Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online December 8, 2005
Stem Cells Vol. 24 No. 4 April 2006, pp. 1020 -1029
doi:10.1634/stemcells.2005-0260; www.StemCells.com
© 2006 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0260v1
24/4/1020    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by François, S.
Right arrow Articles by Chapel, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by François, S.
Right arrow Articles by Chapel, A.

TISSUE-SPECIFIC STEM CELLS

Local Irradiation Not Only Induces Homing of Human Mesenchymal Stem Cells at Exposed Sites but Promotes Their Widespread Engraftment to Multiple Organs: A Study of Their Quantitative Distribution After Irradiation Damage

Sabine Françoisa, Morad Bensidhoumb, Moubarak Mouiseddinea, Christelle Mazurierb, Bénédicte Alleneta, Alexandra Semonta, Johanna Fricka, Amandine Sachéa, Sandrine Bouchetb, Dominique Thierrya, Patrick Gourmelona, Norbert-Claude Gorinb,c, Alain Chapela

a Laboratoire de Thérapie Cellulaire et Radioprotection Accidentelle, Institut de Radioprotection et de Sûreté Nucléaire, Fontenay aux Roses CEDEX, France;
b EA 1638, Laboratoire de Thérapie Cellulaire et Radioprotection Accidentelle, Faculté de Médecine Saint Antoine, Université Paris VI Pierre et Marie Curie, Paris, France;
c Service d’Hématologie et de Thérapie cellulaire, Hôpital Saint Antoine, Paris, France

Key Words. Mesenchymal stem cell • Injured tissues • Homing • Transplantation • Irradiation

Correspondence: Alain Chapel, Ph.D., IRSN, DRPH/SRBE/LTCRA, BP17 Fontenay aux Roses Cedex 92262, France. Telephone: 33 1 58 35 95 46; Fax: 33 1 58 35 84 67; e-mail: alain.chapel{at}irsn.fr

Received June 10, 2005; accepted for publication November 16, 2005.

   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mesenchymal stem cells (MSCs) have been shown to migrate to various tissues. There is little information on the fate and potential therapeutic efficacy of the reinfusion of MSCs following total body irradiation (TBI). We addressed this question using human MSC (hMSCs) infused to nonobese diabetic/ severe combined immunodeficient (NOD/SCID) mice submitted to TBI. Further, we tested the impact of additional local irradiation (ALI) superimposed to TBI, as a model of accidental irradiation. NOD/SCID mice were transplanted with hM-SCs. Group 1 was not irradiated before receiving hMSC infusion. Group 2 received only TBI at a dose of 3.5 Gy, group 3 received local irradiation to the abdomen at a dose of 4.5 Gy in addition to TBI, and group 4 received local irradiation to the leg at 26.5 Gy in addition to TBI. Fifteen days after irradiation, quantitative and spatial distribution of the hMSCs were studied. Histological analysis of mouse tissues confirmed the presence of radio-induced lesions in the irradiated fields. Following their infusion into nonirradiated animals, hMSCs homed at a very low level to various tissues (lung, bone marrow, and muscles) and no significant engraftment was found in other organs. TBI induced an increase of engraftment levels of hMSCs in the brain, heart, bone marrow, and muscles. Abdominal irradiation (AI) as compared with leg irradiation (LI) increased hMSC engraftment in the exposed area (the gut, liver, and spleen). Hind LI as compared with AI increased hMSC engraftment in the exposed area (skin, quadriceps, and muscles). An increase of hMSC engraftment in organs outside the fields of the ALI was also observed. Conversely, following LI, hMSC engraftment was increased in the brain as compared with AI. This study shows that engraftment of hMSCs in NOD/ SCID mice with significantly increased in response to tissue injuries following TBI with or without ALI. ALI induced an increase of the level of engraftment at sites outside the local irradiation field, thus suggesting a distant (abscopal) effect of radiation damage. This work supports the use of MSCs to repair damaged normal tissues following accidental irradiation and possibly in patients submitted to radiotherapy.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Mesenchymal stem cells (MSCs) have been identified in the bone marrow (BM) as multipotent progenitor cells that differentiate into osteocytes, chondrocytes, adipocytes, and stromal cells [1, 2]. Irradiation can induce severe complications, hemopoietic stem cell depletion, multiorgan failure, and death. Inflammation due to irradiation can mobilize hematopoietic stem cells into the circulation; irradiation can activate molecular pathways that increase the release of tissue chemokines, which attract stem cells to tissues where they may home and differentiate [3]. Therefore, stem cell therapy may be a promising therapeutic approach to improve radiotherapy-induced tissue damages.

In several animal models, it has been shown that syngeneic or xenogeneic MSCs administered intravenously are able to engraft into the BM and other tissues in animals with [4–6] or without a pretransplant total body irradiation (TBI) [7, 8]. However, the levels of engraftment in these two different settings have not been compared. MSCs engraft in vivo in several injured tissues [9–14] such as the liver [15, 16]; moreover, primary researches showed that MSCs can graft themselves in muscles [17, 18] and myocardium [19]. In humans, the use of MSCs is being tested for tissue remodeling, including cardiovascular repair, treatment of lung fibrosis, spinal cord injury, bone and cartilage repair (reviewed in [17, 20]). Regarding radio-induced lesions, multiple studies have shown engraftment of MSCs at the site of injury [21–23] but very few have evaluated MSC engraftment in other tissues (outside the irradiation field). The amount of MSCs detected in most tissues is exceedingly low. The signaling pathways responsible for their directed migration still remain unknown, although recent reports have suggested a role for chemokines in human MSC (hMSC) migration [3]. Several studies have begun to elucidate the mechanisms by which stem cells are mobilized from BM to a particular organ and the molecular mediators that orchestrate this process [24–26].

For these studies, xenogenic models are powerful but somewhat controversial models. Essential signals such as cytokine/ receptor interactions may be hampered by species differences. Although the xenogeneicity does not prevent the differentiation, it slightly decreases the migratory ability of the MSCs toward different tissues. This decrease seems to be the result of weak connection between the receptors and ligands of different species [19]. Although it was described that both human and murine MSCs are immunosuppressive, major differences exist between MSCs from the two species. Murine MSCs, unlike their human equivalent, lack major histocompatibility complex class II expression [27]. The host’s crippled immune system could also somehow hinder engraftment but transplant rejection can occur in xenogenic models. However, when transplanted into an immunoincompetent host, adult hMSCs showed persistent engraftment [28].

The first challenge in therapeutic MSC transplantation is efficient delivery to the sites of intended action. In this paper, we describe a xenogeneic experimental transplant model we built to evaluate the full potential of hMSC engraftment and we compare TBI with and without additional localized exposures (leg and abdominal areas). In this study, we used the nonobese diabetic/severe combined immunodeficient (NOD/ SCID) mouse model to evaluate the engraftment of hMSCs in irradiated mice and to have the minimum of animals developing a transplant rejection. Our results showed that after transplantation into adult unconditioned mice, hMSCs migrate not only in BM and lungs as previously reported but also into muscle tissues [6]. TBI increased hMSC implantation in BM and muscle and, furthermore, led to engraftment in brain, heart, and liver. Local irradiation, in addition to TBI, increased specific homing of injected cells both to the injured tissues and to other tissues outside the local irradiation field. We feel these observations may be relevant to several clinical situations such as TBI given as a pretransplant conditioning regimen, radiotherapy for the treatment of cancer, and accidental irradiation, in promoting the use of MSC infusion as part of the therapeutic scheme.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Isolation, Purification, and Expansion of hMSCs
BM cells were obtained from iliac crest aspirates from healthy volunteers after informed consent and were used in accordance with the procedures approved by the human experimentation and ethic committees of Hôpital St. Antoine. As previously described [7], 50 ml of BM were taken from different donors over heparin (Choay de Sanofi-Synthélabo, Paris, http://www.sanofi-adventis.com). Low-density mononuclear cells (MNCs) were separated on Ficoll Hypaque density gradient (1.077). MNCs were plated at a concentration of 107 cells per 10 ml of dexter medium (McCoy’s 5A medium) in 75 cm2 tissue culture flasks (supplemented with 12.5% fetal calf serum, 12.5% horse serum), 1% sodium bicarbonate, 1% sodium pyruvate, 0.4% MEM nonessential amino acids, 0.8% minimum essential medium (MEM) essential amino acids, 1% MEM vitamin solution, 1% L-glutamine (200 mM), 1% penicillin-streptomycin solution (all from Invitrogen, Groningen, The Netherlands, http://www.invitrogen.com), 10–6 M hydrocortisone (StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com), and 2 ng/ml human basic recombinant fibroblast growth factor (R&D Systems, Abington, U.K., http://www.rndsystems.com) and incubated at 37°C in humidified, 5% CO2 atmosphere. After 1 week, nonadherent cells were washed, removed, and replaced with the same complete fresh medium (without Hydrocortisone), and hMSCs at first passage (P1 hMSCs) were plated at a density of 4 x 105 per T-75 cm2 flask; at second passage (P2 hMSCs) when reaching 80% of confluence, the cells were collected and counted, and viability was assessed by trypan blue assay. Before transplant, a sample of the hMSCs prepared was taken for fluorescence-activated cell sorting (FACS) analysis.

FACS Analysis
After trypsin EDTA treatment, the human cells were washed and resuspended in phosphate-buffered saline (PBS) supplemented with 0.5% bovine serum albumin (BSA; Sigma, St. Louis, http://www.sigmaaldrich.com) in aliquots of 2 x 105 cells. Stainings were done with phycoerythrin (PE)-conjugated monoclonal antibody against CD105 (SH2), CD73 (SH3), and CD45 (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com) for 30 minutes at 4°C followed by two washes in PBS containing 0.5% BSA. Cells were resuspended in 200 µl of PBS, 0.5% BSA, and analyzed at 10,000 events per test by FACScalibur BD Pharmingen (San Diego, http://www.bdbiosciences.com/pharmingen). Mouse immunoglobulin G1 (IgG1) were used as isotopic controls (Beckman Coulter, Fullerton, CA, http://www.beckmancoulter.com).

hMSC Infusion into NOD/SCID Mouse Model
All experiments and procedures were performed in compliance with the French Ministry of Agriculture regulations for animal experimentation (Act no. 87–847, October 19, 1987, modified May 2001). NOD-LtSz-scid/scid (NOD-SCID) mice from breeding pairs originally purchased from Jackson Laboratory (Bar Harbor, ME, http://www.jax.org) were bred in our pathogen-free unit and maintained in sterile micro-isolator cages. A total of 60 8-week-old mice, divided in five groups, were used for this study. The hMSCs were delivered intravenously by tail vein injection into each mouse with Myjector syringe of 1 ml, TERUMO (Terumo Medical Corporation, Somerset, NJ, http://www.terumomedical.com) 29-gauge x .05. Twenty-four hours after radiation exposure (using a 137Cs source), four groups of these NOD/SCID mice were transplanted with a dose of 5 x 106 P2 hMSCs in 100 µl of PBS 1X; the fifth group was used as a control group and did not receive hMSC infusion. On average, one BM was used to inject five mice. Group 1 was not irradiated before receiving hMSC infusion. Groups 2–4 received TBI at a sublethal dose of 3.5 Gy before hMSC infusion as follows: Group 2 received TBI only; group 3 received local irradiation to the abdomen (IA) at a dose of 4.5 Gy in addition to TBI; and group 4 received local irradiation to the right posterior leg (irradiation leg) at 26.5 Gy in addition to TBI. Each group had its own control of five animals that did not receive hMSCs. The animals were sacrificed 15 days after irradiation, and the quantitative and spatial distribution of the hMSCs was studied through polymerase chain reaction (PCR) and immunohistology analysis. Peripheral blood, BM (femur), heart, lungs, liver, kidneys, spleen, stomach, gut, brain, right and left posterior legs, quadriceps muscles, tibias, and skin were collected. Before infusion when hMSCs at second passage were collected, the rates of viability to trypan blue were 98%.

Detection and Quantitative Analysis of Engrafted hMSCs: DNA Extraction and PCR Analysis
The biological samples were submitted to DNA extraction and PCR analysis to detect the presence of human cells in mice recipients. Genomic DNA for PCR analysis was prepared from tissues using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, http://www1.qiagen.com). Amplifications were performed in accordance with the standard recommended amplification conditions (Applied BioSystems, Foster City, CA, http://www.appliedbiosystems.com) as previously described by Heid and colleagues [29]. The value of DNA contained in each somatic cell (diploid) is 6.16 pg with two copies of nonrepeated gene. This value was used to calculate the number of gene copies that contain a certain amount of human or mouse DNA (measured by PCR). Therefore, DNA and copy number are proportional to the number of cells. The ratio of human DNA to mouse DNA directly gives the number of human cell in mouse cell tissues. Amplification of human ß-GLOBIN gene was used to quantify the amount of human DNA in each sample of mouse tissue after DNA extraction. Endogenous mouse RAPSYN (receptor-associated protein at the synapse) gene was also amplified, as an internal control. Absolute standard curves were generated for the human ß-GLOBIN and mouse RAPSYN genes and used to quantify the amount of human DNA in each mouse tissue. Evaluation of human specificity of human ß-GLOBIN amplification was demonstrated using tenfold dilution for 100 ng–0.05 ng of hMSC DNA with mouse DNA, without cross-reactivity, to quantify human cells in mouse tissue. One hundred nanograms of purified DNA from various tissues were amplified using TaqMan universal PCR master mix (Applied BioSystems). The primers and probe for human ß-GLOBIN were forward primer 5'GTGCACCTGACTCCTGAGGAGA3' and reverse primer 5'CCTTGATACCAACCTGCCCAGG3', and the probe labeled with fluorescent reporter and quencher was 5'FAM-AAGGTGAACGTGGATGAAGTTGGTGG-TAMRA-3'. The primers and probe for mouse RAPSYN gene were forward primer 5'AC-CCACCCATCCTGCAAAT3' and reverse primer 5'ACCTGTCCGTGCTGCAGAA3'. To determine the efficiency of amplification and the assay precision, calibration curves for human ß-GLOBIN and mouse RAPSYN genes were constructed with a 0.99 correlation (r2) and efficiency superior to 98%. A 100% efficiency corresponded to a slope of –3.32 as determined by the following equation: efficiency = 10(–1/slope) – 1. Mouse DNA was isolated from the identical tissues of nontransplanted NOD/SCID mice and used as a negative control. Also, human DNA was isolated from hMSC culture and used as a positive control. The results were expressed in number of human cells per 100 mouse cells in each tissue (directly related to the numbers of copies of human ß-GLOBIN and mouse RAPSYN genes).

Immunohistochemistry
After paraformaldehyde fixation, the organs were rinsed with distilled water and dehydrated. Blocks were cut at 5 µm on a rotary microtome (Leica, Heerbrugg, Switzerland, http://www.leica.com). For immunohistochemical staining of the paraffin-embedded samples, microtomed sections were deparaffinized in xylene and rehydrated through ethanol baths and PBS. After being rinsed with distilled water bath for 5 minutes, the sections were dipped into PBS-Triton in order to increase tissue permeability. The sections were digested with 2% trypsin for 30 minutes, thus exposing masked epitopes. The polyclonal anti-ß-2-microglobuline antibody (product NCL-B2Mp; Novocastra Ltd., Newcastle upon Tyne, U.K., http://www.novocastra.co.uk) was added at a dilution of 1:50. Negative controls were incubated with rabbit IgG diluted to 1:100. Detection of bound primary antibody was carried out with biotinylated secondary antibody. The biotinylated anti-rabbit IgG secondary antibody was diluted to 1:200, in PBS, and applied for 8 minutes. The slides were subsequently incubated with six-solution Ventana kit to make alkaline phosphatase reaction with FARED substrate for 30 minutes. For antibody detection, the Ventana kit (Ventana Medical Systems, Illkirch Cedex, France, http://www.ventanamed.com) was used, followed by counterstaining with hemalyn for 4 minutes. This procedure was controlled by NEXES 8 software. On successive sections, we carried out an hematoxylin-eosin-safran staining.

Statistical Analysis
To determine the effect of exposure radiation on engraftment of hMSCs, the rates of implantation were compared; statistical significance was calculated using t-test. Significance for all analysis was set at p < .05. We have used Sigmastats software (Sigma Statistical Solutions, Calgary, AB, Canada, http://www.sigmastats.com). All values were expressed as the mean and SEM. Each irradiation group consisted of 10 animals (n = 10). The nonirradiated control group consisted of five animals (n = 5).


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
Isolation and Characterization of hMSCs Expanded from BM
Phenotypic analysis showed that hMSCs used in these experiments were strongly positive for the specific surface antigens SH2 and SH3 (37.3% ± 4.0% and 72.9% ± 3.7%, respectively). Almost no contamination (0.2% ± 0.1% CD 45+ cells) by hematopoietic cells was evidenced in the samples (Fig. 1Go). In vitro culture experiments showed that the cells were still able to differentiate into the osteoblast, chondrocyte, and adipocyte lineages (data not shown).


Figure 1
View larger version (40K):
[in this window]
[in a new window]
  		Figure 1. FACS analysis. Determination of frequency of positive cells for specific markers of human mesenchymal stem cells at second passage, SH2 (CD105) and SH3 (CD73) and positive cells for CD45 (hematopoietic cell marker). Representative FACS plot analysis of the graft sample. Abbreviations: FACS, fluorescence-activated cell sorter; FITC, fluorescein isothiocyanate; IgG1, immunoglobulin G 1; PE, phycoerythrin.

 
For the different BM samples studied, amplification factor from MNC to grafting sample cells has been estimated ex vivo to range from 3,443 to 20,663. From the second to the 15th passage, the published doubling time of the cultured hMSCs is 1.7 days [30].

Irradiation Induces Tissue Injuries in the Untransplanted NOD/SCID Controls as Shown by Histological Analysis
Fifteen days after a 3.5-Gy TBI, cellular depletion was observed in the spleen (Fig. 2AGo), and hemorrhage was observed in the BM (Fig. 2BGo). After 8-Gy abdominal irradiation, villus atrophy, marked crypt loss, and inflammatory infiltrate (Fig. 2CGo, green arrow) of the submucosal layer were observed. Local irradiation of the leg induced ulcerated zones and a modification of the thickness of dermis (Fig. 2DGo, black arrow) of the skin. No injury was observed in nonirradiated tissues (Fig. 2E–2HGo).


Figure 2
View larger version (78K):
[in this window]
[in a new window]
  		Figure 2. Histological examination of radiation exposed tissues by HES staining. (A): Spleen with cellular depletion. (B): Bone marrow with hemorrhage (black arrow). (C): Gut with villus atrophy and inflammatory infiltrates of the submucosal layer (green arrow). (D): modification of the thickness of dermis of irradiated right hind leg (black arrow). (E–H): Nonirradiated controls include spleen (E), bone marrow (F), gut (G), and skin (H).

 
Infused hMSCs Are Moderately Present in Unconditioned (Nonirradiated) NOD/SCID Mice Tissues
Quantitative PCR analysis indicated that after their infusion into nonirradiated animals (n = 10), hMSCs homed to various tissues, albeit at a very low level. Human DNA accounted for engraftment of 0.06% hMSCs in lungs (Fig. 3BGo) and 0.14% in BM (Fig. 4DGo). No significant hMSC engraftment was found in the brain (Fig. 3AGo), kidneys (Fig. 5BGo), liver (Fig. 5AGo), gut (Fig. 5EGo), stomach (Fig. 5CGo), heart (Fig. 3CGo), skin (Fig. 4AGo), muscle (Fig. 4BGo), bone (Fig. 4CGo), or peripheral blood.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
  		Figure 3. Comparison of implantations of hMSC in brain, lung, and heart tissues for mice irradiated according to three configurations of irradiation (TBI, IA, right posterior leg exposure or nonirradiated control mice). (A): hMSC engraftment rate was significantly increased in brain after irradiation, when compared with controls. (B): Abdominal irradiation significantly increased hMSC engraftment in lung when compared with other settings. (C): hMSC engraftment in heart tissues was significantly higher after irradiation of all type than in nonirradiated controls. All values were expressed as the mean and SEM. Significance for all analyses was set at p < .05 (*), p < .01 (**), and p < .001 (***). Each group was constituted of 10 animals (n = 10). Abbreviations: hMSC, human mesenchymal stem cell; IA, irradiation to the abdomen; MSC, mesenchymal stem cell; ns, nonsignificance; TBI, total body irradiation.

 

Figure 4
View larger version (22K):
[in this window]
[in a new window]
  		Figure 4. Comparison of implantation of hMSC in right posterior leg tissues for mice irradiated according to three configurations of irradiation (TBI, IA, right posterior leg exposure) or nonirradiated control mice. (A): hMSC engraftment rate was significantly increased in skin after TBI or right leg exposure when compared with IA or nonirradiated controls. (B): hMSC engraftment rate was significantly increased in muscle after TBI or right leg exposure when compared with IA or nonirradiated controls. (C): hMSC engraftment rate in bone was significantly increased after posterior leg exposure when compared with other irradiation protocols or nonirradiated controls. (D): hMSC engraftment rate was significantly increased in the bone marrow after TBI or abdominal irradiation when compared with right hind leg exposure or nonirradiated controls. All values were expressed as the mean and SEM. Significance for all analysis was set at p < .05 (*), p < .01 (**), and p < .001 (***). Each group was constituted of 10 animals (n = 10). Abbreviations: hMSC, human mesenchymal stem cell; MSC, mesenchymal stem cell; ns, nonsignificance; TBI, total body irradiation.

 

Figure 5
View larger version (26K):
[in this window]
[in a new window]
  		Figure 5. Comparison of implantations of hMSC in abdominal tissues for mice irradiated according to three configurations of irradiation (TBI, IA, and right posterior leg exposure) or nonirradiated control mice. (A): hMSC engraftment rate was significantly increased in liver when compared with controls. (B): Significantly increased hMSC engraftment was observed in kidney after both local irradiations, when compared with TBI or nonirradiated controls. (C): Significantly increased hMSC engraftment was observed in stomach after both local irradiations, when compared with TBI or nonirradiated controls. (D): Significantly increased hMSC engraftment was observed in spleen after abdominal irradiation when compared with TBI alone, right hind leg exposure or nonirradiated controls. (E): Significantly increased hMSC engraftment was observed in gut after right leg exposure or abdominal irradiation when compared with TBI or nonirradiated control. All values were expressed as the mean and SEM. Significance for all analyses was set at p < .05 (*), p < .01 (**), and p < .001 (***). Each group was constituted of 10 animals (n = 10). Abbreviations: hMSC, human mesenchymal stem cell; IA, irradiation to the abdomen; MSC, mesenchymal stem cell; ns, nonsignificance; TBI, total body irradiation.

 
HMSCs Are Present to a Higher Level and in More Organs after TBI
Higher percentages of hMSCs were found in the brain (0.07%, Fig. 3AGo), heart (0.05%, Fig. 3CGo), liver (0.11%, Fig. 5AGo), BM (0.37%, Fig. 4DGo), and muscles (0.12%, Fig. 4BGo). TBI induced a 2.8-fold increase on engraftment levels of hMSCs in the brain (p < .05), threefold in the heart (p < .05), 2.5-fold in the liver (p < .05), 2.6-fold in BM (p < .001), and 1.7-fold in muscles (p < .05) when compared with nonirradiated transplanted mice. TBI did not significantly increase hMSC frequency in the lungs (0.04%, Fig. 3BGo). We detected human ß-GLOBIN gene in lung and heart, suggesting a blood vessel circulation of infused hMSCs after TBI and 14 days after infusion.

hMSCs Are Found Preferentially in Areas of the Body that Have Received the Highest Irradiation Dose
Figure 4Go indicates the quantitiative engraftment hMSCs in leg tissues, and Figure 5Go indicates the levels of hMSC engraftment in abdominal tissues. Mice have received localized irradiation to the abdomen or the right leg in addition to TBI. Abdominal irradiation, as compared with right leg irradiation, increased hMSC engraftment in the exposed area by twofold in the gut (p < .001) (Fig. 5EGo), 2.3-fold in the liver, and 9.3-fold in the spleen (Fig. 5A and 5DGo, respectively). In organs outside the abdomen, hMSC engraftment was increased by 1.8-fold in BM (Fig. 4DGo) and 11.6-fold in the lungs (Fig. 3BGo) (p < .05).

Conversely, right leg irradiation, as compared with abdominal irradiation, increased hMSC engraftment in the exposed area by fivefold in the skin (p < .05) and threefold in quadriceps muscles (p < .001) (Fig. 4A and 4BGo, respectively).

Neither of the localized irradiations significantly modified hMSC engraftment in stomach (Fig. 5CGo), kidney (Fig. 5BGo) or heart tissues (Fig. 3CGo).

The increased hMSC engraftments, in particular in the brain (Fig. 3AGo), after a 30-Gy irradiation of leg and an 8-Gy irradiation of the abdomen (2.2-fold, p < .05) suggest a distant (absopal) effect of radiation damage.

Localization of hMSCs in Engrafted Tissues by Immunohistology and Comparison with PCR Analysis
To localize human cells in engrafted tissues, we performed immunohistologic experiments using a human ß-2-microglobulin–specific antibody. Staining was carried out on the spleen of conditioned mice recipients and on lungs of animals irradiated locally. Cells expressing the human ß-2-microglobulin were either insulated or gathered in clusters in the spleen. This positive result was related to 10% of the cells which recolonized the spleen on the total section 14 days after hMCS graft (Fig. 6AGo). We observed clusters of human ß-2-microglobulin–positive cells in the lungs after abdominal exposure to radiation. These aggregations were localized in perivascular position (Fig. 6BGo). Moreover, we observed the migration of human cells through the vascular wall and an intravascular colonization under intima. Figure 6C and 6DGo show a negative control corresponding to the spleen and lung. In limited perivascular areas of the lung, up to 45% ± 2% of the cells stained positive for the human ß-2-microglobulin. Nevertheless, in other lung areas, no human cell was detected. In contrast to immunohistochemistry analysis, quantitative PCR analysis indicated lower levels of engraftment. PCR is representative of larger sections of tissues both with high levels of implantation of hMSCs and areas with only mouse cells. We have not observed a large interanimal variability for hMSC engraftment in the brain and heart. In tissues such as the liver, the variability was slightly more important (Fig. 7Go).


Figure 6
View larger version (159K):
[in this window]
[in a new window]
  		Figure 6. Human ß-2-microglobuline immunostaining in lung and spleen. The human cells expressing the human ß-2-microglobulin are stained in red. (A): Spleen 15 days after total body irradiation (TBI). Human cells were insulated (white arrow) or gathered in cluster (black arrow) in contact with conjunctive structure of spleen. (B): Lung after localized radiation exposure, clusters of positive cells in perivascular position (black arrow) and passage of human cells through the vascular wall and an intravascular colonization. (C): Negative control (spleen) 15 days after TBI. (D): Negative control (lung) 15 days after TBI.

 

Figure 7
View larger version (6K):
[in this window]
[in a new window]
  		Figure 7. Interanimal variability for human mesenchymal stem cell (hMSC) engraftment. Polymerase chain reaction analysis of percentage of hMSC engraftment in the brain, heart, and liver of 10 animals. Percentage of hMSCs engrafted 15 days after total body irradiation.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In the past decade, there has been considerable interest in the capacities of MSCs to increase hematopoietic recovery and contribute to tissue repair in humans. There have been reports on infusion of MSCs in patients with osteogenesis imperfecta and in animal models with myocardial infarction [31–33]. Other studies have addressed the contribution of the infusion of total BM which combines hematopoietic stem cells and MSCs.

We addressed the question of the potential therapeutic impact of the infusion of MSCs in the context of irradiation damage. We questioned the distribution of MSCs infused intravenously to various tissues in relation to the dose and the distribution of irradiation.

In an effort to answer this question, we built a preclinical model in which hMSCs were infused to NOD/SCID mice, without previous irradiation and after irradiation. Irradiation consisted of sublethal TBI at 3.5 Gy in all animals. To test the impact of localized additional lesions that potentially occur in humans after accidental irradiation (heterogeneous fields), we subjected one group to irradiation of the right hind leg (30 Gy) and another group to irradiation of the abdomen (8 Gy).

We used histology to check the presence of the expected radio-induced lesions in the irradiation fields. We quantified engraftment by PCR for human ß-GLOBIN gene and identified human cells in engrafted tissues by immunohistology using a human ß-2-microglobulin–specific antibody.

Our first observation was that in the absence of irradiation, hMSCs engrafted in the lungs and BM, albeit at a very low level. Previous studies have shown detection of MSCs in multiple tissues (e.g., bone, lungs, heart, liver, kidneys, and spleen) from the first hours to 7 days after systemic injection of murine MSCs (in the absence of previous irradiation) in nude mice and rats [4, 34]. In this study, however, 2 weeks after infusion, MSCs were detectable only in BM and spleen. Using hMSCs in NOD/SCID mice, we were able to detect hMSCs 14 days after infusion in various organs: The highest levels of MSC engraftment were detected in the lungs, muscles, and BM. Such results in BM are expected because it is the primary residence site for MSCs. A detectable engraftment of MSCs in the lungs might pertain to the incapacity of the larger MSCs to pass through the lung capillaries and/or to attach to endothelial cells in a receptor-mediated process [33].

Our second observation was the expected finding that TBI before hMSC infusion increased the levels of engraftment in several, although not all, tissues.

When dealing with additional irradiation at the two local sites (right hind leg and abdomen), the primary observation was that the hMSCs infused intravenously engrafted in all tissues involved in the local additional irradiation, at the highest levels observed. In this study, we detected a maximum rate of 0.94% of hMSCs in the spleen for animals receiving additional abdominal irradiation and 0.16% in the skin, 0.08% in the quadriceps muscle, and 0.12% into BM for animals receiving additional irradiation of the right hind leg. Previous studies have designed different models with local injuries generated in mice by means other than irradiation (e.g., chemical damage to alter lungs [35] or muscle [18, 36], coronary ligation to induce myocardial infarction [19, 20, 31, 37, 38], partial hepatectomy with 2-acetyl-aminofluorene to prevent hepatocyte division [14, 38], spinal cord surgical injury [11], or use of genetically deficient animals [9, 10, 12, 13, 39]). In all these models, with the exception of the work by Bolno et al., MSCs have been administered locally and not intravenously and in addition have been of murine and not human origin [3]. These studies have shown local engraftment of MSCs in injured tissues and their contribution to tissue repair by differentiation [6, 39–41].

The most relevant observation is that after additional local irradiation, the levels of hMSC engraftment increased not only at the sites of local irradiation, as mentioned above, but in all distant organs or tissues tested outside the local irradiation fields as well. This suggests mobilization induced by cytokines and potentially specific homing induced by chemokines, all released by inflammation [42, 43].

In the described experiments after irradiation and hMSC transplant, most of the implanted human cells were found in weakly damaged areas. In a different set of experiments in a nonhuman primate model submitted to mixed {gamma}-neutron irradiation and infused with green fluorescent protein–labeled non-human primate MSCs, we observed that MSCs engrafted preferentially in regenerating tissues [44]. These results suggest that MSCs may participate in the preservation of the targeted tissues. Whether MSC engraftment in irradiated tissues improves their functional recovery remains to be studied. For these future studies, the knowledge of the influence of the pluripotentiality, replicative capacity, and "stemness" of the stroma-derived cells or their engraftment potential is a prerequisite. The comparison of the engraftment of cell populations with various differentiation abilities will offer important insight concerning the future of the clinical use of MSCs.

In our view, this work supports the use of MSC infusion to repair damaged tissues in patients after accidental irradiation and may be used in patients who will undergo controlled radiotherapy for the treatment of solid tumors.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
We thank Patrice Richard and Magali Leroy for their helpful contributions. This study was supported by grants from Electricité de France and the Région Ile de France.


   DISCLOSURES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors indicate no potential conflicts of interest.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Deans RJ, Moseley AB. Mesenchymal stem cells: Biology and potential clinical uses. Exp Hematol 2000;28:875–884.[CrossRef][Medline]

  2. Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.[Abstract/Free Full Text]

  3. Bolno PB, Wechsler A, Kresh JY. Chemokine induced migration of human mesenchymal stem cells: A strategy for directing cardiac repair. J Am Coll Surg 2004;199:33.

  4. Erices AA, Allers CI, Conget PA et al. Human cord blood-derived mesenchymal stem cells home and survive in the marrow of immunodeficient mice after systemic infusion. Cell Transplant 2003;12:555–561.[Medline]

  5. Almeida-Porada G, Zanjani ED. A large animal noninjury model for study of human stem cell plasticity. Blood Cells Mol Dis 2004;32:77–81.[CrossRef][Medline]

  6. Allers C, Sierralta WD, Neubauer S et al. Dynamic of distribution of human bone marrow-derived mesenchymal stem cells after transplantation into adult unconditioned mice. Transplantation 2004;78:503–508.[Medline]

  7. Bensidhoum M, Chapel A, Francois S et al. Homing of in vitro expanded Stro-1– or Stro-1+ human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 2004;103:3313–3319.[Abstract/Free Full Text]

  8. Devine SM, Cobbs C, Jennings M et al. Mesenchymal stem cells distribute to a wide range of tissues after systemic infusion into nonhuman primates. Blood 2003;101:2999–3001.[Abstract/Free Full Text]

  9. Horwitz EM, Prockop DJ, Fitzpatrick LA et al. Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat Med 1999;5:309–313.[CrossRef][Medline]

  10. Schwarz EJ, Alexander GM, Prockop DJ et al. Multipotential marrow stromal cells transduced to produce L-DOPA: Engraftment in a rat model of Parkinson disease. Hum Gene Ther 1999;10:2539–2549.[CrossRef][Medline]

  11. Chopp M, Zhang XH, Li Y et al. Spinal cord injury in rat: Treatment with bone marrow stromal cell transplantation. Neuroreport 2000;11:3001–3005.[Medline]

  12. Li Y, Chen J, Chen XG et al. Human marrow stromal cell therapy for stroke in rat: Neurotrophins and functional recovery. Neurology 2002; 59:514–523.[Abstract/Free Full Text]

  13. Jin HK, Carter JE, Huntley GW et al. Intracerebral transplantation of mesenchymal stem cells into acid sphingomyelinase-deficient mice delays the onset of neurological abnormalities and extends their life span. J Clin Invest 2002;109:1183–1191.[CrossRef][Medline]

  14. Wang X, Montini E, Al-Dhalimy M et al. Kinetics of liver repopulation after bone marrow transplantation. Am J Pathol 2002;161:565–574.[Abstract/Free Full Text]

  15. Sato Y, Araki H, Kato J et al. Human mesenchymal stem cells xenografted directly to rat liver are differentiated into human hepatocytes without fusion. Blood 2005;106:756–763.[Abstract/Free Full Text]

  16. Jiang Y, Jahagirdar BN, Reinhardt RL et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41–49.[CrossRef][Medline]

  17. Barry FP, Murphy JM. Mesenchymal stem cells: Clinical applications and biological characterization. Int J Biochem Cell Biol 2004;36:568–584.[CrossRef][Medline]

  18. Ferrari G, Cusella-De Angelis G, Coletta M et al. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 1998;279:1528–1530.[Abstract/Free Full Text]

  19. Toma C, Pittenger MF, Cahill KS et al. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 2002;105:93–98.[Abstract/Free Full Text]

  20. Pittenger MF, Martin BJ. Mesenchymal stem cells and their potential as cardiac therapeutics. Circ Res 2004;95:9–20.[Abstract/Free Full Text]

  21. Kurozumi K, Nakamura K, Tamiya T et al. Mesenchymal stem cells that produce neurotrophic factors reduce ischemic damage in the rat middle cerebral artery occlusion model. Mol Ther 2005;11:96–104.[Medline]

  22. Silva GV, Litovsky S, Assad JA et al. Mesenchymal stem cells differentiate into an endothelial phenotype, enhance vascular density, and improve heart function in a canine chronic ischemia model. Circulation 2005;111:150–156.[Abstract/Free Full Text]

  23. Mahmud N, Pang W, Cobbs C et al. Studies of the route of administration and role of conditioning with radiation on unrelated allogeneic mismatched mesenchymal stem cell engraftment in a nonhuman primate model. Exp Hematol 2004;32:494–501.[CrossRef][Medline]

  24. Abbott JD, Huang Y, Liu D et al. Stromal cell-derived factor-1alpha plays a critical role in stem cell recruitment to the heart after myocardial infarction but is not sufficient to induce homing in the absence of injury. Circulation 2004;110:3300–3305.[Abstract/Free Full Text]

  25. Neuss S, Becher E, Woltje M et al. Functional expression of HGF and HGF receptor/c-met in adult human mesenchymal stem cells suggests a role in cell mobilization, tissue repair, and wound healing. STEM CELLS 2004;22:405–414.[Abstract/Free Full Text]

  26. Lapidot T, Petit I. Current understanding of stem cell mobilization: The roles of chemokines, proteolytic enzymes, adhesion molecules, cytokines, and stromal cells. Exp Hematol 2002;30:973–981.[CrossRef][Medline]

  27. Krampera M, Glennie S, Dyson J et al. Bone marrow mesenchymal stem cells inhibit the response of naïve antigen specific T-cells to their cognate peptide. Blood 2003;101:3722–3729.[Abstract/Free Full Text]

  28. Grinnemo KH, Mansson A, Dellgren G et al. Xenoreactivity and engraftment of human mesenchymal stem cells transplanted into infarcted rat myocardium. J Thorac Cardiovasc Surg 2004;127:1293–1300.[Abstract/Free Full Text]

  29. Heid CA, Stevens J, Livak KJ et al. Real time quantitative PCR. Genome Res 1996;6:986–994.[Abstract/Free Full Text]

  30. Lee RH, Kim B, Choi I et al. Characterization and expression analysis of mesenchymal stem cells from human bone marrow and adipose tissue. Cell Physiol Biochem 2004;14:311–324.[CrossRef][Medline]

  31. Kinnaird T, Stabile E, Burnett MS et al. Local delivery of marrow-derived stromal cells augments collateral perfusion through paracrine mechanisms. Circulation 2004;109:1543–1549.[Abstract/Free Full Text]

  32. Shake JG, Gruber PJ, Baumgartner WA et al. Mesenchymal stem cell implantation in a swine myocardial infarct model: Engraftment and functional effects. Ann Thorac Surg 2002;73:1919–1925; discussion 1926.[Abstract/Free Full Text]

  33. Tang YL, Zhao Q, Zhang YC et al. Autologous mesenchymal stem cell transplantation induce VEGF and neovascularization in ischemic myocardium. Regul Pept 2004;117:3–10.[CrossRef][Medline]

  34. Gao J, Dennis JE, Muzic RF et al. The dynamic in vivo distribution of bone marrow-derived mesenchymal stem cells after infusion. Cells Tissues Organs 2001;169:12–20.[CrossRef][Medline]

  35. Ortiz LA, Gambelli F, McBride C et al. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci U S A 2003;100:8407–8411.[Abstract/Free Full Text]

  36. Santa Maria L, Rojas CV, Minguell JJ. Signals from damaged but not undamaged skeletal muscle induce myogenic differentiation of rat bone-marrow-derived mesenchymal stem cells. Exp Cell Res 2004;300:418–426.[CrossRef][Medline]

  37. Min JY, Sullivan MF, Yang Y et al. Significant improvement of heart function by cotransplantation of human mesenchymal stem cells and fetal cardiomyocytes in postinfarcted pigs. Ann Thorac Surg 2002;74:1568–1575.[Abstract/Free Full Text]

  38. Bittira B, Shum-Tim D, Al-Khaldi A et al. Mobilization and homing of bone marrow stromal cells in myocardial infarction. Eur J Cardiothorac Surg 2003;24:393–398.[Abstract/Free Full Text]

  39. Jiang Y, Vaessen B, Lenvik T et al. Multipotent progenitor cells can be isolated from postnatal murine bone marrow, muscle, and brain. Exp Hematol 2002;30:896–904.[CrossRef][Medline]

  40. Satoh H, Kishi K, Tanaka T et al. Transplanted mesenchymal stem cells are effective for skin regeneration in acute cutaneous wounds. Cell Transplant 2004;13:405–412.[Medline]

  41. Herrera MB, Bussolati B, Bruno S et al. Mesenchymal stem cells contribute to the renal repair of acute tubular epithelial injury. Int J Mol Med 2004;14:1035–1041.[Medline]

  42. Van der Meeren A, Mouthon MA, Vandamme M et al. Combinations of cytokines promote survival of mice and limit acute radiation damage in concert with amelioration of vascular damage. Radiat Res 2004;161:549–559.[Medline]

  43. Grimm PC, Nickerson P, Jeffery J et al. Neointimal and tubulointerstitial infiltration by recipient mesenchymal cells in chronic renal-allograft rejection. N Engl J Med 2001;345:93–97.[Abstract/Free Full Text]

  44. Chapel A, Bertho JM, Bensidhoum M et al. Mesenchymal stem cells home to injured tissues when co-infused with haematopoetic cells to treat a radiation-induced multi-organ failure syndrome. J Gene Med 2003;5:1028–1038.[CrossRef][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2005-0260v1
24/4/1020    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by François, S.
Right arrow Articles by Chapel, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by François, S.
Right arrow Articles by Chapel, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS
http://www.stemcellsportal.com/