| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TISSUE-SPECIFIC STEM CELLS |
a Laboratoire de Thérapie Cellulaire et Radioprotection Accidentelle, Institut de Radioprotection et de Sûreté Nucléaire, Fontenay aux Roses CEDEX, France;
b EA 1638, Laboratoire de Thérapie Cellulaire et Radioprotection Accidentelle, Faculté de Médecine Saint Antoine, Université Paris VI Pierre et Marie Curie, Paris, France;
c Service d’Hématologie et de Thérapie cellulaire, Hôpital Saint Antoine, Paris, France
Key Words. Mesenchymal stem cell • Injured tissues • Homing • Transplantation • Irradiation
Correspondence: Alain Chapel, Ph.D., IRSN, DRPH/SRBE/LTCRA, BP17 Fontenay aux Roses Cedex 92262, France. Telephone: 33 1 58 35 95 46; Fax: 33 1 58 35 84 67; e-mail: alain.chapel{at}irsn.fr
Received on June 10, 2005;
accepted for publication on November 16, 2005.
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
In several animal models, it has been shown that syngeneic or xenogeneic MSCs administered intravenously are able to engraft into the BM and other tissues in animals with [4–6] or without a pretransplant total body irradiation (TBI) [7, 8]. However, the levels of engraftment in these two different settings have not been compared. MSCs engraft in vivo in several injured tissues [9–14] such as the liver [15, 16]; moreover, primary researches showed that MSCs can graft themselves in muscles [17, 18] and myocardium [19]. In humans, the use of MSCs is being tested for tissue remodeling, including cardiovascular repair, treatment of lung fibrosis, spinal cord injury, bone and cartilage repair (reviewed in [17, 20]). Regarding radio-induced lesions, multiple studies have shown engraftment of MSCs at the site of injury [21–23] but very few have evaluated MSC engraftment in other tissues (outside the irradiation field). The amount of MSCs detected in most tissues is exceedingly low. The signaling pathways responsible for their directed migration still remain unknown, although recent reports have suggested a role for chemokines in human MSC (hMSC) migration [3]. Several studies have begun to elucidate the mechanisms by which stem cells are mobilized from BM to a particular organ and the molecular mediators that orchestrate this process [24–26].
For these studies, xenogenic models are powerful but somewhat controversial models. Essential signals such as cytokine/ receptor interactions may be hampered by species differences. Although the xenogeneicity does not prevent the differentiation, it slightly decreases the migratory ability of the MSCs toward different tissues. This decrease seems to be the result of weak connection between the receptors and ligands of different species [19]. Although it was described that both human and murine MSCs are immunosuppressive, major differences exist between MSCs from the two species. Murine MSCs, unlike their human equivalent, lack major histocompatibility complex class II expression [27]. The host’s crippled immune system could also somehow hinder engraftment but transplant rejection can occur in xenogenic models. However, when transplanted into an immunoincompetent host, adult hMSCs showed persistent engraftment [28].
The first challenge in therapeutic MSC transplantation is efficient delivery to the sites of intended action. In this paper, we describe a xenogeneic experimental transplant model we built to evaluate the full potential of hMSC engraftment and we compare TBI with and without additional localized exposures (leg and abdominal areas). In this study, we used the nonobese diabetic/severe combined immunodeficient (NOD/ SCID) mouse model to evaluate the engraftment of hMSCs in irradiated mice and to have the minimum of animals developing a transplant rejection. Our results showed that after transplantation into adult unconditioned mice, hMSCs migrate not only in BM and lungs as previously reported but also into muscle tissues [6]. TBI increased hMSC implantation in BM and muscle and, furthermore, led to engraftment in brain, heart, and liver. Local irradiation, in addition to TBI, increased specific homing of injected cells both to the injured tissues and to other tissues outside the local irradiation field. We feel these observations may be relevant to several clinical situations such as TBI given as a pretransplant conditioning regimen, radiotherapy for the treatment of cancer, and accidental irradiation, in promoting the use of MSC infusion as part of the therapeutic scheme.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
FACS Analysis
After trypsin EDTA treatment, the human cells were washed and resuspended in phosphate-buffered saline (PBS) supplemented with 0.5% bovine serum albumin (BSA; Sigma, St. Louis, http://www.sigmaaldrich.com) in aliquots of 2 x 105 cells. Stainings were done with phycoerythrin (PE)-conjugated monoclonal antibody against CD105 (SH2), CD73 (SH3), and CD45 (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com) for 30 minutes at 4°C followed by two washes in PBS containing 0.5% BSA. Cells were resuspended in 200 µl of PBS, 0.5% BSA, and analyzed at 10,000 events per test by FACScalibur BD Pharmingen (San Diego, http://www.bdbiosciences.com/pharmingen). Mouse immunoglobulin G1 (IgG1) were used as isotopic controls (Beckman Coulter, Fullerton, CA, http://www.beckmancoulter.com).
hMSC Infusion into NOD/SCID Mouse Model
All experiments and procedures were performed in compliance with the French Ministry of Agriculture regulations for animal experimentation (Act no. 87–847, October 19, 1987, modified May 2001). NOD-LtSz-scid/scid (NOD-SCID) mice from breeding pairs originally purchased from Jackson Laboratory (Bar Harbor, ME, http://www.jax.org) were bred in our pathogen-free unit and maintained in sterile micro-isolator cages. A total of 60 8-week-old mice, divided in five groups, were used for this study. The hMSCs were delivered intravenously by tail vein injection into each mouse with Myjector syringe of 1 ml, TERUMO (Terumo Medical Corporation, Somerset, NJ, http://www.terumomedical.com) 29-gauge x .05. Twenty-four hours after radiation exposure (using a 137Cs source), four groups of these NOD/SCID mice were transplanted with a dose of 5 x 106 P2 hMSCs in 100 µl of PBS 1X; the fifth group was used as a control group and did not receive hMSC infusion. On average, one BM was used to inject five mice. Group 1 was not irradiated before receiving hMSC infusion. Groups 2–4 received TBI at a sublethal dose of 3.5 Gy before hMSC infusion as follows: Group 2 received TBI only; group 3 received local irradiation to the abdomen (IA) at a dose of 4.5 Gy in addition to TBI; and group 4 received local irradiation to the right posterior leg (irradiation leg) at 26.5 Gy in addition to TBI. Each group had its own control of five animals that did not receive hMSCs. The animals were sacrificed 15 days after irradiation, and the quantitative and spatial distribution of the hMSCs was studied through polymerase chain reaction (PCR) and immunohistology analysis. Peripheral blood, BM (femur), heart, lungs, liver, kidneys, spleen, stomach, gut, brain, right and left posterior legs, quadriceps muscles, tibias, and skin were collected. Before infusion when hMSCs at second passage were collected, the rates of viability to trypan blue were 98%.
Detection and Quantitative Analysis of Engrafted hMSCs: DNA Extraction and PCR Analysis
The biological samples were submitted to DNA extraction and PCR analysis to detect the presence of human cells in mice recipients. Genomic DNA for PCR analysis was prepared from tissues using the QIAamp DNA Mini Kit (Qiagen, Valencia, CA, http://www1.qiagen.com). Amplifications were performed in accordance with the standard recommended amplification conditions (Applied BioSystems, Foster City, CA, http://www.appliedbiosystems.com) as previously described by Heid and colleagues [29]. The value of DNA contained in each somatic cell (diploid) is 6.16 pg with two copies of nonrepeated gene. This value was used to calculate the number of gene copies that contain a certain amount of human or mouse DNA (measured by PCR). Therefore, DNA and copy number are proportional to the number of cells. The ratio of human DNA to mouse DNA directly gives the number of human cell in mouse cell tissues. Amplification of human ß-GLOBIN gene was used to quantify the amount of human DNA in each sample of mouse tissue after DNA extraction. Endogenous mouse RAPSYN (receptor-associated protein at the synapse) gene was also amplified, as an internal control. Absolute standard curves were generated for the human ß-GLOBIN and mouse RAPSYN genes and used to quantify the amount of human DNA in each mouse tissue. Evaluation of human specificity of human ß-GLOBIN amplification was demonstrated using tenfold dilution for 100 ng–0.05 ng of hMSC DNA with mouse DNA, without cross-reactivity, to quantify human cells in mouse tissue. One hundred nanograms of purified DNA from various tissues were amplified using TaqMan universal PCR master mix (Applied BioSystems). The primers and probe for human ß-GLOBIN were forward primer 5'GTGCACCTGACTCCTGAGGAGA3' and reverse primer 5'CCTTGATACCAACCTGCCCAGG3', and the probe labeled with fluorescent reporter and quencher was 5'FAM-AAGGTGAACGTGGATGAAGTTGGTGG-TAMRA-3'. The primers and probe for mouse RAPSYN gene were forward primer 5'AC-CCACCCATCCTGCAAAT3' and reverse primer 5'ACCTGTCCGTGCTGCAGAA3'. To determine the efficiency of amplification and the assay precision, calibration curves for human ß-GLOBIN and mouse RAPSYN genes were constructed with a 0.99 correlation (r2) and efficiency superior to 98%. A 100% efficiency corresponded to a slope of –3.32 as determined by the following equation: efficiency = 10(–1/slope) – 1. Mouse DNA was isolated from the identical tissues of nontransplanted NOD/SCID mice and used as a negative control. Also, human DNA was isolated from hMSC culture and used as a positive control. The results were expressed in number of human cells per 100 mouse cells in each tissue (directly related to the numbers of copies of human ß-GLOBIN and mouse RAPSYN genes).
Immunohistochemistry
After paraformaldehyde fixation, the organs were rinsed with distilled water and dehydrated. Blocks were cut at 5 µm on a rotary microtome (Leica, Heerbrugg, Switzerland, http://www.leica.com). For immunohistochemical staining of the paraffin-embedded samples, microtomed sections were deparaffinized in xylene and rehydrated through ethanol baths and PBS. After being rinsed with distilled water bath for 5 minutes, the sections were dipped into PBS-Triton in order to increase tissue permeability. The sections were digested with 2% trypsin for 30 minutes, thus exposing masked epitopes. The polyclonal anti-ß-2-microglobuline antibody (product NCL-B2Mp; Novocastra Ltd., Newcastle upon Tyne, U.K., http://www.novocastra.co.uk) was added at a dilution of 1:50. Negative controls were incubated with rabbit IgG diluted to 1:100. Detection of bound primary antibody was carried out with biotinylated secondary antibody. The biotinylated anti-rabbit IgG secondary antibody was diluted to 1:200, in PBS, and applied for 8 minutes. The slides were subsequently incubated with six-solution Ventana kit to make alkaline phosphatase reaction with FARED substrate for 30 minutes. For antibody detection, the Ventana kit (Ventana Medical Systems, Illkirch Cedex, France, http://www.ventanamed.com) was used, followed by counterstaining with hemalyn for 4 minutes. This procedure was controlled by NEXES 8 software. On successive sections, we carried out an hematoxylin-eosin-safran staining.
Statistical Analysis
To determine the effect of exposure radiation on engraftment of hMSCs, the rates of implantation were compared; statistical significance was calculated using t-test. Significance for all analysis was set at p < .05. We have used Sigmastats software (Sigma Statistical Solutions, Calgary, AB, Canada, http://www.sigmastats.com). All values were expressed as the mean and SEM. Each irradiation group consisted of 10 animals (n = 10). The nonirradiated control group consisted of five animals (n = 5).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
). In vitro culture experiments showed that the cells were still able to differentiate into the osteoblast, chondrocyte, and adipocyte lineages (data not shown).
|
Irradiation Induces Tissue Injuries in the Untransplanted NOD/SCID Controls as Shown by Histological Analysis
Fifteen days after a 3.5-Gy TBI, cellular depletion was observed in the spleen (Fig. 2A), and hemorrhage was observed in the BM (Fig. 2B). After 8-Gy abdominal irradiation, villus atrophy, marked crypt loss, and inflammatory infiltrate (Fig. 2C, green arrow) of the submucosal layer were observed. Local irradiation of the leg induced ulcerated zones and a modification of the thickness of dermis (Fig. 2D, black arrow) of the skin. No injury was observed in nonirradiated tissues (Fig. 2E–2H).
|
) and 0.14% in BM (Fig. 4D). No significant hMSC engraftment was found in the brain (Fig. 3A), kidneys (Fig. 5B), liver (Fig. 5A), gut (Fig. 5E), stomach (Fig. 5C), heart (Fig. 3C), skin (Fig. 4A), muscle (Fig. 4B), bone (Fig. 4C), or peripheral blood.
|
|
|
), heart (0.05%, Fig. 3C), liver (0.11%, Fig. 5A), BM (0.37%, Fig. 4D), and muscles (0.12%, Fig. 4B). TBI induced a 2.8-fold increase on engraftment levels of hMSCs in the brain (p < .05), threefold in the heart (p < .05), 2.5-fold in the liver (p < .05), 2.6-fold in BM (p < .001), and 1.7-fold in muscles (p < .05) when compared with nonirradiated transplanted mice. TBI did not significantly increase hMSC frequency in the lungs (0.04%, Fig. 3B). We detected human ß-GLOBIN gene in lung and heart, suggesting a blood vessel circulation of infused hMSCs after TBI and 14 days after infusion.
hMSCs Are Found Preferentially in Areas of the Body that Have Received the Highest Irradiation Dose
Figure 4 indicates the quantitiative engraftment hMSCs in leg tissues, and Figure 5 indicates the levels of hMSC engraftment in abdominal tissues. Mice have received localized irradiation to the abdomen or the right leg in addition to TBI. Abdominal irradiation, as compared with right leg irradiation, increased hMSC engraftment in the exposed area by twofold in the gut (p < .001) (Fig. 5E), 2.3-fold in the liver, and 9.3-fold in the spleen (Fig. 5A and 5D, respectively). In organs outside the abdomen, hMSC engraftment was increased by 1.8-fold in BM (Fig. 4D) and 11.6-fold in the lungs (Fig. 3B) (p < .05).
Conversely, right leg irradiation, as compared with abdominal irradiation, increased hMSC engraftment in the exposed area by fivefold in the skin (p < .05) and threefold in quadriceps muscles (p < .001) (Fig. 4A and 4B, respectively).
Neither of the localized irradiations significantly modified hMSC engraftment in stomach (Fig. 5C), kidney (Fig. 5B) or heart tissues (Fig. 3C).
The increased hMSC engraftments, in particular in the brain (Fig. 3A), after a 30-Gy irradiation of leg and an 8-Gy irradiation of the abdomen (2.2-fold, p < .05) suggest a distant (absopal) effect of radiation damage.
Localization of hMSCs in Engrafted Tissues by Immunohistology and Comparison with PCR Analysis
To localize human cells in engrafted tissues, we performed immunohistologic experiments using a human ß-2-microglobulin–specific antibody. Staining was carried out on the spleen of conditioned mice recipients and on lungs of animals irradiated locally. Cells expressing the human ß-2-microglobulin were either insulated or gathered in clusters in the spleen. This positive result was related to 10% of the cells which recolonized the spleen on the total section 14 days after hMCS graft (Fig. 6A). We observed clusters of human ß-2-microglobulin–positive cells in the lungs after abdominal exposure to radiation. These aggregations were localized in perivascular position (Fig. 6B). Moreover, we observed the migration of human cells through the vascular wall and an intravascular colonization under intima. Figure 6C and 6D show a negative control corresponding to the spleen and lung. In limited perivascular areas of the lung, up to 45% ± 2% of the cells stained positive for the human ß-2-microglobulin. Nevertheless, in other lung areas, no human cell was detected. In contrast to immunohistochemistry analysis, quantitative PCR analysis indicated lower levels of engraftment. PCR is representative of larger sections of tissues both with high levels of implantation of hMSCs and areas with only mouse cells. We have not observed a large interanimal variability for hMSC engraftment in the brain and heart. In tissues such as the liver, the variability was slightly more important (Fig. 7).
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
We addressed the question of the potential therapeutic impact of the infusion of MSCs in the context of irradiation damage. We questioned the distribution of MSCs infused intravenously to various tissues in relation to the dose and the distribution of irradiation.
In an effort to answer this question, we built a preclinical model in which hMSCs were infused to NOD/SCID mice, without previous irradiation and after irradiation. Irradiation consisted of sublethal TBI at 3.5 Gy in all animals. To test the impact of localized additional lesions that potentially occur in humans after accidental irradiation (heterogeneous fields), we subjected one group to irradiation of the right hind leg (30 Gy) and another group to irradiation of the abdomen (8 Gy).
We used histology to check the presence of the expected radio-induced lesions in the irradiation fields. We quantified engraftment by PCR for human ß-GLOBIN gene and identified human cells in engrafted tissues by immunohistology using a human ß-2-microglobulin–specific antibody.
Our first observation was that in the absence of irradiation, hMSCs engrafted in the lungs and BM, albeit at a very low level. Previous studies have shown detection of MSCs in multiple tissues (e.g., bone, lungs, heart, liver, kidneys, and spleen) from the first hours to 7 days after systemic injection of murine MSCs (in the absence of previous irradiation) in nude mice and rats [4, 34]. In this study, however, 2 weeks after infusion, MSCs were detectable only in BM and spleen. Using hMSCs in NOD/SCID mice, we were able to detect hMSCs 14 days after infusion in various organs: The highest levels of MSC engraftment were detected in the lungs, muscles, and BM. Such results in BM are expected because it is the primary residence site for MSCs. A detectable engraftment of MSCs in the lungs might pertain to the incapacity of the larger MSCs to pass through the lung capillaries and/or to attach to endothelial cells in a receptor-mediated process [33].
Our second observation was the expected finding that TBI before hMSC infusion increased the levels of engraftment in several, although not all, tissues.
When dealing with additional irradiation at the two local sites (right hind leg and abdomen), the primary observation was that the hMSCs infused intravenously engrafted in all tissues involved in the local additional irradiation, at the highest levels observed. In this study, we detected a maximum rate of 0.94% of hMSCs in the spleen for animals receiving additional abdominal irradiation and 0.16% in the skin, 0.08% in the quadriceps muscle, and 0.12% into BM for animals receiving additional irradiation of the right hind leg. Previous studies have designed different models with local injuries generated in mice by means other than irradiation (e.g., chemical damage to alter lungs [35] or muscle [18, 36], coronary ligation to induce myocardial infarction [19, 20, 31, 37, 38], partial hepatectomy with 2-acetyl-aminofluorene to prevent hepatocyte division [14, 38], spinal cord surgical injury [11], or use of genetically deficient animals [9, 10, 12, 13, 39]). In all these models, with the exception of the work by Bolno et al., MSCs have been administered locally and not intravenously and in addition have been of murine and not human origin [3]. These studies have shown local engraftment of MSCs in injured tissues and their contribution to tissue repair by differentiation [6, 39–41].
The most relevant observation is that after additional local irradiation, the levels of hMSC engraftment increased not only at the sites of local irradiation, as mentioned above, but in all distant organs or tissues tested outside the local irradiation fields as well. This suggests mobilization induced by cytokines and potentially specific homing induced by chemokines, all released by inflammation [42, 43].
In the described experiments after irradiation and hMSC transplant, most of the implanted human cells were found in weakly damaged areas. In a different set of experiments in a nonhuman primate model submitted to mixed 
-neutron irradiation and infused with green fluorescent protein–labeled non-human primate MSCs, we observed that MSCs engrafted preferentially in regenerating tissues [44]. These results suggest that MSCs may participate in the preservation of the targeted tissues. Whether MSC engraftment in irradiated tissues improves their functional recovery remains to be studied. For these future studies, the knowledge of the influence of the pluripotentiality, replicative capacity, and "stemness" of the stroma-derived cells or their engraftment potential is a prerequisite. The comparison of the engraftment of cell populations with various differentiation abilities will offer important insight concerning the future of the clinical use of MSCs.
In our view, this work supports the use of MSC infusion to repair damaged tissues in patients after accidental irradiation and may be used in patients who will undergo controlled radiotherapy for the treatment of solid tumors.
|
ACKNOWLEDGMENTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
DISCLOSURES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  C. Kyriakou, N. Rabin, A. Pizzey, A. Nathwani, and K. Yong Factors that influence short-term homing of human bone marrow-derived mesenchymal stem cells in a xenogeneic animal model Haematologica, October 1, 2008; 93(10): 1457 - 1465. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. J. Rippon, S. Lane, M. Qin, N.-S. Ismail, M. R. Wilson, M. Takata, and A. E. Bishop Embryonic Stem Cells as a Source of Pulmonary Epithelium In Vitro and In Vivo Proceedings of the ATS, August 15, 2008; 5(6): 717 - 722. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Morigi, M. Introna, B. Imberti, D. Corna, M. Abbate, C. Rota, D. Rottoli, A. Benigni, N. Perico, C. Zoja, et al. Human Bone Marrow Mesenchymal Stem Cells Accelerate Recovery of Acute Renal Injury and Prolong Survival in Mice Stem Cells, August 1, 2008; 26(8): 2075 - 2082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Meuleman, G. Vanhaelen, T. Tondreau, P. Lewalle, J. Kwan, J. Bennani, P. Martiat, L. Lagneaux, and D. Bron Reduced intensity conditioning haematopoietic stem cell transplantation with mesenchymal stromal cells infusion for the treatment of metachromatic leukodystrophy: a case report Haematologica, January 1, 2008; 93(1): e11 - e13. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. H. Klopp, E. L. Spaeth, J. L. Dembinski, W. A. Woodward, A. Munshi, R. E. Meyn, J. D. Cox, M. Andreeff, and F. C. Marini Tumor Irradiation Increases the Recruitment of Circulating Mesenchymal Stem Cells into the Tumor Microenvironment Cancer Res., December 15, 2007; 67(24): 11687 - 11695. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Chamberlain, J. Fox, B. Ashton, and J. Middleton Concise Review: Mesenchymal Stem Cells: Their Phenotype, Differentiation Capacity, Immunological Features, and Potential for Homing Stem Cells, November 1, 2007; 25(11): 2739 - 2749. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Amsalem, Y. Mardor, M. S. Feinberg, N. Landa, L. Miller, D. Daniels, A. Ocherashvilli, R. Holbova, O. Yosef, I. M. Barbash, et al. Iron-Oxide Labeling and Outcome of Transplanted Mesenchymal Stem Cells in the Infarcted Myocardium Circulation, September 11, 2007; 116(11_suppl): I-38 - I-45. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Mouiseddine, S Francois, A Semont, A Sache, B Allenet, N Mathieu, J Frick, D Thierry, and A Chapel Human mesenchymal stem cells home specifically to radiation-injured tissues in a non-obese diabetes/severe combined immunodeficiency mouse model Br. J. Radiol., September 1, 2007; 80(Special_Issue_1): S49 - S55. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chan, S. N. Waddington, K. O'Donoghue, H. Kurata, P. V. Guillot, C. Gotherstrom, M. Themis, J. E. Morgan, and N. M. Fisk Widespread Distribution and Muscle Differentiation of Human Fetal Mesenchymal Stem Cells After Intrauterine Transplantation in Dystrophic mdx Mouse Stem Cells, April 1, 2007; 25(4): 875 - 884. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. He, C. Wan, and G. Li Concise Review: Multipotent Mesenchymal Stromal Cells in Blood Stem Cells, January 1, 2007; 25(1): 69 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, F. Li, and C. Niyibizi Progenitors Systemically Transplanted into Neonatal Mice Localize to Areas of Active Bone Formation In Vivo: Implications of Cell Therapy for Skeletal Diseases Stem Cells, August 1, 2006; 24(8): 1869 - 1878. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
