Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online August 18, 2005
Stem Cells Vol. 24 No. 2 February 2006, pp. 266 -273
doi:10.1634/stemcells.2005-0204; www.StemCells.com
© 2006 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0204v1
24/2/266    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacham-Kaplan, O.
Right arrow Articles by Trounson, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacham-Kaplan, O.
Right arrow Articles by Trounson, A.

EMBRYONIC STEM CELLS

Testicular Cell Conditioned Medium Supports Differentiation of Embryonic Stem Cells into Ovarian Structures Containing Oocytes

Orly Lacham-Kaplan, Hun Chy, Alan Trounson

Monash Immunology and Stem Cell Laboratories, Monash University, Clayton, Australia

Key Words. Embryonic stem cells • Germ stem cells • Testicular cell cultures • Conditioned medium • Oocytes

Correspondence: Orly Lacham-Kaplan, Ph.D., Monash Immunology and Stem Cell Laboratories, Monash University, Wellington Rd., Clayton, Australia 3165. Telephone: 61-3-99050781; Fax: 61-3-99050680; e-mail: Orly.Lacham-kaplan{at}med.monash.edu.au


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous reports and the current study have found that germ cell precursor cells appear in embryoid bodies (EBs) formed from mouse embryonic stem cells as identified by positive expression of specific germ cell markers such as Oct-3/4, Mvh, c-kit, Stella, and DAZL. We hypothesized that if exposed to appropriate growth factors, the germ cell precursor cells within the EBs would differentiate into gametes. The source for growth factors used in the present study is conditioned medium collected from testicular cell cultures prepared from the testes of newborn males. Testes at this stage of development contain most growth factors required for the transformation of germ stem cells into differentiated gametes. When EBs were cultured in the conditioned medium, they developed into ovarian structures, which contained putative oocytes. The oocytes were surrounded by one to two layers of flattened cells and did not have a visible zona pellucida. However, oocyte-specific markers such as Fig-{alpha} and ZP3 were found expressed by the ovarian structures. The production of oocytes using this method is repeatable and reliable and may be applicable to other mammalian species, including the human.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Mouse and human embryonic stem cells (ESCs) differentiate spontaneously into germ cell precursor cells in vitro as identified by expression of a variety of germ cell markers [1–4]. When isolated, the germ stem cells will progress in gamete differentiation toward putative sperm [2, 3]. When left intact with other cells, they may differentiate into oocytes [1]. These discoveries have raised the possibility that, in the future, sterility due to lack of germ cells could be treated using stem cell therapy.

In vivo, growth factors that mediate local cell–cell interactions are responsible for the differentiation of primordial germ cells (PGCs) into germ stem cells and oogonia [5] after the arrival at the genital ridge. The growth factors’ role changes according to the gender. As a result, in the ovary, PGCs enter prophase of the first meiotic division to become oocytes [6], while those in the testis become mitotically arrested at the prospermatogonial stage [7]. Similarly, in vitro differentiation of PGCs is also dependent on their sequential exposure and response to an array of growth factors [5]. In the presence of multiple growth signals, PGCs restart rapid proliferation in vitro and transform into pluripotent embryonic germ cells (EGCs) [8–10]. It is believed that EGCs formed in vitro are equivalent to PGCs and that ESCs differentiate into those cells before further differentiation into germ cells [11]. When continuously supported by growth factors, EGCs form colonies of immortal cells that propagate in culture for many generations without losing their pluripotency. Significant growth factors involved in maintenance of EGCs are leukemia inhibitory factor (LIF), basic fibroblast growth factor (ßFGF), and stem cell factor (SCF) [8, 9, 12–15]. Exposure to other growth factors in vivo, or in vitro, results in these cells differentiating into a variety of cell types, including gonadal cells [10, 11, 16].

The testis is an abundant source of numerous growth factors such as bone morphogenetic protein 4 (BMP-4), SCF, LIF, ß-FGF, growth differentiation factor-9 (GDF-9), and many others [17–20]. The present study examined the effects of conditioned medium collected from crude testicular cell cultures (TCCs) on the differentiation of mouse ESCs into germ cell precursor cells and putative gametes. We have found that conditioned medium prepared from newborn testes supports the differentiation of ESCs into putative ovaries containing oocytes.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mouse ESC Culture
Male mouse ESCs (kindly donated by Dr. Peter Mountford, Stem Cell Sciences, Clayton, Australia) were cultured on gelatine (0.1%; Sigma, Castle Hill, Australia, http://www.sigmaaldrich.com)–coated 50-ml plastic flasks (Falcon, Becton Dickinson, Lane Cove, Australia, http://www.bectondickinson.com.au) in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco–Life Technologies, Mulgrave, Australia, http://www.invitrogen.com) supplemented with 10% fetal calf serum (FCS) (Australian-made; Gibco–Life Technologies, batch no. 12021565) and recombinant mouse LIF (1,000 IU/ml; Chemicon, Boronia, Australia, http://www.chemicon.com), 1% w/w nonessential amino acids (Gibco–Life Technologies), 1 mM ß-mercaptoethanol (Sigma), and 1% w/w penicillin/streptomycin (Gibco–Life Technologies). Flasks were incubated at 37°C in 5% CO2 in air. Primary cultures were allowed to reach confluence before cells were lifted, split, and replated. For this, flasks were washed once with protein-free Dulbecco’s phosphate-buffered saline (D-PBS) (Gibco–Life Technologies) before addition of 3 ml Trypsin-EDTA (Gibco–Life Technologies) solution. Flasks were placed on a 37°C warm stage for 2–3 minutes. The solution containing the dispersed ESCs was aspirated and placed in a 10-ml conical plastic tube containing 7 ml LIF-DMEM solution. The tubes were centrifuged for 3 minutes at 1,000g. The supernatant was removed, and the cells were resuspended in 5 ml LIF-DMEM from which aliquots of 1 ml were placed in new gelatine-coated flasks containing 6 ml LIF-DMEM.

Creation of Embryoid Bodies
Embryoid bodies (EBs) were created using the hanging drop method [21]. Once secondary ESC cultures reached confluence, cells were lifted as described before, washed, and resuspended in LIF-free DMEM supplemented with 10% FCS or in testicular cell (TC) conditioned DMEM to a concentration of 100,000 cells per ml. Twenty microliter drops of the suspension were placed on the lid of a 10-cm plastic culture dish (Falcon). The lid was turned upside down and placed on the bottom part of the dish, which was filled with sterile water, creating hanging drops. Dishes were incubated at 37°C in 5% CO2 in air. EBs were cultured for 48, 72, and 120 hours before being transferred to 0.5 ml DMEM or TC conditioned medium for up to 2 weeks.

TCCs
TCCs were prepared from testicular tissue of 1-day-old newborn F2 (C57Bl x CBA, F1, parents) male mice. The testes of 10 males were removed from the body and placed in Trypsin-EDTA solution. The tissue was torn to pieces using fine forceps and left in the Trypsin solution for 5 minutes. The suspension was collected into a 15-ml plastic conical tube. The tube was centrifuged for 300g for 3 minutes, and the supernatant was removed. One milliliter of D-PBS containing 10% FCS was added to the tube, and the pellet was mixed with the solution thoroughly. The mixture was left at room temperature for 10 minutes, after which time the top 0.8 ml was removed and placed in another conical tube. An additional 11 ml of DMEM medium supplemented with 10% FCS, 1% nonessential amino acids, and 1% penicillin/streptomycin solution was added to the cell suspension. The solution was mixed well before being divided into six wells (2 ml in each) of a six-well culture dish (Falcon). Cultures were incubated at 37°C in 5% CO2 in air. Once they reached 80% confluence, established cultures were lifted using Trypsin-EDTA as described for ESCs, either frozen or diluted 1:2, and replated into new wells.

TC Conditioned Medium
Conditioned medium was collected from established TCCs 10–12 days after initiation of cultures. Conditioned medium was collected only from cultures with obvious germ cell proliferation. TCCs that did not show a substantial proliferation of germ cells within the 10 days were not used. The culture medium was collected from established TCCs every 3 days starting 10 days after initiation. Conditioned medium was collected, filtered, and either stored at –20°C or used immediately.

Immunofluorescent Staining
ESCs, EBs, and TCs were examined for the expression of Oct-3/4, c-kit, and the mouse VASA homologue Mvh. The cultures were fixed using 100% methanol for 5 minutes followed by three washes in cold D-PBS for 5 minutes. Washed cultures were treated with blocking solution (D-PBS + 10% FCS) for a minimum of 2 hours before being washed with D-PBS and stained with first antibodies for Oct-3/4 (Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com) c-kit (Santa Cruz Biotechnology Inc.), and Mvh (thankfully provided by Dr. Toshiaki Noce, Mitsubishi Kagaku Institute of Life Sciences, Tokyo) overnight at 4°C. For Oct-3/4 and Mvh analyses, antibodies were diluted and cells were washed in D-PBS containing 0.1% Triton X-100 (Sigma) to increase permeabilization of the cell membranes. Antibodies were diluted according to manufacturer or provider instructions. Cultures were washed with D-PBS, or D-PBS with 0.1% Triton-X, three times for 5 minutes, and the fluorescent secondary antibody was added for 30 minutes, during which time the cultures were kept in the dark. Goat anti-rat–fluorescein isothiocyanate (FITC) (green; Santa Cruz Biotechnology Inc.) with absorption and emission wavelengths of 494 and 519 nm, respectively, was used to identify c-kit. Goat anti-rabbit–Rhodamine Immunoglobulin G (red; Santa Cruz Biotechnology Inc.) with absorption and emission wavelengths of 570 and 590 nm, respectively, was used to identify Oct-3/4 and Mvh. Cells were washed with cold D-PBS three times for 5 minutes followed by 1-hour incubation in D-PBS containing 0.1% Triton X-100 in the dark. Stained cells were visualized under an Olympus 1X70 inverted fluorescent microscope (Olympus, Tokyo, http://www.olympus-global.com) using the appropriate excitation wavelength filters. Cultures were washed in D-PBS and stained with 4' 6-diamidino-2-phenylindole (DAPI) dilactate (Roche Applied Science, Castle Hill, Australia, https://roche-applied-science.com) with absorption and emission wavelengths of 344 and 450 nm, respectively, dissolved (1:1,000) in anti-fade Vectashield mounting medium (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com).

Marker Analyses by Reverse Transcription–Polymerase Chain Reaction
Total RNA was isolated and purified from ESCs, EBs, and Zin-40 mice fibroblasts, liver, and muscle tissues using the RNeasy Mini kit (Qiagen, Hilden, Germany, http://www.qiagen.com). The reverse transcription–polymerase chain reaction (RT-PCR) was analyzed in 1% agarose (Progen Scientific/Quantum Scientific, QLD, Australia, http://www.quantumscientific.com), stained with ethidium bromide (Invitrogen, Carlsbad, CA, http://www.invitrogen.com), and visualized under UV illumination, using the Superscript III One-Step RT-PCR system (Invitrogen). The PCR conditions were denaturation at 95°C for 5 minutes followed by 30 cycles through 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute, and 72°C for 10 minutes.

The following specific primers were used for the amplification: Oct-3/4: sense 5' CTCGAACCACATCCTTCTCT and antisense 5' GTTCTCTTTGGAAAGGTGTTC; c-kit: sense 5' CATGGCTGCATTCTGACAAATTCAC and anti-sense 5' CTCCATCGGTTACAAATACTGTAG; Mvh: sense 5' CTAGAGCACAGCCCCATAGTTGAAAGAT and anti-sense 5' TGCAGATAAACACTGAAACAGGCTA; Stella: sense 5' GAGATGGCTGCGCGTCCGGGA and antisense 5' CTCAGTGGCAGCCACAGGCCT; DAZL: sense 5' CCAC-CACAGTTCCAGAGTGTTTGG and antisense 5' CTTGAG-TAACAAGAGAGTTTCTCAG; Stra8: sense 5' GCAAC-CAACCCAGTGATGATGG and antisense 5' CATCTGG-TCCAACAGCCTCAG; Sry: sense 5' TTACAGCCTGCAGT-TGCCTC and antisense 5' CATGGAACTGCTGCTCCTGG; Fig {alpha}: sense 5' GCCATCTGTAGGCTCAAGCGC and anti-sense 5' CTCCTAGTCTCAGGTACTGTGC; ZP1: sense 5' CCTCTCACCCTCTGTGGAACAG and antisense 5' GAGCATGTATCAGACCCAGAGG; ZP2: sense 5' GTCCTGAAGTTCCCTTACGAGAC and antisense 5' GTTCCCTTGGAAGTAGAAGGTCAG; ZP3: sense 5' CTTGGCTCA-GAG-GGTTGTC and antisense 5' CTCTCAGATAGACC-ATCCAC; and ß-actin: sense 5' CACCACACCTTCTACA-ATGAGC and antisense 5' CGTAGATGGGCACAGTG-TGGGCATGGAACTGCTGCTCCTGG.

Experimental Design
The experiments outlined in this study are:

  1. TCCs and 48-hour ESC cultures were analyzed by immunofluorescence for the expression of the germ cell markers Oct 3/4, Mvh, and cKit. The expression of the germ cell markers Oct 3/4, Mvh, cKit, Stella, and DAZL was also examined in ESCs by RT-PCR.
  2. EBs were created from dissociated ESCs cultured in hanging drops of LIF-free DMEM containing 10% FCS. EBs at 48, 72, and 120 hours from initiation were examined by immunofluorescence for the expression of the germ cell markers Oct 3/4, Mvh, and cKit. In addition, 48-hour EBs were examined by RT-PCR for the expression of the germ cell markers Oct 3/4, Mvh, cKit, Stella, and DAZL.
  3. EBs were created from dissociated ESCs as described previously and cultured in hanging drops of LIF-free DMEM containing 10% FCS or TC conditioned DMEM. At 48, 72, and 120 hours, EBs were transferred into 0.5 ml LIF-free DMEM containing 10% FCS or TC conditioned DMEM, resulting in four groups for each time point: (a) EBs growing in LIF-free DMEM containing 10% FCS drops followed by culture in 0.5 ml LIF-free DMEM containing 10% FCS, (b) EBs growing in TC conditioned DMEM drops followed by culture in 0.5 ml TC conditioned DMEM, (c) EBs growing in LIF-free DMEM containing 10% FCS drops followed by culture in 0.5 ml TC conditioned DMEM, and (d) EBs growing in TC conditioned DMEM drops followed by culture in 0.5 ml LIF-free DMEM containing 10% FCS.
     
    EBs from the four different groups were examined each day, and morphological changes were recorded. In addition, ESCs from primary cultures were dissociated and cultured in LIF-free DMEM containing 10% FCS or TC conditioned DMEM for up to 3 weeks. The cultures were examined each day, and morphological changes were recorded. The culture solution for ESCs and EBs was replaced every 3 days.
     
  4. EBs were created in TC conditioned DMEM drops for 120 hours before being transferred to TC conditioned DMEM for 2 weeks. Cultures were monitored for morphological changes each day. After 2 weeks, EBs were collected and analyzed for the expression of male and female germ cell markers Sry and Stra8 and the oocyte-specific markers Fig{alpha}, ZP1, ZP2, and ZP3. The expression of these markers was compared with that of 1-day-old newborn ovaries and testes.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
TCCs
An obvious germ cell proliferation was evident in TCCs 8–10 days from initiation. The round cells were clustered together and easily dissociated from other cells when dishes were shaken. Germ cells differed in size and appeared as single cells or attached to each other, forming pairs or rows (Fig. 1AGo). As identified by immunofluorescence, germ cells in TCCs were positive to Oct 3/4 and Mvh but very few cells were positive to c-kit (Figs. 1C–1EGo). By 30–35 days from initiation, the number of germ cells was gradually reduced, and by 40–45 days, floating germ cells were rarely observed. Clusters of cells (Fig. 1BGo) appeared within the cultures, and they were no longer used for collecting conditioned medium.


Figure 1
View larger version (86K):
[in this window]
[in a new window]
  		Figure 1. Testicular cell cultures produced from newborn testes. Testicular cell cultures at 10 days (A) and at 45 days (B). At 10 days of culture, germ cells (GCs; as pointed by arrows) appear semifloating on a monolayer of cells as single cells or in pairs or groups. At 45 days, no GCs are evident and unique clusters appear within the cultures. GCs are stained for Oct 3/4 (C2) and Mvh (D2) but rarely for c-kit (E2). (C1, D1, E1): Bright field images of stained cells.

 
Formation of EBs from ESCs and Identification of Germ Cell Markers Within EBs
Dissociated ESC monolayers (Fig. 2AGo) cultured in LIF-free DMEM containing 10% FCS in hanging drops for 24 hours formed a single cluster with some loose cells around it. By 48 hours, the cluster almost doubled in size and formed a defined edge line with a darker center (Fig. 2BGo). A small gradual growth in size was evident from 72 to 120 hours with no further morphological changes observed in EBs at these time points. Immunofluorescence staining of 48-, 72-, and 120-hour EBs identified cells that are positive to Oct-3/4, Mvh, and c-kit (Fig. 3Go). RT-PCR on 48-hour EBs confirmed positive expression of the germ cell markers Oct-3/4, Mvh, c-kit, Stella, and DAZL (Fig. 4Go). Expression of germ cell markers was also identified in undifferentiated 24- and 48-hour ESC cultures grown on gelatine in LIF-DMEM containing 10% FCS (Fig. 4Go).


Figure 2
View larger version (88K):
[in this window]
[in a new window]
  		Figure 2. Putative ovaries. Monolayers of mouse embryonic stem cells (ESCs) grown in leukemia inhibitory factor–Dulbecco’s modified Eagle’s medium containing 10% fetal calf serum (A) (magnification x 800). When ESCs are grown in hanging drops, they form EBs (B). The edges of the EBs become defined within 48 hours. Within 6–7 days, 120-hour EBs grown in testicular cell conditioned medium develop into a unique ovarian-like structure (C, D). Scale bars = ~25 µm.

 

Figure 3
View larger version (99K):
[in this window]
[in a new window]
  		Figure 3. Immunofluorescence of 120-hour embryoid bodies (EBs) grown in leukemia inhibitory factor–free Dulbecco’s modified Eagle’s medium. Cells within the EB are stained for Oct 3/4 (A2), c-kit (B2), and Mvh (C2). (A1, B1, C1): Bright field images of stained cells. Magnification x 800.

 

Figure 4
View larger version (12K):
[in this window]
[in a new window]
  		Figure 4. Reverse transcription–polymerase chain reaction for the identification of germ cell markers. Markers are examined in mouse embryonic stem (ES) cells from 24-hour (ES1) and 48-hour (ES2), 48-hour embryoid bodies (EBs), fibroblasts (F), muscle cells (M), and liver cells (L). Except for Stella, all the other markers were expressed in 24-hour ESCs. All germ cell markers were expressed in 24- and 48-hour ESCs and in EBs. c-kit was also expressed in fibroblasts.

 
Culture of ESCs and EBs in LIF-Free DMEM and in TC Conditioned DMEM
Similar to ESCs grown in LIF-DMEM containing 10% FCS on gelatine, ESCs in LIF-free DMEM containing 10% FCS or TC conditioned medium attached to the plastic and formed small clusters by 5–7 days from initiation. These, however, did not continue to form unified confluent cultures, but clumps that were spread all over the dish. Clusters formed from ESCs cultured in TC conditioned medium showed a more distinctive round morphology.

During the course of the study, conditioned medium was collected from new TCCs for each experiment. Medium from TCCs that showed a slower proliferation rate of germ cells was not collected. Of 96 EBs at 72 and 120 hours prepared in TC conditioned medium and cultured further in this solution (n = 5), 78 (81%) formed ovarian-looking structures. A comparison was done between different treatments in three repeats, using conditioned medium from a different TCC for each repeat. The results from this comparison are presented in Table 1Go. Significant morphological changes were observed when 72- and 120-hour EBs grown in TC conditioned DMEM hanging drops were transferred to 0.5 ml TC conditioned DMEM for up to 2 weeks. These EBs remained semifloating within the solution with only a few cells attached to the plastic surface. Within 6–7 days, unique morphological changes were evident in these EBs. Follicle-like structures started forming within the entire EB, resulting in the appearance of ovarian structures (Figs. 2C, 2DGo). The structures varied in size, with the larger ones as large as 70 – 80 µm in diameter. When the follicles were dissociated mechanically, cells ranging from 15 to 35 µm in diameter were exposed, some surrounded by one to two layers of flattened cells (Fig. 5Go). These putative oocytes had no zona pellucida. Based on their size, the lack of a zona structure, and the limited cell layers surrounding the cells, it can be postulated that the developmental stage of these "oocytes" was early during oogenesis [22]. Similar morphological changes were evident in some 120-hour EBs that were grown in TC hanging drops and cultured further in LIF-free DMEM containing 10% FCS. Hence, for this transformation to occur, EBs need to be exposed to TC during the initial 4–5 days. EBs grown in LIF-free DMEM containing 10% FCS for this period of time attached to the culture dish within 1–3 days. When plated down, peripheral cells of the EBs formed monolayers that continued to spread around the center of the EB. Within 1 week, the central cells degenerated and the peripheral cells had varied morphological shapes. On a few occasions, clusters of cells had an obvious beating rhythm indicative of their differentiation into cardiac muscle cells.


View this table:
[in this window]
[in a new window]
  		Table 1. Developmental outcome of 72- and 120-hour EBs cultured in LIF-free DMEM and TC conditioned DMEM (n = 3)

 

Figure 5
View larger version (128K):
[in this window]
[in a new window]
  		Figure 5. Putative eggs separated from ovarian structures. The oocytes are surrounded by one or two layers of cells with no sign of a zona pellucida around them. Scale bars = ~25 µm. (A): Putative oocytes within the ovarian-like structure. (B–D): Isolated putative oocytes surrounded with two (B), one (C), and no (D) cell layers.

 
From the oocyte-specific markers investigated, putative ovaries, similar to ovaries obtained from newborn females, expressed Fig{alpha} and ZP3 (Fig. 6Go). The markers ZP1 and ZP2 were not expressed by putative ovaries and were weakly expressed by ovaries from newborn females. The expression of Sry and Stra8 genes, which are specific to male and female early germ cells, was also positive in putative ovaries. Testicular tissue from newborn males expressed only the Sry gene (Fig. 6Go).


Figure 6
View larger version (88K):
[in this window]
[in a new window]
  		Figure 6. The expression of early male and female germ cell markers and oocyte markers in putative ovaries. Lane 1 represents testicular cells from a newborn male. Lane 2 represents ovaries obtained from newborn females, and lane 3 represents putative ovaries derived from embryoid bodies. Lane 4 represents muscle cells used as control, whereas lane 5 represents negative control. Fig-{alpha} and Zp3 are expressed in putative ovaries and ovaries obtained from 1-day-old females. Zp1 and Zp2 are not expressed in putative ovaries but are expressed in newborn ovaries. None of the oocyte markers was expressed in testicular cells obtained from a newborn male or by muscle cells.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In a previous report, mouse ESCs developed into oogonia that enter meiosis and recruit adjacent cells to form follicle-like structures without any other external stimuli apart from growing the cells in the presence of FCS [1]. We were unable to repeat these observations using ESC medium supplemented with FCS. We have used conditioned medium from TCCs to support the differentiation of ESCs into oocytes. Using this system, putative ovaries containing oocytes formed consistently after culture of 4- to 5-day-old EBs in TC conditioned medium. Similar to previous reports [1–3], the present study used one ESC line. Regardless of how differentiation was obtained, this study and the previous studies prove the ability of cells from different mouse ESC lines to differentiate into oocytes in vitro.

Mouse ESCs form aggregates known as EBs [23] when cultured in hanging drops or nonadherent cultures without LIF or supporting feeder cells. As in the human [4], mouse EBs also express germ cell markers such as Oct-3/4, c-kit, and DAZL, and as evident from the present results, they also express Stella and Mvh. Evidently, unknown environmental microenvironment conditions within EBs provide the necessary triggers and signals for commitment of ESCs to the germ line. A negligible number of undifferentiated ESCs express germ cell markers identified only by RT-PCR (Fig. 4Go). The number of cells that are positive to germ cell markers examined by immunofluorescence increased in EBs. However, EBs transform into ovarian-like structures only when exposed to TC conditioned DMEM.

The molecular regulators to which EBs are exposed during culture govern the differentiation and lineage restriction. The main source of growth factors in ESC culture media is usually FCS. In some cases, factors in FCS promote differentiation of ESCs to germ cells [1]. In the present study, however, FCS was not itself able to induce ESCs into oocytes. On the other hand, TC conditioned DMEM was effective in inducing this transformation. Crude TCCs were prepared from newborn male mice and were cultured in DMEM containing 10% FCS. Manifestation of male germ cells in these cultures continued for up to 4 weeks, which is indicative of their healthy state. Regeneration of germ cells has been supported for a relatively long period of time and, as reported previously [19, 24], has resulted in heterogeneity of the germ cell population. The majority of germ cells were positively stained for Oct3/4 and Mvh, but cells expressing c-kit were rarely found. This indicates that the germ cell precursor cells were at a developmental stage equivalent to that of postmigratory PGCs or early germ stem cells (GSCs) [25]. Although the conditioned medium was not analyzed for cytokine content, it is likely that growth factors secreted by the cells are responsible for the transformation of ESCs into gametes. The ability of the testis environment to support oocyte development has been recently described by Isotani et al. [26]. In that study, female PGCs were able to continue their oogenesis within a compromised chimeric testis, suggesting that all necessary requirements for oocyte development are also present in the male gonad. Growth factors such as GDF-9 [27], BMP-4 [17], SCF [27, 28], LIF [29], and IGF-I [30] are found in the testes associated with germ cells or with gonadal somatic cells such as Leydig, Sertoli, and testicular somatic cells. These factors are also associated with granulosa and ovarian theca cells and with oogenesis [31–43].

In the present study, EBs were created from male (XY) ESCs. Nonetheless, differentiation resulted in a female phenotype. It is not well understood what triggers PGCs to enter spermatogenesis in vivo and form spermatogonia or to enter oogenesis and become oogonia. Sex differentiation is an outcome of both endogenous gene expression and local cellular interactions [43, 44]. The arrival of PGCs at the genital ridge during embryogenesis stimulates proliferation of other epithelial and mesenchyme cells to form the undifferentiated gonad composed of two compartments. The first compartment is epithelial and contains the PGCs. The other, a stromal compartment, contains fibroblasts and blood vessels. These two compartments interact via paracrine and endocrine triggers to maintain and differentiate cells within the germ line. A morphological distinction in female and male gonads is obvious at approximately embryonic day 12–12.5. Although few genes that appear in both male and female gonads have been connected to gonadal establishment and sex differentiation [44, 45], the Sry gene has received most attention as a male differentiation gene [46]. Hubner et al. [1] proposed that ESCs develop into germ cells with female phenotype because of the absence of appropriate Sry expression, which may be due to inappropriate or missing differentiation factors, such as retinoic acid [3], involved in Sertoli and Leydig cell metabolism and hence in spermiogenesis.

Expression of Sry and Stra8 was identified in putative ovaries. In the literature, the gender-related expression of Stra8 is under dispute. Whereas some studies [47] have concluded that Stra8 is a molecular marker of female germ cell differentiation, others [48–50] refer to the gene as a male germ cell–specific marker. In the present study, male ESCs and ESCs derived from ovaries grown in TC conditioned DMEM expressed the Stra8 gene, but testicular tissue from a newborn male which presumably contains male germ cells did not. Expression of oocyte-specific markers such as Fig{alpha}, and ZP3 in putative ovaries confirms the female gametic lineage of oocytes. The lack of expression of ZP1, which is a structural protein, and ZP2, which is a secondary receptor for sperm, within the zona pellucida [51, 52] suggests that the oocytes are at an early stage of their growth phase, when mRNAs of the zona proteins ZP1, ZP2, and ZP3 are normally accumulating [52]. However, chromosomal analyses and further studies are required to identify the specific stage of these oocytes and whether they can develop to fully functional eggs.

These findings suggest that within ESC cultures, a small number of cells may be programmed to become germ stem cells. Changes to culture conditions, such as the removal of LIF and growing the cells under nonadherent conditions, encourage more ESCs either to become EGCs or to initiate rapid division cycles of the existing EGCs, increasing their numbers. Further modifications to culture conditions, such as the introduction of growth factor signals, induce a more direct differentiation into specific gonadal cells. The findings from the present study suggest that these signals are present in the TC conditioned medium. The specific signals directly related to formation of follicles and oocytes remain to be determined. Further studies are required to isolate and identify these factors.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We are grateful to Monash IVF, Melbourne, Australia, for the financial support of this project.

DISCLOSURES
The authors indicate no potential conflicts of interest.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hubner K, Fuhrmann G, Christenson LK et al. Derivation of oocytes from mouse embryonic stem cells. Science 2003;300:1251–1256.[Abstract/Free Full Text]

  2. Toyooka Y, Tsunekawa N, Akasu R et al. Embryonic stem cells can form germ cells in vitro. Proc Natl Acad Sci U S A 2003;100:11457–11462.[Abstract/Free Full Text]

  3. Geijsen N, Horoschak M, Kim K et al. Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 2004;427:148–154.[CrossRef][Medline]

  4. Clark AT, Bodnar MS, Fox M et al. Spontaneous differentiation of germ cells from human embryonic stem cells in-vitro. Hum Mol Genet 2004; 13:721–739.

  5. Tres LL, Rosselot C., Kierszenbaum AL, Primordial germ cells: What does it take to be alive? Mol Reprod Dev 2004;68:1–4.[CrossRef][Medline]

  6. Nilsson E, Skinner MK. Cellular interactions that control primordial follicle development and folliculogenesis. J Soc Gynecol Investig 2001; 8:S17–S20.[CrossRef][Medline]

  7. Ricci G, Catizone A, Galdieri M. Embryonic mouse testis development: Role of platelet derived growth factor (PDGF-BB). J Cell Physiol 2004; 200:458–467.[CrossRef][Medline]

  8. Matsui Y, Zsebo K, Hogan BL. Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 1992;70:841–847.[CrossRef][Medline]

  9. Resnick JL, Bixler LS, Cheng L et al. Long-term proliferation of mouse primordial germ cells in culture. Nature 1992;359:550–551.[CrossRef][Medline]

  10. Durcova-Hills G, Ainscough JFX, McLaren A. Pluripotential stem cells derived from migrating primordial germ cells. Differentiation 2001;68:220–226.[CrossRef][Medline]

  11. West JA, Daley GQ. In vitro gametogenesis from embryonic stem cells. Curr Opin Cell Biol 2004;16:688–692.[CrossRef][Medline]

  12. De Felici M, Dolci S. Leukemia inhibitory factor sustains the survival of mouse primordial germ cells cultured on TM4 feeder layers. Dev Biol 1991;147:281–284.[CrossRef][Medline]

  13. De Felici M, Dolci S, Pesce M. Proliferation of mouse primordial germ cells in vitro: A key role for cAMP. Dev Biol 1993;157:277–280.[CrossRef][Medline]

  14. Koshimizu U, Taga T, Watanabe M et al. Functional requirement of gp130-mediated signalling for growth and survival of mouse primordial germ cells in vitro and derivation of embryonic germ (EG) cells. Development 1996;122:1235–1242.[Abstract]

  15. Mayanagi T, Ito K, Takahashi J. Association of culture of mouse urogenital complexes in media containing rodent sera with the appearance of primordial germ cell-like cells. Reproduction 2003;12:519–526.[CrossRef]

  16. Durcova-Hills G, Wianny F, Merriman J et al. Developmental fate of embryonic germ cells (EGCs), in vivo and in vitro. Differentiation 2003;71:135–141.[CrossRef][Medline]

  17. Pellegrini M, Grimaldi P, Rossi P et al. Developmental expression of BMP4/ALK3/SMAD5 signalling pathway in the mouse testis: A potential role of BMP4 in spermatogonia differentiation. J Cell Sci 2003;116:3363–3372.[Abstract/Free Full Text]

  18. Takabayashi S, Sasaoka Y, Yamashita M et al. Novel growth factor supporting survival of murine primordial germ cells: Evidence from conditioned medium of ter fetal gonadal somatic cells. Mol Reprod Dev 2001;60:384–396.[CrossRef][Medline]

  19. Creemers LB, den Ouden K, van Pelt AM et al. Maintenance of adult mouse type A spermatogonia in vitro: Influence of serum and growth factors and comparison with prepubertal spermatogonial cell culture. Reproduction 2002;124:791–799.[Abstract]

  20. Huleihel M, Lunenfeld E. Regulation of spermatogenesis by paracrine/autocrine testicular factors. Asian J Androl 2004;6:259–268.[Medline]

  21. Höpfl G, Gassmann M, Desbaillets I. Differentiating embryonic stem cells into embryoid bodies. Methods Mol Biol 2004;254:79–98. In: Schatten H, ed. Germ Cell Protocols, Vol. 2: Molecular Embryo Analysis, Live Imaging, Transgenesis, and Cloning. Totowa, NJ: Humana Press Inc. 79–98, 2004.[Medline]

  22. Klinger FG, De Felici M. In vitro development of growing oocytes from fetal mouse oocytes: Stage-specific regulation by stem cell factor and granulosa cells. Dev Biol 2002;244:85–95.[CrossRef][Medline]

  23. Karbanova J, Mokry J. Histological and histochemical analysis of embryoid bodies. Acta Histochem 2002;104:361–365.[CrossRef][Medline]

  24. van der Wee KS, Johnson EW, Dirami G et al. Immunomagnetic isolation and long term culture of mouse type A spermatogonia. J Androl 2001;22:696–704.[Abstract]

  25. Lacham-Kaplan O. In-vivo and in-vitro differentiation of male germ cells in the mouse. Reproduction 2004;128:147–152.[Abstract/Free Full Text]

  26. Isotani A, Nakanishi T, Koboyashi S et al. Genomic imprinting of XX spermatogonia and XX oocytes recovered from XX {leftrightarrow} XY chimeric testes. Proc Natl Acad Sci U S A 2005;102:4039–4044.[Abstract/Free Full Text]

  27. Rossi P, Albanesi C, Grimaldi P et al. Expression of the mRNA for the ligand of c-kit in mouse Sertoli cells. Biochem Biophys Res Commun 1991;176:910–914.[CrossRef][Medline]

  28. Ashman LK. The biology of stem cell factor and its receptor C-kit. Int J Biochem Cell Biol 1999;31:1037–1051. Review.[CrossRef][Medline]

  29. Piquet-Pellorce C, Dorval-Coiffec I, Pham MD et al. Leukemia inhibitory factor expression and regulation within the testis. Endocrinology 2000;141:1136–1141.[Abstract/Free Full Text]

  30. Cailleau J, Vermeire S, Verhoeven G. Independent control of the production of insulin-like growth factor I and its binding by cultured testicular cells. Mol Cell Endocrinol 1990;69:79–89.[CrossRef][Medline]

  31. Fitzpatrick SL, Sindoni DM, Shughrue PJ et al. Expression of growth differentiation factor-9 messenger ribonucleic acid in ovarian and nonovarian rodent and human tissues. Endocrinology 1998;139:2571–2578.[Abstract/Free Full Text]

  32. Dong J, Albertini DF, Nishimori K et al. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 1996;383:531–535.[CrossRef][Medline]

  33. Jaatinen R, Laitinen MP, Vuojolainen K et al. Localization of growth differentiation factor-9 (GDF-9) mRNA and protein in rat ovaries and cDNA cloning of rat GDF-9 and its novel homolog GDF-9B. Mol Cell Endocrinol 1999;156:189–193.[CrossRef][Medline]

  34. Matzuk MM, Burns KH, Viveiros MM et al. Intercellular communication in the mammalian ovary: Oocytes carry the conversation. Science 2002; 296:2178–2180.[Abstract/Free Full Text]

  35. Knight PG, Glister C. Local roles of TGF-beta superfamily members in the control of ovarian follicle development. Anim Reprod Sci 2003;78:165–183.[CrossRef][Medline]

  36. Lui WY, Lee WM, Cheng CY. TGF-betas: Their role in testicular function and Sertoli cell tight junction dynamics. Int J Androl 2003;26:147–160.[CrossRef][Medline]

  37. Pangas SA, Jorgez CJ, Matzuk MM. Growth differentiation factor 9 regulates expression of the bone morphogenetic protein antagonist gremlin. J Biol Chem 2004;279:32281–32286.[Abstract/Free Full Text]

  38. Nilsson EE, Skinner MK. Bone morphogenetic protein-4 acts as an ovarian follicle survival factor and promotes primordial follicle development. Biol Reprod 2003;69:1265–1272.[Abstract/Free Full Text]

  39. Klinger FG, De Felici M. In-vitro development of growing oocytes from fetal mouse oocytes: Stage-specific regulation by stem cell factor and granulosa cells. Dev Biol 2002;244:85–95.[CrossRef][Medline]

  40. Brankin V, Mitchell MR, Webb B et al. Paracrine effects of oocyte secreted factors and stem cell factor on porcine granulosa and theca cells in vitro. Reprod Biol Endocrinol 2003;12:1–15.

  41. Wang J, Roy SK. Growth differentiation factor-9 and stem cell factor promote primordial follicle formation in the hamster: Modulation by follicle-stimulating hormone. Biol Reprod 2004;70:577–585.[Abstract/Free Full Text]

  42. Lyrakou S, Hulten MA, Hartshorne GM. Growth factors promote meiosis in mouse fetal ovaries in vitro. Mol Hum Reprod 2002;8:906–911.[Abstract/Free Full Text]

  43. Demeestere I, Gervy C, Center J et al. Effect of insulin-like growth factor-I during preantral follicular culture on steroidogenesis, in-vitro oocyte maturation, and embryo development in mice. Biol Reprod 2004; 70:1664–1669.[Abstract/Free Full Text]

  44. Mittwoch U. The elusive action of sex-determining genes: Mitochondria to the rescue? J Theor Biol 2004;228:359–365. Review.[CrossRef][Medline]

  45. Merchant-Larios H, Moreno-Mendoza N. Onset of sex differentiation: Dialog between genes and cells. Arch Med Res 2001;32:553–558. Review.[Medline]

  46. Koopman P, Munsterberg A, Capel B et al. Expression of a candidate sex-determining gene during mouse testis differentiation. Nature 1990; 348:450–452.[CrossRef][Medline]

  47. Menke DB, Koubova J, Page DC. Sexual differentiation of germ cells in XX mouse gonads occur in an anterior-to posterior wave. Dev Biol 2003;262:303–312.[CrossRef][Medline]

  48. Oulad-Abdelghani M, Bouillet P, Decimo D et al. Characterization of a premeiotic germ cell specific cytoplasmic protein encoded by Stra8, a novel retinoic acid-responsive gene. J Cell Biol 1996;135:469–477.[Abstract/Free Full Text]

  49. Nayernia K, Li M, Jaroszynski L et al. Stem cell-based therapeutic approach of male infertility by teratocarcinoma derived germ cells. Hum Mol Genet 2004;13:1451–1460.[Abstract/Free Full Text]

  50. Miyamoto T, Sengoku K, Takuma N et al. Isolation and expression analysis of the testis specific gene, STRA8, stimulated by retinoic acid gene 8. J Assist Reprod Genet 2002;19:531–535.[Medline]

  51. Wassarman PM, Jovine L, Litcher ES. Mouse zona pellucida genes and glycoproteins. Cytogenet Genome Res 2004;105:228–234.[CrossRef][Medline]

  52. Dean J. Oocyte-specific genes regulate follicle formation, fertility and early mouse development. J Reprod Immunol 2002;53:171–180.[CrossRef][Medline]

Received on May 5, 2005; accepted for publication on July 25, 2005.




This article has been cited by other articles:


Home page
 Endocr. Rev.Home page
C. R. Nicholas, S. L. Chavez, V. L. Baker, and R. A. Reijo Pera
Instructing an Embryonic Stem Cell-Derived Oocyte Fate: Lessons from Endogenous Oogenesis
Endocr. Rev., May 1, 2009; 30(3): 264 - 283.
[Abstract] [Full Text] [PDF]

Home page
 Hum Reprod UpdateHome page
A.I. Marques-Mari, O. Lacham-Kaplan, J.V. Medrano, A. Pellicer, and C. Simon
Differentiation of germ cells and gametes from stem cells
Hum. Reprod. Update, May 1, 2009; 15(3): 379 - 390.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
T. S. Park, Z. Galic, A. E. Conway, A. Lindgren, B. J. van Handel, M. Magnusson, L. Richter, M. A. Teitell, H. K. A. Mikkola, W. E. Lowry, et al.
Derivation of Primordial Germ Cells from Human Embryonic and Induced Pluripotent Stem Cells Is Significantly Improved by Coculture with Human Fetal Gonadal Cells
Stem Cells, April 1, 2009; 27(4): 783 - 795.
[Abstract] [Full Text] [PDF]

Home page
 Hum Reprod UpdateHome page
S. Ziebe, P. Devroey, and on behalf of the State of the ART 2007 Workshop Gr
Assisted reproductive technologies are an integrated part of national strategies addressing demographic and reproductive challenges
Hum. Reprod. Update, November 1, 2008; 14(6): 583 - 592.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
F. D. West, D. W. Machacek, N. L. Boyd, K. Pandiyan, K. R. Robbins, and S. L. Stice
Enrichment and Differentiation of Human Germ-Like Cells Mediated by Feeder Cells and Basic Fibroblast Growth Factor Signaling
Stem Cells, November 1, 2008; 26(11): 2768 - 2776.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
A. J. Childs, P. T.K. Saunders, and R. A. Anderson
Modelling germ cell development in vitro
Mol. Hum. Reprod., September 1, 2008; 14(9): 501 - 511.
[Abstract] [Full Text] [PDF]

Home page
 JCOHome page
H.-J. Lee, K. Selesniemi, Y. Niikura, T. Niikura, R. Klein, D. M. Dombkowski, and J. L. Tilly
Bone Marrow Transplantation Generates Immature Oocytes and Rescues Long-Term Fertility in a Preclinical Mouse Model of Chemotherapy-Induced Premature Ovarian Failure
J. Clin. Oncol., August 1, 2007; 25(22): 3198 - 3204.
[Abstract] [Full Text] [PDF]

Home page
 Reproductive SciencesHome page
C. E. Gargett
Review Article: Stem Cells in Human Reproduction
Reproductive Sciences, July 1, 2007; 14(5): 405 - 424.
[Abstract] [PDF]

Home page
 ScienceHome page
G. Q. Daley
Gametes from Embryonic Stem Cells: A Cup Half Empty or Half Full?
Science, April 20, 2007; 316(5823): 409 - 410.
[Abstract] [Full Text] [PDF]

Home page
 Hum ReprodHome page
H.-F. Chen, H.-C. Kuo, C.-L. Chien, C.-T. Shun, Y.-L. Yao, P.-L. Ip, C.-Y. Chuang, C.-C. Wang, Y.-S. Yang, and H-N. Ho
Derivation, characterization and differentiation of human embryonic stem cells: comparing serum-containing versus serum-free media and evidence of germ cell differentiation
Hum. Reprod., February 1, 2007; 22(2): 567 - 577.
[Abstract] [Full Text] [PDF]

Home page
 ReproductionHome page
B. Aflatoonian and H. Moore
Germ cells from mouse and human embryonic stem cells.
Reproduction, November 1, 2006; 132(5): 699 - 707.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
I. Novak, D. A. Lightfoot, H. Wang, A. Eriksson, E. Mahdy, and C. Hoog
Mouse Embryonic Stem Cells Form Follicle-Like Ovarian Structures but Do Not Progress Through Meiosis
Stem Cells, August 1, 2006; 24(8): 1931 - 1936.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0204v1
24/2/266    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lacham-Kaplan, O.
Right arrow Articles by Trounson, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lacham-Kaplan, O.
Right arrow Articles by Trounson, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS