, http://www.mediacy.com). Cell counts from serial sections were corrected according to the Abercrombie method (1946) and adjusted to the total size of the graft [21]. In five eyes with subretinal grafts, sections were available for counting of Rhodopsin+ (Rho+) cells. In each eye, four sections from the main area of the graft were randomly selected for quantification. In each section, the percentage of cells that coexpressed Rhodopsin and GFP out of the total number of engrafted cells was calculated.
| RESULTS |
|---|
|
|
|---|
promoter was accomplished using a lentiviral vector system, according to our published protocol [19]. Differentiation of hESCs (Fig. 1A
|
|
|
Thus, we were able to establish highly enriched cultures of hESC-derived NPs that express key genes of retinal and photoreceptor development, as well as transcripts of markers of mature photoreceptors. However, under our differentiation-inducing culture conditions, the NPs failed to express these markers at the protein level.
Survival, Incorporation, and Differentiation of the NPs After Transplantation into Rat Eyes
Given the potential of the NPs to express key regulatory genes of retinal development in vitro, we hypothesized that further differentiation of the hESC-derived NPs into retinal neurons may be brought about by inductive signals operative in the retinal microenvironment. To test this hypothesis, we examined whether the ocular microenvironment, and specifically the subretinal space, could promote further differentiation of the NPs toward a retinal fate. Single-cell suspension of NPs derived and propagated 4 weeks in culture were engrafted into the subretinal and/or vitreal space in 19 adult and 34 neonatal (2- to 3-day-old) rats. Sixty thousand to one hundred thousand NPs were engrafted per eye. The rats were sacrificed for histopathological analysis of the grafts at sequential time points between 1 and 16 weeks after transplantation. Vehicle-transplanted rats (four adult rats and four neonates) served as controls.
Localization and Migration of Grafted Cells
Indirect immunofluorescence and immunohistochemical staining with anti-GFP, human-specific anti-mitochondrial, and anti-human Ki67 confirmed the presence of human cells in 8 out of 19 (42%) transplanted adult eyes and in 15 out of 34 (44%) neonatal eyes (Figs. 4D4L
, 5B, 5C, 5E, 5F, 5H, 5I, 5K, 5M, 5O
, 6D, 6I, and 6N
). The residual eyes, namely 11 of 19 (58%) adult and 19 of 34 (56%) neonate eyes, were considered as failed transplantation. Human-derived cells were identified as late as 16 weeks post transplantation, the latest time point examined (Table 1
). In most cases (19 of 23 successfully transplanted eyes), large main grafts were present (e.g., Figs. 4A4C
), presumably reflecting the site of injection (Table 1
).
|
|
|
|
In eyes with large clusters of human-derived cells at the sites of injection, immunohistochemical analysis also demonstrated dispersed transplanted cells across the retina, singly or in small clusters, and often quite distant from the main graft (Figs. 4E4I
). There was a marked difference between eyes with subretinal grafts versus eyes with vitreal grafts in this regard. Subretinal grafts remained mostly clustered at the site of injection (Fig. 4D
), and there was only a little dissemination within the host photoreceptor outer segment layer (Fig. 4E
), probably via migration within the subretinal space (between the photoreceptor outer segments and the RPE). Only a small number of cells migrated from the subretinal cluster and penetrated the outer nuclear layer (ONL) to the more inner layers of the retina (not shown). In contrast, vitreal grafts were associated with wide dispersion of the transplanted cells, especially in newborn-injected eyes. In these eyes, GFP+ cells penetrated and migrated in the retina, mainly within the inner plexiform layer (IPL, Figs. 4F4I
). At 1216 weeks after transplantation, GFP+ cells had migrated to parts of the IPL quite distant from the main graft (Fig. 4F
). There were additional GFP+ cells in the nerve fiber and ganglion cell layers, whereas only a few cells migrated into the inner nuclear layer (INL, Figs. 4F, 4G
). Interestingly, the grafted cells that were integrated in the IPL often had GFP+ processes extending within this layer (Fig. 4H
) and were immunoreactive with anti-Synaptophysin (Figs. 4J4M
). However, it is not clear whether this implies any connectivity between the grafted cells and the host retina. Human cells and GFP+ processes were also observed in the nerve fiber layer and the proximal part of the optic nerve (Fig. 4I
).
There was marked variability in the number of engrafted cells seen in different eyes. The total number of engrafted cells within four subretinal and four intravitreal grafts was evaluated by counting in serial sections throughout the whole graft followed by adjustment for the total size of the graft. The four subretinal grafts contained a mean of 197,481 ± 62,070 cells 816 weeks after transplantation, and 55,611 ± 24,162 cells were found within the four intravitreal grafts 4 weeks after transplantation. Because delivery of 60,000100,000 cells was attempted per eye, proliferation of transplanted cells obviously occurred in at least some of the eyes, as detailed below.
Proliferative State of Grafted Cells
A potential complication after transplantation of hESC-derived differentiated progeny is the formation of teratoma tumors [6]. We did not observe teratomas in any of the transplanted animals. Still, proliferation of transplanted precursors, analyzed by Ki67 expression, was observed throughout the 16-week follow-up period (Figs. 4O, 4P
, 5E
). Occasionally, the NPs formed rosette structures (Figs. 4P
, 5E
). The percentage of Ki67+ cells out of the total number of grafted cells within a cluster or layer was determined by counting the number of GFP+ grafted cells in an adjacent (4 µmapart) section (e.g., Figs. 4N, 4O
) or by counting the total number of nuclei within morphologically defined grafts (e.g., Fig. 5E
). Whereas 46.8% ± 2.3% (mean ± SE) of the NPs expressed Ki67 in vitro, just before transplantation, the percentage declined to 10.0% ± 2.4% in vivo (± SEM, n = 16 grafts, analyzed at 216 weeks post transplantation). The percentage of Ki67+ cells was similar in grafts analyzed 24 weeks after transplantation, compared with 816 weeks post transplantation (8.5% ± 3.1% [n = 9 grafts] versus 12.1% ± 3.8% [n = 7 grafts], respectively; p = .47). Cells expressing Ki67 were more abundant within large clusters of grafted cells, especially in areas with rosette-like formations, and less often seen among dispersed cells. The extent of apoptosis was evaluated within four grafts, 412 weeks after transplantation, by immunostaining with antiCaspase-3. Engrafted cells expressing Caspase-3 were only rarely observed.
Fate and Differentiation of Transplanted Cells
Indirect immunofluorescence studies using cell typespecific antibodies demonstrated the differentiation of the transplanted NPs into glial and neuronal lineages within both subretinal and intravitreal grafts. Cells immunoreactive with anti-GFAP antibodies, a marker of astroglial cells, were frequently observed (Figs. 5A, 5C, 5J, and 5K
). Cells that expressed the neuronal markers ß-tubulin III and light-chain neurofilament (NF70) were also abundant within the grafts (Figs. 5D, 5F, 5L, 5M
[NF70] and 5G, 5I, 5N, 5O
[ß-tubulin III]). In areas of the grafts with abundant Ki67+ cells (Fig. 5D
), the expression of NF70 was markedly reduced (Fig. 5E
), suggesting that the cells within these areas were at a lower state of differentiation.
To test the capability of the ocular microenvironment to promote the differentiation of engrafted NPs into photoreceptor cells, we analyzed the expression of photoreceptor-specific markers by the engrafted cells (Fig. 6
). Double-labeling studies showed cells that coexpressed human-specific markers and the photoreceptor markers NRL, blue cone opsin, and rhodopsin (Fig. 6
) in seven eyes. It should be noted that we did not observe transplanted cells with fully formed inner and outer segments, characteristic of mature photoreceptors. Rather, rhodopsin and blue cone opsin expression was observed in the cytoplasm of round and elliptical cells (Figs. 6H, 6J, 6M, and 6O
). In addition, transplanted cells expressing photoreceptor markers were infrequently observed. They were present only in subretinal grafts (7 of 11 subretinal grafts in which this was examined) and were not detected within intravitreal (nine eyes examined) or inner retinal grafts (one eye). These cells tended to appear in clusters within small regions of the grafts. In areas of Ki67+ rosettes, as with the NF-70 marker, such cells were not present. The mean percentage of rhodopsin+ cells out of the total number of engrafted cells was 1.47% ± 0.39% (n = 5 subretinal grafts). The presence of such cells in only the subretinal, but not in the intravitreal, grafts suggests that the subretinal compartment expressed signals and cues that were required to promote photoreceptoral differentiation of transplanted cells.
| DISCUSSION |
|---|
|
|
|---|
The concept of replacing dysfunctional or degenerated retina by transplantation has been developing ever since the first retina-to-retina transplant in 1986 [41]. In most studies, primary retinal immature (fetal) tissue has been used as donor material (for review, see [1]). It was demonstrated that such transplants can survive, differentiate, and even establish connections with the host retina to a limited degree [8, 9]. However, attempts to apply this approach clinically have not been effective thus far, mainly due to difficulties in establishing fully functional integration and perhaps have also been compounded by inflammatory or immune responses [42]. Moreover, even once these difficulties are overcome, the use of fetal retinal tissues for transplantation is severely limited by ethical constraints and practical problems in obtaining sufficient tissue supply.
An alternative approach to engrafting primary fetal retinal tissue is transplantation of NP cells. Indeed, this has recently been reported in newborn and adult normal, as well as dystrophic, animal eyes. Adult rat hippocampal progenitor cells, spinal precursor cells, as well as brain-derived precursor cell lines have been used. Survival of the cells, integration into different retinal layers, and partial differentiation into glial- and neuron-like cells were shown [1012]. However, in contrast to our findings, differentiation toward a photoreceptor fate was not observed. Given the early embryonic origin and pluripotent nature of hESCs, it is possible that the early NPs derived from them may have a broader developmental and functional potential than the NPs derived from specific regions of adult or fetal brains, which were used in the majority of the aforementioned retinal studies. This concept is further supported by recent transplantation studies showing that mouse ESCderived neural progeny could differentiate into functional dopaminergic neurons after transplantation to Parkinsonian rats [4345]. This result has been largely unattainable when NPs derived from fetal or adult brains were transplanted [4648]. Very recently, retinal progenitor cells harvested from 1-day-old mice [15] and retinal stem cells isolated from the pars plana and pars plicata in humans [16] were shown to develop into mature retinal cells (including photoreceptors), and this may provide an exciting new source for cells for retinal regeneration. Interestingly, transdifferentiation of bone marrowderived stem cells into retinal cells expressing rhodopsin after transplantation into rat eyes, was also recently reported [13, 14]. It remains to be seen whether retinal cells transdifferentiated from non-neural stem cells will function in animal models of retinal degeneration. Additional characterization and analysis of function of putative retinal cells originating from retinal stem cells, transdifferentiation processes, ESCs, and neural stem cells are required, and it is too early in the current experimental phase to predict which type of cells will ultimately prevail in retinal transplantation therapy.
The precise cellular and molecular mechanisms that govern the development of the eye and retina are far from being completely understood. Experimental evidence in vertebrates suggests that a highly conserved self-regulatory genetic network of transcription factors plays crucial roles in morphogenesis of the eye and retinal development [23, 25, 27, 28]. The hESC-derived NPs in this study expressed many of the known key transcription factors in eye development, suggesting that they had the developmental potential to further differentiate into retinal cells.
Based on current knowledge, it appears that differentiation into the various principal cell types of the retina is probably determined by a state of intrinsic competence conferred by the transcriptional programs discussed above, that allows response to environmental cues present at the appropriate time [49]. Such extrinsic signals that augment the differentiation of progenitors to photoreceptors may include taurine [50], vasoactive intestinal peptide, retinoic acid [51], sonic hedgehog [52, 53], and activin [54]. The observation in the present study that expression of markers of mature photoreceptors was observed only in grafted cells located in the subretinal space but not in human cells transplanted into the vitreous or allowed to differentiate spontaneously in vitro, may be related to the requirement for such site-specific extrinsic cues. The percentage of transplanted cells expressing photoreceptoral markers was low, and this may reflect lack of intrinsic competence in a majority of the transplanted cells. Further studies aimed at identifying those factors and conditions that will confer increased intrinsic competence as well as provide the necessary extrinsic cues for retinal and photoreceptoral differentiation are needed. Interestingly, differentiation of human neural stem cells into retinal cells expressing opsin was recently reported after treatment with human transforming growth factor ß3 [55].
In this study, we have shown for the first time the incorporation of hESC-derived NPs in the retina, accompanied by expression of photoreceptor-specific markers in a small percentage of the cells. Whereas our observations point out the potential of hESCs for retinal transplantation, the data also highlight key issues that need further analysis in future studies. Our data showed that delivery of transplanted cells to the appropriate location within the retina is not a trivial matter. Both in newborn and adult eyes, migration of engrafted precursors within the subretinal environment, that could promote differentiation toward a photoreceptor fate, was very limited. Whereas transplanted cells from intravitreal grafts were more extensively disseminated throughout the inner retina, the NPs migrated mainly within the IPL, and integration within the INL was sparse. Transplantation of NPs into the brain at the acute stage of stroke or in an inflammatory disease results in their migration toward the lesion and differentiation into the type of cells that were injured [56, 57]. In the eye, similar observations have been reported, with transplanted cells incorporating more readily in injured, compared with intact, retinas [58]. It remains to be seen whether degenerative processes of photoreceptors in the retina will promote a similar course with hESC-derived precursors.
Function of the grafts and connectivity with the host tissue were not assessed in the current study. Interestingly, transplanted cells, especially those dispersed in the IPL, often exhibited GFP+ neurites and extensions in between neighboring host cells, and some also expressed synaptophysin, a synaptic marker. A few very long processes were even identified in the optic nerve exiting the eye. It is not known whether these extensions represent any functional connectivity. Clearly, this is also an issue requiring further study. The fact that transplanted ESC-derived progeny was shown to be functional in other animal models of neurodegenerative conditions is encouraging in this regard [44].
Transplantation of undifferentiated ESCs is known to be associated with teratoma tumor formation. This complication was recently reported after subretinal transplantation of mouse ESCderived neural cells [6]. Here, the hESCs were directed to differentiate in vitro into highly enriched cultures of NPs prior to transplantation. These cultures most probably did not include undifferentiated hESCs, as suggested by the lack of expression of the transcription factor Oct4, a marker of undifferentiated ESCs. Accordingly, teratoma tumors were indeed not observed in the recipient animals. However, although a reduction in the level of proliferation of the NPs was observed after transplantation, proliferating grafted cells expressing Ki67 were still present after a prolonged follow-up of 16 weeks. This finding is in line with the observation in many eyes that the total number of engrafted cells, a few weeks postinjection, exceeded the number of cells originally transplanted. It highlights the requirement for extensive long-term studies to determine the safety of hESC-derived neural progeny transplantation.
Summary
The present study shows that hESCs can be directed in vitro to form NPs that express genes associated with retinal differentiation. Subsequently, transplantation of these cells into the local microenvironment of the subretinal space in rats allowed further differentiation and expression of specific markers of mature photoreceptors in a small percentage of cells. Whereas this subpopulation of differentiated cells is clearly not composed of fully formed photoreceptors, our findings do show that this approach is feasible and that by combining in vitro manipulation with the proper in vivo environment, differentiation toward a retinal fate can be achieved. These initial findings may be the first step toward the potential use of hESCs for future transplantation therapy of retinal degeneration.
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
DISCLOSURES
The authors indicate no potential conflicts of interest.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
N. D. Bull, G. A. Limb, and K. R. Martin Human Muller Stem Cell (MIO-M1) Transplantation in a Rat Model of Glaucoma: Survival, Differentiation, and Integration Invest. Ophthalmol. Vis. Sci., August 1, 2008; 49(8): 3449 - 3456. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Singhal, J. M. Lawrence, B. Bhatia, J. S. Ellis, A. S. Kwan, A. MacNeil, P. J. Luthert, J. W. Fawcett, M.-T. Perez, P. T. Khaw, et al. Chondroitin Sulfate Proteoglycans and Microglia Prevent Migration and Integration of Grafted Muller Stem Cells into Degenerating Retina Stem Cells, April 1, 2008; 26(4): 1074 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Limb and J. T. Daniels Ocular regeneration by stem cells: present status and future prospects Br. Med. Bull., March 1, 2008; 85(1): 47 - 61. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang, B. Lu, S. Girman, T. Holmes, N. Bischoff, and R. D. Lund Morphological and Functional Rescue in RCS Rats after RPE Cell Line Transplantation at a Later Stage of Degeneration Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 416 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Klassen, J. F. Kiilgaard, T. Zahir, B. Ziaeian, I. Kirov, E. Scherfig, K. Warfvinge, and M. J. Young Progenitor Cells from the Porcine Neural Retina Express Photoreceptor Markers After Transplantation to the Subretinal Space of Allorecipients Stem Cells, May 1, 2007; 25(5): 1222 - 1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. T. Oh, N. Khan, E. Novelli, H. Khanna, E. Strettoi, and A. Swaroop From the Cover: Transformation of cone precursors to functional rod photoreceptors by bZIP transcription factor NRL PNAS, January 30, 2007; 104(5): 1679 - 1684. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Canola, B. Angenieux, M. Tekaya, A. Quiambao, M. I. Naash, F. L. Munier, D. F. Schorderet, and Y. Arsenijevic Retinal Stem Cells Transplanted into Models of Late Stages of Retinitis Pigmentosa Preferentially Adopt a Glial or a Retinal Ganglion Cell Fate Invest. Ophthalmol. Vis. Sci., January 1, 2007; 48(1): 446 - 454. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mimeault and S. K. Batra Concise Review: Recent Advances on the Significance of Stem Cells in Tissue Regeneration and Cancer Therapies Stem Cells, November 1, 2006; 24(11): 2319 - 2345. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |