| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TISSUE-SPECIFIC STEM CELLS |
a Dental Biology Unit, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland, USA;
b Genetics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA;
c Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland, USA;
d Laboratory of Cellular Oncology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USA;
e Office of Clinical Pharmacology and Biopharmaceutics, Center for Drug Evaluation and Research, Food and Drug Administration, Rockville, Maryland, USA;
f Oral Infection and Immunity Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, Maryland, USA
Key Words. Bone marrow–derived mesenchymal stem cell • Malignant transformation • Chromosomal instability • Fibrosarcoma
Correspondence: Songtao Shi, D.D.S., Ph.D., Dental Biology Unit, National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 131, 30 Convent Drive MSC4320, Bethesda, Maryland 20892, USA. Telephone: 301-435-4584; Fax: 301-480-5353; e-mail: sshi{at}mail.nih.gov
Received on August 19, 2005;
accepted for publication on October 31, 2005.
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
In the meantime, multipotent adult progenitor cells (MAPCs) were discovered as an infrequent population of BMMSCs maintained in the adult bone marrow compartment [11]. They are considered an extremely important stem cell resource for regenerative medicine because they were reported to possess pluripotent stem cell characteristics, similar to embryonic stem cells (ESCs); they differentiate into endoderm-, mesoderm-, and ectoderm-derived cells and proliferate extensively without entering into senescence. However, it is important to further verify characteristics of the cells with extensive proliferation in adult bone marrow.
In this study, we found that continuous passages led BMMSCs to spontaneous immortalization. After additional passages, the immortalized BMMSCs became transformed into malignant cells, capable of forming fibrosarcomas in vivo, at least partially, due to accumulated chromosomal abnormalities, amplified c-Myc expression, and elevated telomerase activity. This consecutive conversion of BMMSCs to malignant cells provides an excellent model to study the mechanisms associated with the tumorigenic potential of postnatal stem cells and explore therapeutic strategies for malignant tumors.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
-minimum essential medium (-MEM) (Gibco, Grand Island, NY, http://www.invitrogen.com). The culture medium consisted of -MEM, 20% fetal bovine serum (FBS; Equitech-Bio, Kerrville, TX, http://www.equitech-bio.com), 2 mM L-glutamine (Biofluids, Rockville, MD, http://www.biofluids.com), a combination of 100 U/ml penicillin and 100 µg/ml streptomycin (Biofluids), and 55 µM 2-mercaptoethanol (Gibco). Primary cultures (passage 0 [P0]) were passaged to disperse the colony-forming cells and seeded on freshly prepared culture dishes (P1). Initially, BMMSCs were passed at 1:2–5 dilution when they reached confluence. After BMMSCs were immortalized (at approximately P15), cells were passed at 1:10–20. To obtain single colony–derived BMMSC clones, bone marrow cells were seeded at 1–3 x 106 cells in 15-cm culture dishes and cultured as described above. Colonies were isolated at 14 to 21 days after cultivation. The proliferation rate of BMMSCs was assessed by bromodeoxyuridine (BrdU) incorporation for 4 hours using a BrdU staining Kit (Zymed Laboratories, Inc., San Francisco, http://www.zymed.com). In vitro osteogenic, adipogenic, and chondrogenic assays were done as previously reported [13, 14].
Human MSC Culture
Human bone marrow aspirates from healthy adult volunteers were purchased from AllCells, LLC (Berkeley, CA, http://www.allcells.com). To identify putative BMMSCs, single-cell suspension of 1 x 106 of bone marrow mononuclear cells was seeded into 15-cm culture dishes and nonadherent cells were removed after 4 hours of incubation at 37°C. The adherent cells were cultured with -MEM supplemented with 15% FBS, 100 µM L-ascorbic acid 2-phosphate (Wako Pure Chemical Industries Ltd., Osaka, Japan, http://www.wako-chem.co.jp), 2 mM L-glutamine, and a combination of 100 U/ml penicillin and 100 µg/ml streptomycin. BMMSCs were plated at 1:4 dilution when the cells were approaching confluence. Isolation of dental pulp stem cells and periodontal ligament stem cells was described as previously [15, 16]. They were cultured in the same medium as that used for human BMMSCs and plated at 1:4 dilution when the cells were approaching confluence.
Transplantation and Injection of BMMSCs
Approximately 2–4 x 106 of murine BMMSCs were transplanted into 6- to 8-week-old immunocompromised (bg-nu/nu-xid) mice using hydroxyapatite/tricalcium phosphate (HA/TCP) ceramic powder (Zimmer, Inc., Warsaw, IN, http://www.zimmer.com) and harvested 8 weeks after transplantation [17]. To assess tumorigenesis and migration potential, 1 x 106 of BMMSCs were injected into bg-nu/nu-xid mice subcutaneously and intravenously through tail vein, respectively. In some experiments, tumor cells were dispersed by digesting tumors with 3 mg/ml collagenase type I (Worthington Biochem, Freehold, NJ, http://www.worthington-biochem.com) and 4 mg/ml dispase (Boehringer Mannheim, GmbH, Mannheim, Germany, http://www.boehringer.com). Then tumor cells were injected subcutaneously into second-recipient bg-nu/nu-xid mice. These procedures were performed in accordance with an approved small-animal protocol (National Institute of Dental and Craniofacial Research no. 04–317).
Histological Analysis
Transplants were harvested and demineralized with 10% EDTA before embedding. The paraffin-embedded sections were stained with hematoxylin and eosin, or Mallory trichrome, or incubated with the antibodies for vimentin (Zymed Laboratories, Inc.) and cytokeratin (DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com).
Fluorescence-Activated Cell Sorting Analysis
Cells (1 x 106) were incubated with 1 µg of phycoerythrin (PE)-conjugated antibodies for 45 minutes at 4°C. PE-conjugated isotype-matched immunoglobulin G (IgG) was used as control. Antibodies against CD45, TER119, CD13, Sca-1, Thy-1, CD34, c-kit, CD19, CD3, and CD18 were from BD Biosciences (San Diego, http://www.bdbiosciences.com), and SSEA-1 and Flk-1 were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, http://www.scbt.com).
Spectral Karyotyping and Fluorescent In Situ Hybridization
Metaphase chromosomes for spectral karyotyping (SKY) hybridization were prepared from BMMSCs at different passages. Cells in culture were incubated for 1–2 hours in 0.02 mg/ml Colcemid (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). The cells were incubated in hypotonic solution (0.075 M KCl) and fixed in methanol/acetic acid (3:1). SKY was then performed as described previously, using a combination of five different fluorochromes [18, 19]. Images were acquired with Sky acquisition software (Applied Spectral Imaging, Ltd, Migdal Haemek, Israel, http://www.spectral-imaging.com) using a spectral cube and a CCD (charge-coupled device) camera (Hamamatsu, Bridgewater, NJ, http://jp.hamamatsu.com) connected to a DMRXA microscope (Leica Imaging Systems, Cambridge, U.K., http://www.leica.com) with a custom SKY-3 optical filter (Chroma Technology Corp., Rockingham, VT, http://www.chroma.com). A minimum of 10 metaphases were imaged and karyotyped using SkyView version 1.6.2 software. To confirm the origin of the double-minute chromosomes detected by SKY, dual-color fluorescent in situ hybridization (FISH) was performed with a chromosome-painting probe for chromosome MMU15 and the c-myc gene. DNA was isolated from the BAC clone for c-myc (D15Mit17) and labeled with biotin-16-dUTP (Roche BioMolecular, Indianapolis, https://www.roche-applied-science.com) using a standard nick-translation protocol. Chromosome-painting probe for MMU15 (directly labeled with CyTm5) used for FISH hybridizations was prepared using the same protocols as for labeling of SKY chromosome-painting probes (http://www.riedlab.nci.nih.gov/protocols.asp). FISH probe for c-myc was labeled by Nick translation with biotin-16-dUTP (Roche BioMolecular) and visualized using CW4000 FISH software (Leica Imaging Systems). The condition for hybridization was as described in http://www.riedlab.nci.nih.gov/protocols.asp.
Western Blot Analysis
Cells were lysed in mammalian protein extraction reagent (Pierce Chemical Co., Rockford, IL, http://www.piercenet.com). Ten micrograms of protein per each lane was separated by SDS-PAGE, transferred to a nitrocellulose membrane, and probed with c-Myc (Santa Cruz Biotechnology, Inc.) and ß-actin (Sigma, St. Louis, http://www.sigmaaldrich.com). Bound antibodies were revealed with goat anti-mouse IgG conjugated to horseradish peroxidase (HRP) (Santa Cruz Biotechnology, Inc.), and blots were developed using Super Signal chemiluminescence HRP substrate (Pierce Chemical Co.).
Quantitative Telomerase Activity Assay
The telomerase activity was evaluated using the two-step quantitative-PCR-based telomeric repeat amplification protocol assay as reported previously with slight modification [20]. Briefly, 40 µl of first-step reaction mixture, which contained 2.0 µg of cell lysate diluted into 26 µl of 0.1 mg/ml bovine serum albumin, 1X TRAP standard reaction buffer, 50 µM each deoxynucleotide triphosphate, 0.1 µg of TS oligonucleotide substrate (TS primer; AATCCGTCGAGCAGAGTT), and 0.2 µg of T4 gene protein (Amersham Pharmacia Biotech, Piscataway, NJ, http://www.amersham.com) was incubated at 33°C for 5 hours and 95°C for 10 minutes. Sybr Green real-time Q-PCR assays (Applied BioSystems, Foster City, CA, http://www.appliedbiosystems.com) were carried out using 25 µl of volume containing 1.0 µl of the product from the first step and 300 nM TS and ACX primers (ACX primer; GCGCGGCTTACCCTTACCCTTACCCTAACC). Standard curve was produced for the assay using serially diluted 293 cell extracts, and all samples were run in triplicate.
Telomere Length Assay
Genomic DNA was purified from BMMSCs using a High Pure PCR Template Preparation Kit (Roche Applied Science, Mannheim, Germany, http://www.roche-applied-science.com). Telomere length was assessed by Telo TAGGG Telomere Length Assay kit (Roche Applied Science) according to the manufacturer’s protocol.
Anti-Cancer Drug Treatment
BMMSCs at P1 and transformed BMMSCs at P63 seeded in 96-well plates were treated with etoposide (0–1,000 µg/ml; Alexis Biochemicals, San Diego, http://www.axxora.com, http://sigmaaldrich.com) and doxorubicin (0–30 µg/ml; Sigma) for 48 hours at 37°C. Cell viability was measured by using the Cell Counting Kit-8 from Dojindo Molecular Technologies, Inc. (Gaithersburg, MD, http://www.dojindo.com) according to the manufacturer’s protocol. The inhibition effects of drugs (percentage of control) were calculated as (absorbance of non-treated cells x absorbance of treated cells)/absorbance of non-treated cells. Median effective concentration (EC50) is the drug concentration at which the cell viability becomes 50% of non-treated cells. The experiments were repeated three times. The representative plates were scanned after the reaction.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
). After additional passages, BMMSCs gradually acquired increased proliferating capacity as shown by BrdU incorporation (Fig. 1B). Initially, BMMSCs at P0 formed single-colony clusters (Fig. 1C) and showed multiple in vitro differentiation capabilities to become osteogenic (Fig. 1D), adipogenic (Fig. 1E), and chondrogenic cells (Fig. 1F) under various inductive conditions [21–24]. Upon in vivo transplantation into immunocompromised mice [17], BMMSCs at P1 (Fig. 1G) generated bone and associated marrow components, indicating an in vivo osteogenic differentiation capacity (Fig. 1K). BMMSCs at early stages (P2–P5) demonstrated a slower proliferation rate and an enlarged, flattened cellular morphology, indicative of cellular senescence. However, they gradually gained rapid proliferating ability after overcoming the crisis phase with continuous regular passages [10]. At P13, BMMSCs still maintained a large cell morphology (Fig. 1H) but failed to generate any mineralized tissues in vivo (Fig. 1L), suggesting that BMMSCs have lost their osteogenic differentiation potential after they overcome the crisis phase and acquired proliferating capacity. With further continued passages (P29), the cells became smaller (Fig. 1I) and generated tumors upon in vivo transplantation (Fig. 1M). Moreover, as the passage number increased to P54, the cells showed a significantly smaller morphology (Fig. 1J) and formed tumors with a shorter latent period after transplantation compared with P29 (Fig. 1N), indicating a higher degree of malignancy.
|
). The blue cytoplasmic staining of tumor cells by Mallory trichrome staining suggested fibroblastic differentiation (Fig. 2B). In addition, the positive staining for vimentin (Fig. 2C) and the negative staining for cytokeratin (Fig. 2D) by immunohistochemical analysis revealed their mesenchymal origin. Taken together, these tumors generated by transformed BMMSCs were diagnosed as fibrosarcomas. BMMSCs have been shown to integrate into multiple organs after systemic administration known as "homing" [11, 25]. Therefore, we explored whether the transformed BMMSCs might similarly migrate to multiple organs when injected into immunocompromised mice through the tail vein. At 6–8 weeks after injection, transformed BMMSCs at P65 settled in several organs, including lungs (Fig. 2E), kidneys (Fig. 2F), mediastinum (Fig. 2G), vertebrae (Fig. 2H), and pericardium (data not shown) with in situ tumorigenesis. Furthermore, we investigated whether fibro-sarcoma cells isolated from tumors could regenerate tumors in vivo. Fibrosarcoma cells showed a clonogenic capability at the frequency of 2.4% from total dispersed fibrosarcoma cells (Fig. 2I). The progeny of 20 individual colonies was inoculated into secondary recipient immunocompromised mice subcutaneously. All of these 20 colonies developed fibrosarcomas within 2 weeks (Fig. 2J). This evidence implies that a small population of fibrosarcoma cells, which forms colonies in vitro, maintains the properties of forming tumors upon serial transplantation as previously reported for cancer stem cells in other tumors [3–6].
|
) but lost the expression of Thy-1, SSEA-1, and Flk-1 expressed in BMMSCs at P1 (data not shown). Hematopoietic cell markers, CD45, TER119, CD18, CD19, CD3, c-kit, and CD34, were negative in BMMSCs at both P57 and P1. These findings indicated that the transformation process changed the expression pattern of surface markers in BMMSCs, but some markers expressed in BMMSCs at P1 were still maintained.
To further clarify the features of BMMSC at the single-cell level, single colony–derived BMMSCs were isolated and their immortalization and transformation potentials were assessed. We found that five out of 100 single colony–derived BMMSCs became immortalized. All of the immortalized clones maintained in vitro osteogenic differentiation potential and four out of five clones maintained in vitro adipogenic differentiation potential at early passages (Table 1). Four out of five of these clones were eventually transformed to generate fibrosarcoma after a subcutaneous inoculation (Table 1). One of them, clone C3, showed significant bone differentiation within the newly formed fibrosarcoma (Table 1). However, when transplanted with HA/TCP, two more clones (clone D2 and H8) also generated bone after they acquired tumor formation capacity (Table 1). These findings suggest that not only multicolony-derived BMMSCs, but also single colony–derived BMMSCs, become transformed and that some cells in transformed clones partially maintain their differentiation capability, probably depending on the environment and the cell stages.
|
), which may imply increased chromosome instability in murine BMMSCs. BMMSCs at P27 showed the gain of murine chromosome 2 (MMU2) in 40% of the cells (Fig. 3A; Table 2) and more than 10 double-minute chromosomes per cell involving MMU15 in 40% of the cells (Fig. 3A, yellow arrow), indicating the existence of clonal numerical and structural abnormalities. Chromosomal aneuploidy was also detected with non-clonal gains and losses of numerous chromosomes (Table 2). At P55, BMMSCs showed a greater number of double-minute chromosomes involving MMU15 in 90% of the analyzed cells (Fig. 3B, yellow arrow) and the clonal deletion of MMU14 (Fig. 3B; Table 2) with other numerical aberrations (Table 2). Chromosomal imbalances were more frequent at P55 compared with P27 (Table 2). These results suggested that accumulation of chromosomal abnormalities was a dynamic process during continuous passages, leading to the immortalization and transformation of BMMSCs. We further performed FISH analysis and identified that the double-minute chromosomes were due to an amplification of c-myc, an oncogene located on MMU15 (Fig. 3C). Western blot analysis confirmed the upregulation of c-Myc protein expression in BMMSCs at P14, P29, and P54 when compared with the expression at P1 (Fig. 3D). Next, we examined telomerase activity because c-myc has been reported to activate telomerase activity [28, 29]. The quantitative assay indicated that BMMSCs at P1 had little telomerase activity compared with the HEK293 cells used as a positive control, but after continuous passages, BMMSCs gradually gained increased telomerase activity (Fig. 3E). Non-transformed BMMSCs and transformed BMMSCs showed similar telomere lengths (Fig. 3F), suggesting that telomere length was maintained by telomerase activity during the immortalization and transformation process. These findings suggested that amplification of c-myc was, at least in part, involved in the transformation of BMMSCs through upregulated telomerase activity.
|
|
). The inhibitory curves of etoposide to BMMSCs at P1 and P63 were significantly separated (Fig. 4B), indicating that the therapeutic effect of etoposide may be achieved without causing a severe toxic effect on normal BMMSCs at a wide range of concentrations. In contrast, the inhibitory curves of doxorubicin to BMMSCs at P1 and P63 were very close. The mean EC50 values of doxorubicin to BMMSCs at P1 and P63 were 0.49 ± 0.18 µg/ml and 0.16 ± 0.05 µg/ml, respectively (Fig. 4C, 4D), suggesting that the toxicity was relatively significant because there was no separation between "toxicity curve" (the inhibitory effect on BMMSCs at P1) and "effective curve" (the inhibitory effect on BMMSCs at P63). These findings may correlate with the fact that doxo-rubicin has adverse side effects on patients, such as the damage to cardiac muscles and the suppression of bone marrow function. Taken together, this system suggests a unique model for in vitro screening to select drugs and determine appropriate dosages to target transformed stem cells without severe side effects on normal stem cells.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
It is important to point out that the immortalization and transformation processes seen in murine BMMSCs were not observed in human BMMSCs under our culture conditions. To evaluate the potential of human BMMSCs to become spontaneously immortalized, we used similar strategies to find that in vitro cell culture with continuous passages led human BMMSCs to senescence without any sign of immortalization (data not shown). Human BMMSCs at P17, which had almost reached senescence, showed a very slow growth rate and demonstrated normal chromosomes (46, XX) in 14 of 15 analyzed cells, with only one revealing two non-clonal structural aberrations, deletion of chromosome 9 and 10 (data not shown). Therefore, human BMMSCs at the very latest stage of their life span are still capable of maintaining fidelity of chromosomal segregation. We tested not only human BMMSCs but other human MSCs, including dental pulp stem cells [15] and periodontal ligament stem cells [16], and did not observe spontaneous immortalization (data not shown). Genome stability in human stem cells may be maintained with complicated mechanisms that keep human cells more stable than murine cells as previously reported [30]. In the present study, murine BMMSCs at P1 showed a high degree of chromosome instability, implying that murine stem cells are susceptible to chromosomal aberration under in vitro cultivation which may associate with the clonal chromosomal abnormality such as increased gene amplification of c-myc. Very recently, however, the spontaneous transformation of human adult stem cell was reported [9]. Although the mechanisms such as increased c-myc expression and telomerase activity may contribute to the spontaneous immortalization of human MSCs [9] and murine BMMSCs, we had difficulty immortalizing human MSCs using the same continuous passage strategy as we did on murine BMMSCs. Even telomerase-transfected human BMMSCs can’t be spontaneously immortalized under our experimental conditions [13]. The discrepancy between the reported finding and our observation in human BMMSCs may be due to the different experimental conditions or the origin of donors. If human BMMSCs can be spontaneously transformed to malignant cells, the clinical applications of BMMSCs for tissue engineering should be conducted very carefully and new therapeutic approaches will have to be developed to target transformed BMMSCs. Thus, understanding the mechanisms of how BMMSCs are transformed to malignant cells is critical for providing new insight into therapeutic strategies when human stem cells are applied for clinical therapies.
Spontaneous immortalization/malignant transformation in our system may mimic the process of tumorigenesis in human body. Also, the comparison of BMMSCs with transformed BMMSCs derived from their parental normal BMMSCs makes this system unique to compare the response to the drugs at different stages. We attempted to use this BMMSCs/fibrosar-coma transformation system to screen anti-cancer drugs for identifying a therapeutic index. The response of malignant cells and normal cells to drug treatment represents the effectiveness and the toxicity of the tested drug, respectively. After in vitro treatment, the EC50 of etoposide to normal BMMSCs at P1 was more than 170 folds higher than EC50 to transformed BMMSCs at P63, suggesting that etoposide has a wide therapeutic index. In contrast to etoposide, doxorubicin showed a very close EC50 between normal BMMSCs and transformed BMMSCs. These data suggest doxorubicin is more toxic than etoposide due to less specific effects on malignant cells. Indeed, this finding corresponds to the fact that doxorubicin causes worse side effects, such as the damage to cardiac muscles and the suppression of bone marrow function. It is suggested that, taken together, this system has the potential to provide a useful model for in vitro drug screening. This may help us to examine newly developed drugs and select more appropriate drugs and dosages while avoiding severe side effects.
In summary, we demonstrated that murine BMMSCs become spontaneously transformed with accumulated chromosomal abnormalities, including double-minute chromosomes, and form fibrosarcoma in vivo. Our BMMSCs/fibrosarcoma transformation system may be useful for drug screening as well as for further investigation of the mechanisms by which BMMSCs become transformed to establish stem cell–based therapies.
|
ACKNOWLEDGMENTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
DISCLOSURES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
This article has been cited by other articles:
|
|
 |
|
  M. Gjerstorff, J. S. Burns, O. Nielsen, M. Kassem, and H. Ditzel Epigenetic Modulation of Cancer-Germline Antigen Gene Expression in Tumorigenic Human Mesenchymal Stem Cells: Implications for Cancer Therapy Am. J. Pathol., July 1, 2009; 175(1): 314 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Snykers, J. De Kock, V. Rogiers, and T. Vanhaecke In Vitro Differentiation of Embryonic and Adult Stem Cells into Hepatocytes: State of the Art Stem Cells, March 1, 2009; 27(3): 577 - 605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Walker, S. K. Shah, M. T. Harting, and C. S. Cox Jr Progenitor cell therapies for traumatic brain injury: barriers and opportunities in translation Dis. Model. Mech., January 1, 2009; 2(1-2): 23 - 38. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Tasso, A. Augello, M. Carida', F. Postiglione, M. G. Tibiletti, B. Bernasconi, S. Astigiano, F. Fais, M. Truini, R. Cancedda, et al. Development of sarcomas in mice implanted with mesenchymal stem cells seeded onto bioscaffolds Carcinogenesis, January 1, 2009; 30(1): 150 - 157. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. B. Copland, E. M. Jolicoeur, M.-A. Gillis, J. Cuerquis, N. Eliopoulos, B. Annabi, A. Calderone, J.-F. Tanguay, A. Ducharme, and J. Galipeau Coupling erythropoietin secretion to mesenchymal stromal cells enhances their regenerative properties Cardiovasc Res, August 1, 2008; 79(3): 405 - 415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Pawelczyk and J. A. Frank Transferrin Receptor Expression in Iron Oxide-labeled Mesenchymal Stem Cells Radiology, June 1, 2008; 247(3): 913 - 914. [Full Text] [PDF]
|
|
|
|
|
|
G. Lazennec and C. Jorgensen Concise Review: Adult Multipotent Stromal Cells and Cancer: Risk or Benefit? Stem Cells, June 1, 2008; 26(6): 1387 - 1394. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Jones and D. McGonagle Human bone marrow mesenchymal stem cells in vivo Rheumatology, February 1, 2008; 47(2): 126 - 131. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Li, X. Fan, R. C. Kovi, Y. Jo, B. Moquin, R. Konz, C. Stoicov, E. Kurt-Jones, S. R. Grossman, S. Lyle, et al. Spontaneous Expression of Embryonic Factors and p53 Point Mutations in Aged Mesenchymal Stem Cells: A Model of Age-Related Tumorigenesis In Mice Cancer Res., November 15, 2007; 67(22): 10889 - 10898. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Nauta and W. E. Fibbe Immunomodulatory properties of mesenchymal stromal cells Blood, November 15, 2007; 110(10): 3499 - 3506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Bernardo, N. Zaffaroni, F. Novara, A. M. Cometa, M. A. Avanzini, A. Moretta, D. Montagna, R. Maccario, R. Villa, M. G. Daidone, et al. Human Bone Marrow Derived Mesenchymal Stem Cells Do Not Undergo Transformation after Long-term In vitro Culture and Do Not Exhibit Telomere Maintenance Mechanisms Cancer Res., October 1, 2007; 67(19): 9142 - 9149. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Locatelli, R. Maccario, and F. Frassoni Mesenchymal stromal cells, from indifferent spectators to principal actors. Are we going to witness a revolution in the scenario of allograft and immune-mediated disorders? Haematologica, July 1, 2007; 92(7): 872 - 877. [Full Text] [PDF]
|
|
|
|
|
|
S. Aguilar, E. Nye, J. Chan, M. Loebinger, B. Spencer-Dene, N. Fisk, G. Stamp, D. Bonnet, and S. M. Janes Murine but Not Human Mesenchymal Stem Cells Generate Osteosarcoma-Like Lesions in the Lung Stem Cells, June 1, 2007; 25(6): 1586 - 1594. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Inoue, S. Noda, N. Ogonuki, H. Miki, S. Inoue, K. Katayama, K. Mekada, H. Miyoshi, and A. Ogura Differential Developmental Ability of Embryos Cloned from Tissue-Specific Stem Cells Stem Cells, May 1, 2007; 25(5): 1279 - 1285. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. Katritsis, P. Sotiropoulou, E. Giazitzoglou, E. Karvouni, and M. Papamichail Electrophysiological effects of intracoronary transplantation of autologous mesenchymal and endothelial progenitor cells Europace, March 1, 2007; 9(3): 167 - 171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Chaichana, G. Zamora-Berridi, J. Camara-Quintana, and A. Quinones-Hinojosa Neurosphere Assays: Growth Factors and Hormone Differences in Tumor and Nontumor Studies Stem Cells, December 1, 2006; 24(12): 2851 - 2857. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. B. Doering, B. Gangadharan, and H. T. Spencer Marrow-Derived Stromal Cells as Gene Transfer Vehicles in a Murine Model of Hemophilia A. Blood (ASH Annual Meeting Abstracts), November 16, 2006; 108(11): 5489 - 5489. [Abstract] [PDF]
|
|
|
|
|
|
Y. F. Zhou, M. Bosch-Marce, H. Okuyama, B. Krishnamachary, H. Kimura, L. Zhang, D. L. Huso, and G. L. Semenza Spontaneous Transformation of Cultured Mouse Bone Marrow-Derived Stromal Cells. Cancer Res., November 15, 2006; 66(22): 10849 - 10854. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Wu, S. A. Estwick, S. Chen, M. Yu, W. Ming, T. D. Nebesio, Y. Li, J. Yuan, R. Kapur, D. Ingram, et al. Neurofibromin plays a critical role in modulating osteoblast differentiation of mesenchymal stem/progenitor cells Hum. Mol. Genet., October 1, 2006; 15(19): 2837 - 2845. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
