Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online November 17, 2005
Stem Cells Vol. 24 No. 3 March 2006, pp. 501 -505
doi:10.1634/stemcells.2005-0459; www.StemCells.com
© 2006 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0459v1
24/3/501    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Postovit, L.-M.
Right arrow Articles by Hendrix, M. J.C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Postovit, L.-M.
Right arrow Articles by Hendrix, M. J.C.
THE STEM CELL NICHE

A Three-Dimensional Model to Study the Epigenetic Effects Induced by the Microenvironment of Human Embryonic Stem Cells

Lynne-Marie Postovit, Elisabeth A. Seftor, Richard E.B. Seftor, Mary J.C. Hendrix

Children’s Memorial Research Center, Cancer Biology and Epigenomics Program, Robert H. Lurie Comprehensive Cancer Center, Northwestern University’s Feinberg School of Medicine, Chicago, Illinois, USA

Key Words. Human embryonic stem cells • Melanoma • Microenvironment • Conditioned matrix

Correspondence: Mary J.C. Hendrix, Ph.D., Children’s Memorial Research Center, 2300 Children’s Plaza, Box 222, Chicago, Illinois 60614, USA. Telephone: 773-755-6528; Fax: 773-755-6534; e-mail: mjchendrix{at}childrensmemorial.org

Received on September 19, 2005; accepted for publication on November 13, 2005.


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
New methods of study are necessary to define the homeostatic mechanisms that regulate stem cell properties and to determine the possible epigenetic influence of the stem cell microenvironment on the phenotype of tumor cells. We recently demonstrated that the tumorgenicity of aggressive cutaneous melanoma cells can be abrogated by the zebrafish embryonic microenvironment. We have developed a three-dimensional (3D) model, as a corollary of these findings, that allows melanoma cells to be exposed to the microenvironment of human embryonic stem cells (hESCs). Using this methodology, we determined that hESC microenvironments can dramatically influence the behavior of aggressive melanoma cells. Specifically, exposure of tumor cells to H1- or HSF-6-hESC matrices induced a melanocyte-like phenotype with the ability to form colonies similar to hESCs. Furthermore, melanoma cells were less invasive after culture on hESC microenvironments. These findings demonstrate the utility of this 3D model for studying the unique factors deposited by hESCs and for investigating the epigenetic effects that stem cell microenvironments may have on tumor progression.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The complex, and still enigmatic, relationship between stem cells and their microenvironment plays a pivotal role in cell fate determination. Key to identifying the molecular underpinnings of stem cell plasticity is understanding the unique epigenetic role of the microenvironment on the emergence of cell phenotype. Because pluripotent human embryonic stem cells (hESCs) have the ability to differentiate into a variety of normal cell types, we questioned whether the hESC microenvironment that supports this normal developmental process might have the potential to revert the phenotype of metastatic tumor cells to that of a normal cell phenotype. To develop a method for measuring possible epigenetic effect(s) of the hESC microenvironment on cellular behavior and phenotype, we combined a recently developed technology for culturing hESCs under fibroblast-free conditions [1, 2] with a tumor cell removal methodology perfected in our laboratory [3] to yield an innovative three-dimensional (3D) model that allows multiparameter analyses.

Based on our recent findings demonstrating the tumor-suppressive effect of an embryonic zebrafish microenvironment on human metastatic melanoma cells [4], we hypothesized that the microenvironment of hESCs might have similar potential to reprogram melanoma tumor cells to assume a melanocyte-like phenotype. Thus, as proof-of-concept, we used the 3D model, illustrated in Figure 1Go, to explore the potential epigenetic effects of the hESC microenvironment on human metastatic melanoma cells. The experimental approach involved seeding H1 or HSF-6 hESCs onto a 3D Matrigel matrix for 3 to 4 days, removing the cells, and washing the matrix; this approach resulted in a denuded, preconditioned 3D matrix (CMTX Matrigel). C8161 human amelanotic metastatic cutaneous melanoma cells were seeded onto the hESC-preconditioned matrices or onto an unconditioned (control) Matrigel for 3 to 4 days and then examined for changes in cellular morphology and the expression of a melanocyte phenotype marker, Melan-A. In addition, invasion assays were conducted to measure the ability of the hESC environment to modulate melanoma cell function. Using this methodology, we determined that the hESC microenvironment can reprogram the phenotype of aggressive amelanotic melanoma cells to that of less invasive, Melan-A–producing cells. These findings highlight the potential utility of the 3D–matrix model as a tool for examining the ability of the hESC microenvironment to influence cell fate and possibly reprogram the metastatic phenotype.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. Experimental methodology flow chart. The H1 or HSF-6 hESCs, 5 x 104 cells in compact colonies, are seeded onto a 3D matrix comprised of growth factor–reduced Matrigel (BD Biosciences) in the presence of conditioned stem cell medium for 3 to 4 days. Subsequently, the hESCs are removed from their 3D matrix with NH4OH followed by thorough washes with double-distilled H2O, phosphate-buffered saline, and complete medium, leaving a denuded, preconditioned, 3D matrix (CMTX Matrigel). Onto this preconditioned matrix are seeded human amelanotic metastatic cutaneous melanoma cells (C8161), 2.5 x 105 cells per six-well dish, for 3 to 4 days. At the end of this incubation period, analyses of potential changes in morphology, gene and protein expression, and behavioral function(s) can be performed on the melanoma cells exposed to the hESC-preconditioned matrix microenvironment. Abbreviations: hESCs, human embryonic stem cell, 3D, three dimensional.

 

    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Cell Culture and Maintenance
The human cutaneous amelanotic melanoma cell line (C8161) has been previously characterized as highly aggressive, invasive, and metastatic [5]. The C8161 cells were maintained in RPMI 1640 (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) supplemented with 10% fetal bovine serum (Gemini Bio-Products, Woodland, CA, http://www.gembio.com). Human neonatal epidermal melanocytes (HEMn-LP; Cascade Biologics, Portland, OR, http://www.cascadebio.com) were maintained in 254 medium supplemented with human melanocyte growth supplement (Cascade Biologics).

The H1 and HSF-6 hESC lines were maintained at a passage of less than 50 in gelatin-coated six-well dishes on feeder layers of irradiated mouse embryonic fibroblasts (MEFs; strain CF-1; American Type Culture Collection, Manassas, VA, http://www.atcc.org) plated at 200,000 cells per well. The cells were cultured in 2.5 ml of stem cell medium (SM) consisting of 80% Dulbecco’s modified Eagle’s medium–F12, 20% knockout serum replacer, 1% nonessential amino acids, 1 mM L-Glutamine, and 4 ng/ml basic fibroblast growth factor (Invitrogen) and were incubated at 37°C in 5% CO2. Differentiating colonies were removed manually. For passaging and experimentation, the hESCs were incubated at 37°C for 10 minutes with collagenase type IV (1 mg/ml; Invitrogen) and were subsequently removed mechanically. After several washes with SM, the hESCs were replated.

For the conditioned matrix experiments, the stem cells were maintained in SM preconditioned on irradiated MEFs seeded at a density of 2.12 x 105 MEFs per ml medium.

3D-Conditioned Matrix Experiments
Approximately 50,000 hESCs in compact colonies were seeded onto a 3D matrix comprised of growth factor–reduced Matrigel (14 mg/ml; BD Biosciences, San Diego, http://www.bdbiosciences.com) and were cultured in the presence of conditioned SM for 3 to 4 days. Subsequently, the hESCs were removed from their 3D matrix with 20 mM NH4OH followed by thorough washes with double-distilled H2O, phosphate-buffered saline (PBS) and complete medium, leaving a denuded, preconditioned, 3D matrix (CMTX Matrigel; Fig. 2Go, inset). Alternatively, human epidermal melanocytes were used to condition the matrix. Onto this preconditioned matrix were seeded human amelanotic metastatic cutaneous melanoma cells (C8161), 2.5 x 105 cells per six-well dish, for 3 to 4 days. At the end of this incubation period, analyses of potential changes in morphology, gene and protein expression, and behavioral function(s) were performed on the melanoma cells exposed to the preconditioned matrix microenvironment(s).


Figure 2
View larger version (113K):
[in this window]
[in a new window]
 
Figure 2. The microenvironment of human embryonic stem cells (hESCs) induces melanoma spheroid formation. (A–G): Phase-contrast microscopy showing the confluent growth of C8161 amelanotic, human metastatic cutaneous melanoma cells on 3D Matrigel matrix (A), compared with the formation of colonies by H1 (B) and HSF-6 (C) hESCs on 3D Matrigel matrix; after removal of the hESCs from their 3D matrix (leaving a denuded preconditioned matrix, CMTX, shown in inset), the C8161 tumor cells seeded onto the H1 (D, E) and HSF-6 (F) hESC-preconditioned matrices, CMTX (Matrigel), now form spheroids (D–F) similar to hESC colonies. However, C8161 cells exposed to medium conditioned by H1 cells are unable to form spheroids (G). Scale bar = 200 µm (A).

 
Electrophoresis and Immunoblotting
H1 hESC and C8161 cells, plus the 3D matrix they were cultured on, were scraped into radioimmunoprecipitation assay buffer (100 mM Tris [pH 7.5], 150 mM NaCl, 1% deoxycholate, 0.1% Triton X-100, 0.1% SDS, plus protease inhibitors: 1 mM phenylmethylsulfonyl fluoride, 50 µM leupeptin, 10 µg/ml aprotinin, and 2 mM NaVO3; Sigma, St. Louis, http://www.sigmaaldrich.com), then sonicated for 3 seconds and centrifuged at 13,000 rpm for 35 minutes at 4°C. Protein concentrations were determined using a bicinchoninic acid assay (Pierce, Rockford, IL, http://www.piercenet.com), and 40 µg of protein were loaded per well of a 4%–12% gradient Bis-Tris polyacrylamide gel (Invitrogen). After electrophoresis (using a monohydrate, 2-(N-morpholino)ethane-sulfonic acid monohydrate reservoir buffer), the proteins were electroblotted onto an Immobilon-P membrane (Millipore, Bedford, MA, http://www.millipore.com). Melan-A was detected using an anti–Melan-A antibody (M2410, 1:100; USBiological, Swampscott, MA, http://www.usbio.net) followed by a secondary anti-mouse antibody conjugated with horseradish peroxidase (1:5,000; GE Health-care, Piscataway, NJ, http://www.gehealthcare.com) and enhanced chemiluminescence (GE Healthcare).

RNA Extraction and Semi-Quantitative Reverse Transcription–Polymerase Chain Reaction
Total RNA from normal melanocytes or aggressive melanoma cells cultured on a Matrigel matrix (nonconditioned) or on a matrix preconditioned by melanocytes was isolated using TRIzol reagent (Invitrogen) in accordance with the manufacturer’s instructions. The RNA was reverse-transcribed using the Advantage PCR kit according to manufacturer’s instructions (Clontech Laboratories, Palo Alto, CA, http://www.clontech.com), and Melan-A expression was subsequently determined using polymerase chain reaction (PCR). PCR amplifications were performed with gene-specific primers (forward sequence 5' GGTGTCCTGTGCCCTGACCCTAC 3'; reverse Sequence 5' ATGTCTCAGGTGTCTCGCTGGCTC 3') with an annealing temperature of 67°C for 30 cycles.

Invasion Assays
The invasive potential of the cells was analyzed in vitro using the membrane invasion culture system as previously described [6]. Briefly, 50,000 cells were suspended in RPMI 1640 with 1X Mito+ (BD Bioscience) and then seeded onto a 10 µm poly-carbonate membrane (Osmonics Co., Livermore, CA, https://www1.fishersci.com) coated with a defined matrix consisting of 50 µg/ml each of human laminin, and collagen IV (Sigma) in 2 mg/ml gelatin. Chambers were incubated for 24 hours at 37°C, 5% CO2, after which time, the cells that invaded through the matrix and the membrane were collected and counted. Percent invasion was corrected for proliferation and calculated as the total number of invading cells divided by the cells seeded x 100, and these values were normalized to the value obtained for the control parameter. Statistical analysis was performed using the SigmaStat statistical package (SPSS Inc., Chicago, http://www.spss.com). Statistical significance was determined using the Kruskal-Wallis One Way Analysis of Variance on Ranks, and the p values were adjusted for multiple comparisons using the Student-Newman-Keuls method. All of the statistical tests were two-sided, and the differences were considered statistically significant at p < .05.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
3D Matrices Preconditioned by hESCs Induce Melanoma Spheroid Formation
Preconditioning of the matrix exerted a dramatic effect on melanoma cell morphology (Fig. 2Go). On a control unconditioned Matrigel matrix, C8161 melanoma cells (Fig. 2AGo) grew into overconfluent monolayers, whereas undifferentiated H1 (Fig. 2BGo) and HSF-6 (Fig. 2CGo) hESCs formed compact colonies of cells with a high nucleus-to-cytoplasm ratio. However, C8161 melanoma cells seeded onto the 3D matrices preconditioned by the hESCs acquired an altered phenotype manifested by the formation of spheroids similar to the colonies formed by hESCs (Figs. 2D–2FGo). In contrast, the conditioned media from hESCs did not exert an epigenetic change on the C8161 cells (Fig. 2GGo), suggesting that hESCs influence melanoma cell phenotype through the alteration of the immediate microenvironment.

3D Matrices Preconditioned by hESCs Promote Epigenetic Changes in Aggressive Amelanotic Melanoma Cells
To further analyze epigenetic changes in the phenotype of C8161 cells exposed to the hESC microenvironment, we performed Western blot and reverse transcription–PCR analyses of a melanocyte marker, Melan-A (Fig. 3Go). Melan-A was absent both in H1 hESCs (indicating their lack of a differentiated pigment cell phenotype) and in C8161 melanoma cells (illustrating their dedifferentiated phenotype) on Matrigel. However, Melan-A expression was induced in amelanotic C8161 melanoma cells exposed to the H1 hESC-preconditioned Matrigel matrix (Fig. 3Go, upper panel), demonstrating the epigenetic induction of a melanocyte-specific phenotype marker, similar to control melanocytes (HEMn) on Matrigel. By contrast, C8161 melanoma cells exposed to 3D matrices preconditioned by normal HEMn were not induced to change their morphology or to express Melan-A (Fig. 3Go, lower panel). Thus, the normal melanocyte microenvironment does not share the ability of the hESC microenvironment to epigenetically reprogram metastatic melanoma cells to express a melanocyte-like phenotype.


Figure 3
View larger version (41K):
[in this window]
[in a new window]
 
Figure 3. Epigenetic changes in human metastatic cutaneous melanoma cells exposed to the microenvironment of hESCs. Western blot analysis of whole-cell lysates (with an equal amount of protein loaded per sample) for a melanocyte marker, Melan-A, shows its absence in H1 hESCs on Matrigel and C8161 tumor cells on Matrigel, and the induction of Melan-A in C8161 cells exposed to the H1 hESCs preconditioned matrix, CMTX (Matrigel), compared with Melan-A in control HEMn on Matrigel (upper panel). Semi-quantitative reverse transcription–polymerase chain reaction analysis of Melan-A gene expression in HEMn cultured on Matrigel compared with C8161 cells exposed to an HEMn preconditioned matrix, CMTX (Matrigel), compared with C8161 cells on Matrigel. The CMTX lane serves as a control demonstrating the complete removal of the HEMn cells from the preconditioned matrix prior to seeding the C8161 melanoma cells. GAPDH was used as a loading control for RNA (lower panel). Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HEMn, human neonatal epidermal melanocyte; hESC, human embryonic stem cell.

 
The aggressiveness of tumor cells is correlated with their ability to invade through the extracellular matrix; thus, we examined the effect of hESC microenvironments on melanoma cell invasion. As illustrated in Figure 4Go, the in vitro invasiveness of aggressive C8161 cells was significantly inhibited after culture on matrices preconditioned by hESCs, suggesting suppressive, anti-invasion cues associated with this human embryonic microenvironment.


Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. The microenvironment of human embryonic stem cells (hESCs) decreases melanoma cell invasion. Invasion of C8161 cells after culture on unconditioned Matrigel (Control) or Matrigel preconditioned by either H1 or HSF-6 hESCs was calculated as a percentage of cells able to invade through a defined matrix (collagen IV, laminin, and gelatin)–coated membrane during a 24-hour period using the membrane invasion culture system assay. Bars represent the mean, normalized, invasion indices ± SDs. The values indicated by an asterisk are significantly different from the invasion index of control cells.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
hESCs represent a promising source for a variety of transplantation therapies. Advances since their original isolation [7] have provided techniques for their maintenance on feeder-free matrices and specialized 3D scaffolds, characterized culture conditions that promote their undifferentiated state, and defined environmental parameters and signaling cascades that regulate differentiation into specific cellular phenotypes [1, 2, 812]. However, an understudied area in hESC research is their microenvironment, especially the epigenetic potential of this microenvironment on other cell types. This study developed a technology that permits a global assessment of the epigenetic effects of the 3D microenvironment of hESCs on tumor cells, using human metastatic melanoma cells as proof-of-concept.

Cutaneous melanoma is one of the few remaining cancers escalating in incidence and thus represents a growing public health burden worldwide [13]. The normal precursor cell type of human melanoma is the epidermal melanocyte, a cell of neural crest origin. Recent studies have identified the cellular microenvironment as a novel target to treat melanoma and other cancers [3, 14, 15]. These observations prompted our development of a model that might help to develop techniques for reprogramming the metastatic phenotype to that of a more normal cell. For this study, we selected amelanotic C8161 metastatic melanoma cells, which have lost their expression of Melan-A, a melanocyte-specific phenotype antigen that is an integral component of the pigmentation pathway. Previous work has demonstrated a favorable disease outcome in melanoma patients in whom this melanocyte-associated antigen is expressed [16], and there is evidence that T cells are unable to recognize Melan-A–negative melanoma tumors [17]. Thus, it is tempting to speculate that re-expression of normal melanocyte antigens, such as Melan-A, in patients with metastatic disease could be a viable therapeutic strategy for redifferentiating highly aggressive metastatic melanoma cells to a less aggressive melanocytic-like phenotype. The 3D microenvironment model allowed us to expose C8161 melanoma cells to a Matrigel matrix preconditioned by hESCs, which yielded the remarkable finding that the tumor cells, probably a subpopulation of the C8161 cell line, were reprogrammed to express Melan-A. This epigenetic effect was specific to the hESC microenvironment, as the normal HEMn microenvironment was unable to induce a similar change in C8161 cells. Also noteworthy is the finding that the hESC-conditioned media did not exert an epigenetic effect on the melanoma cells, which suggests that the factor(s) or biomechanical properties necessary for the induction are specific to the hESC microenvironment.

The 3D model also enabled us to examine the effects of hESC microenvironments on tumor cell invasion. Indeed, we determined that C8161 melanoma cells are less invasive after exposure to matrices preconditioned by hESCs. Interestingly, exposure to the hESC microenvironment did not completely abrogate melanoma cell invasiveness. This was due to the heterogeneous nature of the hESC-preconditioned matrix. For example, although the entire population of melanoma cells was used in the invasion assays, it appears that only the subpopulation of cells exposed to the areas of matrix that supported hESC clusters would be epigenetically altered to become less invasive. This concept is supported by our morphological studies, which showed melanoma spheroid formation localized to the areas of matrix previously occupied by hESC colonies.

In summary, this study has presented a novel methodology that may be used to dissect the unique elements defining the hESC microenvironment. As proof-of-concept, we were able to show that hESC-preconditioned matrices have a potent effect on the phenotype of aggressive amelanotic melanoma cells. These matrices induced melanoma spheroid formation, promoted the re-expression of Melan-A, and inhibited melanoma cell invasion. The 3D microenvironment model presented here may therefore serve as a viable tool for defining essential signaling pathways and molecular mechanisms critical to understanding the potent influence of the hESC microenvironment on reprogramming aberrant phenotypes involved in disease pathogenesis.


    DISCLOSURES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
This work was supported in part by the NIH/National Cancer Institute (grant CA 59702), The Charlotte Geyer Foundation, and a Canadian Institutes for Health Research postdoctoral fellowship awarded to L.-M.P. We gratefully acknowledge the insightful scientific comments of Dr. Jack Kessler (Northwestern University) as well as the creative input and technical assistance of Dr. Dawn Kirschmann and William Wheaton. L.-M.P. and E.A.S. contributed equally to this work.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Xu RH, Peck RM, Li DS et al. Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nat Methods 2005;2:185–190.[CrossRef][Medline]

  2. Schatten G, Smith J, Navara C et al. Culture of human embryonic stem cells. Nat Methods 2005;2:455–463.[CrossRef][Medline]

  3. Seftor RE, Seftor EA, Koshikawa N et al. Cooperative interactions of laminin 5 gamma2 chain, matrix metalloproteinase-2, and membrane type-1-matrix/metalloproteinase are required for mimicry of embryonic vasculogenesis by aggressive melanoma. Cancer Res 2001;61:6322–6327.[Abstract/Free Full Text]

  4. Lee LMJ, Seftor EA, Bonde G et al. The fate of human malignant melanoma cells transplanted into zebrafish embryos: Assessment of migration and cell division in the absence of tumor formation. Dev Dyn 2005;233:1560–1570.[CrossRef][Medline]

  5. Welch DR, Bisi JE, Miller BE et al. Characterization of a highly invasive and spontaneously metastatic human malignant melanoma cell line. Int J Cancer 1991;47:227–237.[Medline]

  6. Hendrix MJ, Seftor EA, Seftor RE et al. A simple quantitative assay for studying the invasive potential of high and low human metastatic variants. Cancer Lett 1987;38:137–147.[CrossRef][Medline]

  7. Thomson JA, Itskovitz-Eldor J, Shapiro SS et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–1147.[Abstract/Free Full Text]

  8. Levenberg S, Huang NF, Lavik E et al. Differentiation of human embryonic stem cells on three-dimensional polymer scaffolds. Proc Natl Acad Sci U S A 2003;100:12741–12746.[Abstract/Free Full Text]

  9. Ezashi T, Das P, Roberts RM. Low O2 tensions and the prevention of differentiation of hES cells. Proc Natl Acad Sci U S A 2005;102:4783–4788.[Abstract/Free Full Text]

  10. Ramalho-Santos M, Yoon S, Matsuzaki Y et al. "Stemness": Transcriptional profiling of embryonic and adult stem cells. Science 2002;298: 597–600.[Abstract/Free Full Text]

  11. Weissman IL. Stem cells: Units of development, units of regeneration, and units in evolution. Cell 2000;100:157–168.[CrossRef][Medline]

  12. Silva GA, Czeisler C, Niece KL et al. Selective differentiation of neural progenitor cells by high-epitope density nanofibers. Science 2004;303: 1352–1355.[Abstract/Free Full Text]

  13. Rigel DS, Carucci JA. Malignant melanoma: Prevention, early detection, and treatment in the 21st century. CA Cancer J Clin 2000;50:215–236.[Abstract]

  14. Satyamoorthy K, Herlyn M. Cellular and molecular biology of human melanoma. Cancer Bio Therapy 2002;1:14–17.

  15. Bissell MJ, LaBarge MA. Context, tissue plasticity, and cancer: Are tumor stem cells also regulated by the microenvironment? Cancer Cell 2005;7:17–23.[Medline]

  16. Takeuchi H, Kuo C, Morton DL et al. Expression of differentiation melanoma-associated antigen genes is associated with favorable disease outcome in advanced-stage melanomas. Cancer Res 2003;63:441–448.[Abstract/Free Full Text]

  17. Maeurer MJ, Gollin SM, Martin D et al. Tumor escape from immune recognition: Lethal recurrent melanoma in a patient associated with downregulation of the peptide transporter protein TAP-1 and loss of expression of the immunodominant MART-1/Melan-A antigen. J Clin Invest 1996;98:1633–1641.[Medline]




This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
I. S. Jovin and F. J. Giordano
Differentiation by association: is a cell's fate determined by the company it keeps?
Am J Physiol Heart Circ Physiol, April 1, 2008; 294(4): H1503 - H1504.
[Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L.-M. Postovit, N. V. Margaryan, E. A. Seftor, D. A. Kirschmann, A. Lipavsky, W. W. Wheaton, D. E. Abbott, R. E. B. Seftor, and M. J. C. Hendrix
Human embryonic stem cell microenvironment suppresses the tumorigenic phenotype of aggressive cancer cells
PNAS, March 18, 2008; 105(11): 4329 - 4334.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L.-M. Postovit, E. A. Seftor, R. E.B. Seftor, and M. J.C. Hendrix
Influence of the Microenvironment on Melanoma Cell Fate Determination and Phenotype
Cancer Res., August 15, 2006; 66(16): 7833 - 7836.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0459v1
24/3/501    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Postovit, L.-M.
Right arrow Articles by Hendrix, M. J.C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Postovit, L.-M.
Right arrow Articles by Hendrix, M. J.C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS