HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 2005-0598v1 24/4/876    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Yu, X. Articles by Civin, C. I. Search for Related Content PubMed PubMed Citation Articles by Yu, X. Articles by Civin, C. I.

STEM CELL GENETICS AND GENOMICS

HES1 Inhibits Cycling of Hematopoietic Progenitor Cells via DNA Binding

^a Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Department of Oncology, and
^b Stem Cell Program, Institute for Cell Engineering, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA;
^c Clinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, Washington, USA

Key Words. HES1 • Notch signaling pathway • Hematopoietic stem cells • Hematopoietic progenitor cells • Stem cell self-renewal • Cell cycle • bHLH

Correspondence: Curt I. Civin, M.D., The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Bunting-Blaustein Cancer Research Building, Room 2M44, 1650 Orleans Street, Baltimore, Maryland 21231, USA. Telephone: 410-955-8816; Fax: 410-955-8897; e-mail: civincu{at}jhmi.edu

Received November 29, 2005; accepted for publication February 24, 2006.

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Notch signaling is implicated in stem cell self-renewal, differentiation, and other developmental processes, and the Drosophila hairy and enhancer of split (HES) 1 basic helix-loop-helix protein is a major downstream effector in the Notch pathway. We found that HES1 was expressed at high levels in the hematopoietic stem cell (HSC)–enriched CD34⁺/[CD38/Lin]^{– /low} subpopulation but at low levels in more mature progenitor cell populations. When CD34⁺ cells were cultured for 1 week, the level of HES1 remained high in the CD34⁺ subset that had remained quiescent during ex vivo culture but was reduced in CD34⁺ cells that had divided. To investigate the effects of HES1 in human and mouse hematopoietic stem–progenitor cells (HSPCs), we constructed conditional lentiviral vectors (lentivectors) to introduce transgenes encoding either wild-type HES1 or a mutant lacking the DNA-binding domain (BHES1). We found that lentivector-mediated HES1 expression in CD34⁺ cells inhibited cell cycling in vitro and cell expansion in vivo, associated with upregulation of the cell cycle inhibitor p21^cip1/Waf1 (p21). The HES1 DNA–binding domain was required for these actions. HES1 did not induce programmed cell death or alter differentiation in HSPCs, and while short-term repopulating activity was reduced in HES1-transduced mouse and human cells, long-term reconstituting HSC function was preserved. Our data characterize the complex, cell context–dependent actions of HES1 as a major downstream Notch signaling regulator of HSPC function.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Evolutionally conserved Notch pathway signaling molecules have myriad effects in the proliferation, differentiation, and apoptosis of multiple stages and lineages of normal cells, as well as in the pathophysiologies of several diseases [1–8]. Binding of a Notch ligand to a Notch receptor results in cleavage and release of the intracellular domain of the Notch receptor (ICN) by a membrane-associated protease complex containing presenilin [1]. The ICN then translocates to the nucleus, where it complexes with CBF1/RBP-J [9, 10], mastermind-like (MAML) [11], and other modulators [12, 13]. The assembled multisubunit nuclear complex binds to the cognate DNA–binding sequence of CBF1 and regulates transcription of several Notch effector genes, including HES1 [14].

Although the role of Notch signaling molecules in lymphopoiesis is clear [15], the effects of Notch signaling in early mammalian hematopoiesis are controversial. For example, in one study using knockout mice, generation of hematopoietic stem cells (HSCs) was impaired by Notch1 (but not Notch2) deletion [16]. However, in a different study, conditional inactivation of Notch1 in adult mouse bone marrow (BM) cells reduced T-cell development but appeared to have no effect on hematopoietic stem–progenitor cells (HSPCs) [17]. Dissection of the actions of individual downstream targets of ICN should help to clarify the actions of Notch signaling in hematopoiesis.

Mammalian homologs of Drosophila hairy and enhancer of split (HES) are prominent targets of Notch signaling [18, 27]. HES1 is the founding member of the basic helix-loop-helix (bHLH) HES–molecule family. The functional domains of HES family members include a bHLH domain, an Orange domain (helix 3/4), and a WRPW motif at the C-terminus (Fig. 1) [19]. The bHLH domain mediates the formation of HES homodimers or heterodimers with other bHLH proteins [20–22]. HES1 homodimers bind with high affinity to N box (CACNAG) and with lower affinity to E box DNA elements located in the promoter region of target genes [23]. HES1 also binds Groucho/transducin-like enhancer of split (Gro/TLE)-family corepressors [24–26].

View larger version (13K): [in this window] [in a new window]   Figure 1. Endogenous HES1 expression was higher in quiescent than in proliferative CD34+ cells. Cord blood CD34+ cells were labeled with PKH26 membrane dye. A population of homogenously intensely fluorescent PKH26high/CD34+ cells was then fluorescence-activated cell sorted (FACS) and cultured ex vivo. On day 7, cells were FACS sorted to obtain cells that were still CD34+ and had undergone several cell divisions (CD34+ /PKHlow) and cells that were still CD34+ but had divided only 0–2 times (CD34+ /PKHhigh). Endogenous HES1 mRNA expression in the CD34+ /PKHhigh, CD34+ /PKHlow, and total CD34+ (control) cell populations was determined by quantitative RT-PCR. The relative level of HES1 in the PKHlow subset was normalized to 1.

To further investigate the role of HES1 in mouse and human hematopoiesis, we developed lentiviral vectors (lentivectors) that allow conditional activation of HES1 in vitro and in vivo after stable gene transfer into HSPCs. As mouse and human HES1 are highly conserved and functionally interchangeable, lentivectors expressing the human HES1 gene (and a mutated version lacking the DNA-binding domain that served as a control) were constructed and used to transduce human and mouse HSPCs. We found that functional HES1 transgene expression in mouse and human HSPCs inhibited cell proliferation in vitro and cell expansion in vivo. These effects were associated with upregulation of the cell cycle inhibitor p21^cip1/Waf1 (p21) and were dependent on intact HES1 DNA–binding activity. Neither programmed cell death nor differentiation of HSPCs was induced by HES1-transgene expression, and HSC activity was still present in HES1-transduced cells after secondary and tertiary transplantation in mice. Thus, DNA binding by conditionally expressed HES1 appears to selectively downregulate the proliferation of hematopoietic progenitor cells and short-term reconstituting HSPCs but not long-term reconstituting HSCs.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Primary Human Hematopoietic Cells
Normal human placental/umbilical cord blood (CB) CD34⁺ cells were purchased from AllCells (Berkeley, CA, http://www.allcells.com). Normal BM and granulocyte-colony stimulating factor (G-CSF)–mobilized peripheral blood stem cell (PBSC) CD34⁺ cells were provided by the Hematopoietic Cell Processing Core of the National Heart, Lung, and Blood Institute Program of Excellence in Gene Therapy at Fred Hutchison Cancer Center. CD34⁺ cells were purified by immunomagnetic selection (Miltenyi Biotech, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com) and were >90% CD34⁺ by fluorescence-activated cell sorting (FACS) reanalysis.

Dual-Promoter Lentivectors and Transduction
Wild-type (wt) HES1 cDNA was generated by polymerase chain reaction (PCR). To disrupt the basic DNA-binding domain of HES1, amino acids E43, K44, and R47 in the basic region of wtHES1 were mutated by polymerase chain reaction (PCR) to alanines to produce the BHES1 construct. Similar DNA-binding defective mutations have been described in rat [30] and mouse HES1 [31]. The identities of the wtHES1 and BHES1constructs were confirmed by DNA sequencing (Fig. 2A). To make inducible HES1 constructs (Fig. 2B), the wtHES1 and BHES1 cDNAs were each fused to a modified ligand–binding domain of the estrogen receptor (ER), which binds synthetic 4-hydroxytamoxifen (4HT) with higher affinity than natural estrogen [26]. wtHES1-ER and BHES1-ER cDNAs were then each cloned into dual promoter lentivectors [32], with the HES1 cDNA driven by the elongation factor one alpha (EF1) promoter and a green fluorescent protein (GFP) reporter driven by the ubiquitin C (Ubc) promoter [33]. Lentivector production and multiplicity of infection were assessed using transduction of 293T cells as described previously [32]; in a given experiment, all lentivectors were used at the same multiplicity of infection. The functionality of each HES1 lentivector was validated using a reporter plasmid containing the luciferase reporter gene linked to the portion of the HES1 promoter, known to be negatively regulated by HES1 [30] (a generous gift from Dr. Michael Caudy, Cornell University).

View larger version (30K): [in this window] [in a new window]   Figure 2. Characterization of lentiviral vectors expressing the HES1 transgene. (A): Schematic of the human wtHES1 and BHES1 constructs. The FLAG epitope tag sequence was attached to the N-terminal coding sequence in each construct. (B): Schematic of constructs in which wtHES1 or BHES1 human coding sequence was fused to the ligand-binding domain of a modified ER. Each of these HES1 constructs was cloned into a dual promoter lentivector, with the HES1 transgene driven by the EF1 promoter and the GFP reporter gene driven by the Ubc promoter. (C): Functional analysis of these HES1 transgene expression vectors. Each HES1 vector was cotransfected into 293T cells with a plasmid expressing a luciferase reporter, known to be responsive to transcriptional activation by HES1. After 2 days of culture in the presence (filled bars) or absence (empty bars) of 4HT (200 nM), transfected cells were harvested, and luciferase activity was measured and normalized (units of RLU), and plotted. (D): Efficient nuclear translocation of BHES1-ER fusion protein only in the presence of 4HT. Only successfully transfected 293T cells (expressing the reporter GFP gene; green) expressed the BHES1-ER fusion protein, as detected by a Mab recognizing the FLAG tag (red). The nuclei were counterstained with DAPI (blue). Abbreviations: BHES1, DNA-binding mutant HES1; 4HT, 4-hydroxytamoxifen; ER, estrogen receptor; HES, hairy and enhancer of split; RLU, relative luciferase activity; wtHES1, wild-type HES1.

Transduction of Human CD34⁺ HSPCs
Human CD34⁺ cells were cultured at 5–10 x 10⁵/ml in QBSF-60 serum-free medium (Quality Biologicals, Gaithersburg, MD, http://www.qualitybiological.com) containing FLT3 ligand (100 ng/ml), 20 ng/ml thrombopoietin, and 100 ng/ml KIT ligand (combination = FTK; all recombinant human cytokines from Peprotech, Rocky Hill, NJ, http://www.peprotech.com) and transduced with the lentivector on day 0 [32]. Mouse lineage–depleted (Lin^–) BM cells were cultured and transduced similarly, but in QBSF-58 (Quality Biologicals) serum-free medium containing recombinant mouse kit ligand (100 ng/ml), human FLT3 ligand (50 ng/ml) and human thrombopoietin (10 ng/ml). 48 hours after transduction, cells were either used directly or by FACS, based on GFP fluorescence using a FACS Vantage SE flow cytometer (BD, San Jose, CA, http://www.bd.com), for further studies.

Quantitative Real-Time-PCR Analysis
To determine levels of mRNA, quantitative real-time (RT)-PCR (qRT-PCR) analyses were carried out with the use of gene-specific primers and fluorescent labeled Taqman probes or SYBR green dye (Molecular Probes, Eugene, OR, http://www.probes.invitrogen.com) [32]. The human ß-actin primer and probe sequences were described previously [36]. Human HES1 primer and probe sequences were: Forward primer: 5' TG-GAAATGACAGTGAAGCACCT 3'; Reverse primer: 5' GT TCATGCACTCGCTGAAGC 3'; Probe: 5' FAM-CGCAGAT GACGGCTGCGCTG-TAMRA 3'. Human p21 primers were: Forward primer: 5' GCTGAAGGGTCCCCAGGT3'; Reverse primer: 5' GAAATCTGTCATGCTGGTCTGC3'.

Flow Cytometric Assays
PE-conjugated, PerCP-conjugated, and isotype-control mono-clonal antibodies (Mabs) against leukocyte differentiation antigens were purchased from BD. Annexin V/Viaprobe (BD) and propidium iodide (Sigma-Aldrich) analyses were done using FACS analysis as described previously [32, 37], with DNA content analysis performed using the Dean-Jett-Fox model and FlowJo software (Tree Star Inc., Ashland, OR, http://www.treestar.com).

For the analysis of HSPCs that had divided extensively versus less-proliferative HSPCs, freshly purified CB CD34⁺ cells were labeled with the red fluorescent membrane dye PKH26 (Sigma-Aldrich), and a band of uniformly PKH26-labeled CD34⁺ cells were sorted using a FACS Vantage SE cell sorter, as previously described [38]. The FACS-sorted PKH26^high/CD34⁺ cells were cultured ex vivo in QBSF-60 containing FTK for 7 days, and the cultured cells were FACS sorted based on the intensity of PKH26 fluorescence in individual cells, using the same fluorescence intensity bandwidth as the initially FACS-sorted PKH26⁺ cell band. This allowed us to isolate CD34⁺ cells that had divided several times (PKH^low/CD34⁺) and CD34⁺ cells that had not divided, or had divided only once or twice (PKH^high/CD34⁺: for which associated PKH26 fluorescence had not changed detectably between days 0–7) [38].

Bromo-Deoxyuridine Incorporation for Analysis of Cell Proliferation
Transduced FACS–sorted GFP⁺ CB CD34⁺ cells were allowed to recover during overnight culture in QBSF-60 medium containing FTK. These cells were then transferred into poly-D-lysine (BD) precoated 4-well slide chambers (Nalge Nunc International, Naperville, IL, http://www.nalgenunc.com), cultured for 2 hours, and labeled with 30 mM bromo-deoxyuridine (BrdU; Sigma-Aldrich) (15 minutes, room temperature). Cells were incubated with anti-BrdU Mab (Sigma-Aldrich), then Alexafluor 594-labeled secondary antimouse immunoglobulin antibody (Molecular Probes). After 5 minutes of DAPI staining (Molecular Probes), cells were counted and scored for BrdU staining.

Engraftment of Human HSPCs
Nonobese diabetic-severe combined immunodeficient (NOD-scid) mice, originally provided by Dr. L. Shultz (Jackson Laboratory, Bar Harbor, ME), were bred and housed in the animal facility at the Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins. Transduced HSPCs (4 x 10⁵ human cells per mouse) were injected intravenously (iv) into tail veins of sublethally irradiated (300 cGy) 6–8-week-old NOD-scid mice. Mice were sacrificed 4 weeks after transplantation and BM harvested and assessed for human cell engraftment as previously described [32].

Serial Mouse Transplantation and Analysis of Donor Cell Engraftment
Mice were obtained from the National Cancer Institute (Bethesda, MD) at 4–6 weeks of age. Donor BM cells from B6.SJL (CD45.1⁺) mice were harvested at 5–7 weeks of age, and HSPCs enriched by immunomagnetic depletion of cells expressing mature hematopoietic Lin antigens defined by a cocktail of Mabs: CD5 (Ly-1), CD11b (Mac-1), CD45R (B220), Gr-1, and TER119 (StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com). Cells were transduced with lentivectors on day 0 of ex vivo culture. On day 2, cells were transplanted iv into lethally irradiated (1,100 cGy) recipient C57BL6 (CD45.2⁺) mice. A small aliquot of cells was maintained in culture for 5 days to determine the transduction efficiency. Eight weeks post-transplantation, three of eight primary transplanted mice from each group were sacrificed and BM cells pooled. GFP⁺/CD45.1⁺ BM cells were obtained by FACS sorting and mixed with untransduced marrow cells (such that each secondary transplanted mouse received 0.5 x 10⁵ GFP⁺ cells from primary transplanted mice plus 4 x 10⁵ BM cells from normal untransplanted B6.SJL [CD45.1⁺] mice); this cell mixture was transplanted iv into lethally irradiated naive secondary recipient C57BL6 (CD45.2⁺) mice (five mice per group). Mice were bled every 2–3 weeks, and a percent of CD45.1⁺/GFP⁺ cells was measured by FACS. The above secondary competitive transplant experiment was repeated using three of the five remaining mice from each group at 9 weeks post-transplant. For tertiary competitive transplantation, BM cells were pooled from four mice at 8 weeks after secondary transplantation and GFP⁺ cells were obtained by FACS sorting. 10⁵ CD45.1⁺/GFP⁺ cells from each group of secondary transplants were mixed with 3 x 10⁵ untransduced B6.SJL (CD45.1⁺) cells and transplanted iv into each lethally irradiated naive C57BL6 (CD45.2⁺) recipient mouse (four mice per group).

Statistical Analysis
Data are expressed as mean ± standard error of the mean. Significance of differences was examined using the Student t-test. P values of less than .05 were considered to be significant. Statistical analysis was performed using GraphPad Prism version 4.0 (GraphPad Software, San Diego, CA, http://www.graphpad.com).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The HSC-Enriched Subset of the CD34⁺ Cell Subpopulation Expressed a Higher Level of HES1 mRNA Than Did More Mature Progenitor Cell–Enriched Subsets
Using qRT-PCR, we examined the level of HES1 expression in FACS-sorted cell populations within the human CD34⁺ HSPC population (Table 1). We found that HES1 expression in the HSC-enriched CD34⁺ /[CD38/Lin]^–/low population was more than fivefold higher than in the HSC-depleted, progenitor-enriched CD34⁺ /[CD38/Lin]^high subset, the mono/granulocytic progenitor–enriched CD34⁺ /[CD71/235A] ^–/low/[CD66/33/13]^high subset, or the unfractionated CD34⁺ population, and HES1 mRNA expression was extremely low in the erythroid progenitor–enriched CD34⁺ /[CD71/235A]^high/[CD66/33/13] ^–/low sub-population (Table 1).

Construction of Lentivectors Expressing HES1
We used dual promoter lentivectors [32] to coexpress a GFP reporter and either wtHES1 or BHES1 cDNA. The functionally defective BHES1 mutant cannot bind to the N or E box DNA sequence but can dimerize with bHLH proteins (Fig. 2A) [30, 31]. We also constructed inducible wtHES1-ER or BHES1-ER lentivectors (Fig. 2B). To test functional activity of these HES1 constructs, each plasmid was cotransfected into 293T cells with a plasmid containing luciferase, known to be negatively responsive to HES1 [30]. As predicted, the wtHES1 construct repressed reporter activity; the activity of the inducible (ER) construct was dependent on the presence of 4HT; and the BHES1 constructs had hardly any effect (Fig. 2C), despite the fact the protein from the BHES1 transgene (FLAG tagged) was produced and translocated into the nucleus (Fig. 2D).

Enforced HES1 Expression Inhibited Human BFU-E and CFU-G Colony Formation In Vitro
To determine the effects of enforced HES1 expression, human PBSC CD34⁺ cells were transduced overnight with wtHES1 or control lentivector. After 48 hours, successfully transduced (GFP⁺) cells were enriched by FACS sorting and plated in standard methylcellulose-containing colony-forming cell (CFC) assays, except that, to reduce the complexity of the types of colonies formed, cultures contained only KIT ligand plus either EPO, G-CSF, or M-CSF (Fig. 3A, 3B). As compared to cells transduced with the control lentivector containing only GFP, wtHES1-transduced cells generated only 30% the numbers of BFU-E colonies and 50% the numbers of CFU-G colonies, but similar numbers of CFU-M colonies. Transduction of the BHES1 mutant had no significant effects. We also analyzed the HES1 transcript levels in the transduced cells. The FACS-sorted wtHES1- or BHES1-transduced (GFP⁺) cells expressed approximately sevenfold higher levels of HES1, as compared to the endogenous level of HES1 measured in control-transduced (GFP only) cells (Fig. 3C; as confirmed by Western blotting, data not shown). Similar levels of HES1 expression were detected in cells transduced with conditional ER lentivectors (data not shown).

View larger version (41K): [in this window] [in a new window]   Figure 3. Enforced expression of wtHES1 inhibited erythroid and granulocytic colony formation. (A): Human PBSC CD34+ cells were transduced with wtHES1, BHES1, or control (GFP) lentiviral vectors (lentivector) for 2 days, then successfully transduced GFP+ cells were enriched by fluorescence-activated cell sorting (FACS) and plated in single lineage–CFC assays. In cultures containing KIT ligand (50 ng/ml) plus EPO (five IU/ml), the few nonerythroid colonies were ignored and only BFU-Es were enumerated. Similarly, in cultures containing KIT ligand (50 ng/ml) plus either G-CSF (100 ng/ml) or M-CSF (10 ng/ml), only granulocytic (composed of round, bright, small cells) or monocytic colonies (composed of large cells with oval to round shapes) were enumerated, respectively. Three independent experiments were performed, and a representative data set is shown. p values were determined by Student t test (n = 3). (B) Human CB CD34+ cells were transduced with wtHES1-ER, BHES1-ER, or parental control lentivector, and successfully transduced GFP+ cells were assayed for colony-forming cell assays as above, except in the presence or absence of 4-hydroxytamoxifen (200 nM). Colonies were scored as in (A). Three independent experiments were performed, and a representative data set is shown. p values were calculated via Student t test (n = 3). (C): The relative level of total HES1 gene expression was determined by quantitative RT-PCR in FACS-sorted GFP+ cells that had been transduced with wtHES1 or control lentivector (after normalization to ß-actin expression in those cells). (D): Enriched populations of either enriched mono/granulocytic progenitor cells (CD34+ /[CD71/235A]low/[CD66/33/13]high) were purified from peripheral blood stem cell CD34+ cells (as shown in Table 1), then transduced with either wtHES1 or control lentivector, and successfully transduced GFP+ cells were assayed for CFC-GM. *p < .05 for differences between groups (n = 6). (E): Enriched erythroid progenitor cells (CD34+ /[CD71/235A]high/[CD66/33/13]low) were transduced. Successfully transduced GFP+ cells were assayed for BFU-E. *p < .005 for differences between groups (n = 6). Colonies (D, E) were enumerated in two independent experiments. Abbreviations: BHES1, DNA-binding mutant HES1; 4HT, 4-hydroxytamoxifen; BFU-E, burst-forming unit erythroid; ER, estrogen receptor; GFP, green fluorescent protein; HES1, hairy and enhancer of split 1; wtHES1, wild-type HES1.

Enforced HES1 Expression Did Not Induce Apoptosis but Reduced Proliferation of HSPCs In Vitro
The effects observed above in CFCs suggested that HES1 might induce apoptosis and/or reduce proliferation of human hematopoietic progenitor cells. To determine whether enforced HES1 expression resulted in cell death in progenitor cells, CD34⁺ cells were transduced with wtHES1 or control lentivector as above, and transduced (GFP⁺) cells were examined on days 2–5 by FACS analysis for apoptosis. No differences in apoptosis/viability were observed in wtHES1 lentivector–transduced cells, as compared to controls (Fig. 4A). These results were further confirmed using the inducible lentivectors (data not shown).

View larger version (22K): [in this window] [in a new window]   Figure 4. Enforced HES1 expression inhibited cell proliferation of HSPCs in vitro. (A): After transduction with wtHES1 or control lentiviral vectors (lentivector), aliquots of transduced CB CD34+ cells were examined for viability daily on days 2–5. The percent of viable GFP+ transduced cells that lacked of binding by Annexin V on cell surface and of intracellular DNA by 7-amino-actinomycin D (7-AAD) was determined for the control (triangles) or the wtHES1-transduced (circles) group. Two independent experiments were performed. (B): Aliquots of the same transduced (GFP+) CD34+ cells were sorted and then plated in duplicate in 96 well plates (500 cells/well). Cells were enumerated using a digital camera microscopic image of each entire well. wtHES1 lentivector–transduced cells (solid line, filled circles) underwent reduced cell proliferation, compared to control vector–transduced cells (dotted line, empty circles). One representative of four independent experiments is shown. (C): Aliquots of the same transduced cells were cultured overnight in the presence of BrdU. Then cells were fixed, permeabilized, and stained with an anti-BrdU antibody. The percentages of BrdU+ cells were determined by quantifying eight microscopic fields documented by digital camera images. 1,000–2,000 total cells per group were counted. p < .001 for difference between wtHES1 and control. (D): CB CD34+ cells were transduced for 2 days with wtHES1-ER, BHES1-ER, or control lentivector. Fluorescence-activated cell sorted (FACS) GFP+ cells were plated in CFC assays in the presence or absence of 4HT. Numbers of colonies were counted after 14 days. Then cells in each dish were harvested, and total cell numbers were counted and divided by the total number of colonies per dish. The ratio in the control group was normalized at 1, and the ratios of the remaining groups, with (filled bars) or without (empty bars) 4HT, were plotted. These experiments were repeated three times using either CB or PBSC CD34+ cells, and the pooled results are plotted. p values for differences between groups. (E): 2 days after transduction of PBSC CD34+ cells, GFP+ cells were FACS sorted and used for quantitative RT-PCR for either p21 or ß-actin gene (as an internal control) and expressed and plotted as above. RNA samples from three independent transductions were used in this experiment. p values were calculated via nonparametric Mann-Whitney test, with 2-tailed p value. Abbreviations: BHES1, DNA-binding mutant HES1; 4HT, 4-hydroxytamoxifen; BrdU, bromo-deoxyuridine; HES1, hairy and enhancer of split 1; wtHES1, wild-type HES1.

We also measured the total numbers of cells per colony in CFC assays (Fig. 4D). In this set of experiments, CD34⁺ cells were transduced with wtHES1-ER or BHES1-ER–inducible lentivectors. Transduced (GFP⁺) cells were FACS sorted and then assayed in CFC assays in the presence or absence of 4HT. After colonies were counted, single-cell suspensions were made from each methylcellulose culture, and total cells were enumerated. The total number of colonies was reduced in the wtHES1-ER (but not the BHES1-ER)-transduced group, only in the presence of 4HT (not shown). Average total cell numbers per colony were also reduced by ~50% in the wtHES1-ER group. Thus, the reduction of cell proliferation was dependent on the HES1 DNA–binding domain.

p21 has been identified as a target gene downstream of HES1 and is well known to negatively regulate cell cycle progression and cell proliferation [30]. Enforced expression of wtHES1, but not BHES1, in CD34⁺ cells induced the level of p21 mRNA by fivefold (Fig. 4E).

Enforced HES1 Expression Reduced the Engraftment Capacity of Human or Mouse HSPCs
To evaluate effects in human HSPCs capable of in vivo hematopoietic reconstitution, CD34⁺ cells from CB were transduced with wtHES1, BHES1, or control (GFP only) lentivector as above, and transduction was assessed by GFP expression 48 hours later (transduction efficiencies were ~25% in all groups). On the same day, transduced cells (without FACS sorting) were transplanted into sublethally irradiated NOD-scid mice. Four weeks after transplantation, BM cells from transplanted or non-transplanted mice were isolated and analyzed by FACS for the presence of the transduced human (GFP⁺ /hCD45⁺) cells. The group transduced with the wtHES1 lentivector contained significantly lower numbers of GFP⁺ /hCD45⁺ cells, as compared to the BHES1 (Fig. 5A) or control (GFP) lentivector group (data not shown). This effect of HES1 on short-term engrafting HSCs complemented results of our in vitro experiments that largely measured hematopoietic progenitor/precursor cells.

View larger version (15K): [in this window] [in a new window]   Figure 5. Enforced expression of wtHES1 in human or mouse HSPCs reduced hematopoietic engraftment after primary transplantation. (A): Human cord blood CD34+ cells were transduced with wtHES1, BHES1, or the GFP control lentiviral vectors (lentivector). Then 4 x 105 cells/mouse were transplanted intravenously (iv) into sublethally irradiated NOD-scid mice. Four weeks after transplantation, mice were sacrificed and BM cells assayed by fluorescence-activated cell sorting (FACS) for cells coexpressing GFP and hCD45. Three independent experiments were performed, with five mice per group in each experiment. Empty bars indicate mean percent GFP+ cells on transplant day 0 (i.e., transduction efficiency 2 days after transduction), and filled bars indicate cells co-expressing GFP and hCD45 (percent GFP+ /hCD45+ cells) in NOD-scid mouse bone marrow 4 weeks post-transplant. The data from the control vector group are not shown but were similar to those with BHES1. p values were determined by Student t test. (B): Mouse Lin– BM cells from CD45.1+ mice were transduced with wtHES1, BHES1, or GFP control lentivector. Similar transduction efficiencies (~15%; week 0) were observed in each group. 5 x 105 treated (non-FACS sorted) cells were transplanted iv into each CD45.2+ recipient mouse (eight mice per group). Every 2–3 weeks, blood was obtained and the percent cells coexpressing mCD45.1 (donor-derived) and GFP (transduced) were determined by FACS. p < .005, statistically significant differences compared with control or BHES1 at each time points. (C): Mouse Lin– BM cells from CD45.1+ mice were transduced with wtHES1-ER or BHES1-ER lentivector and transplanted iv into CD45.2+ recipient mice (10 mice per group) as above. Starting 1 week post-transplant, half of the mice from each group were treated with 4HT plus tamoxifen (filled bars), half without (empty bars). Three weeks after the start of 4HT plus tamoxifen, the levels of blood cells co-expressing mCD45.1 and GFP were determined by fluorescence-activated cell sorting from each mouse transplanted with the wtHES1-ER–or BHES1-ER–transduced cells. p values were determined by Student t test. Abbreviations: BHES1, DNA-binding mutant HES1; ER, estrogen receptor; GFP, green fluorescent protein; HES1, hairy and enhancer of split 1; NS, not significant; wtHES1, wild-type HES1.

Similar experiments were repeated using mouse BM cells transduced with the wtHES1-ER or BHES1-ER inducible vector. Starting at 1 week post-transplant, half of the mice from each group were treated with 4HT plus tamoxifen to induce maximal ER fusion protein activation. Three weeks later, the levels of GFP⁺/mCD45.1⁺ cells in blood from each transplanted mouse in each group (n = 10) were determined as above. In mice receiving no induction, the levels of GFP⁺/mCD45.1⁺ cells in blood in the wtHES1-ER and BHES1-ER groups were similar. (This result correlated well with the observation of similar transduction efficiency in all groups prior to transplant.) However, the levels of GFP⁺/mCD45.1⁺ cells in the blood of the wtHES1-ER transduced group after transgene activation dropped from 30% to ~15%, while those in the BHES1-ER transduced group did not change significantly. Conditional activation of HES1 eliminated possible explanations, such as that the reduction in donor cell engraftment in the wtHES1-trandsduced group was due to a defect in homing. In addition, enforced HES1 expression did not alter differentiation in any lineage (data not shown). Thus, the reduction of short-term cell repopulation by HES1-transduced cells complemented the in vitro data indicating that enforced HES1 expression reduced the proliferation of hematopoietic progenitor/precursor cells.

HES1-Transduced HSPCs Generated Long-Term Hematopoiesis In Vivo in Secondary and Tertiary Transplants
To study whether enforced HES1 expression affects long-term engraftment capacity, we performed serial transplantations of FACS-sorted transduced cells using the mouse–mouse transplantation model. At 8 weeks post-transplant, BM cells were pooled from a group of primarily transplanted mice. GFP⁺/mCD45.1⁺ (i.e., transduced/donor-derived) cells were FACS sorted and mixed (1:8) with BM cells from naive (i.e., nontrans-planted) mCD45.1⁺ mice. The latter cell population was provided to help assure the survival of lethally irradiated CD45.2⁺ (secondary) recipient mice (Fig. 6A). In contrast to the results in the primary transplants (Fig. 5), the mice that underwent secondary transplants in the wtHES1-transduced group had higher levels of GFP⁺/mCD45.1⁺ blood cells over time than did the mice that underwent secondary transplants with the BHES1-or control-transduced group. To extend this observation, we performed tertiary competitive transplantations. At 8 weeks after secondary transplant, four mice from each group (Fig. 6A) were sacrificed, and pooled BM cells were FACS sorted to isolate GFP⁺/mCD45.1⁺ BM cells. These labeled donor cells from secondary recipients were mixed (1:3) with CD45.1⁺ naïve BM cells and transplanted into the naive tertiary CD45.2⁺ recipient mice. At 3 or 5 weeks after tertiary transplantation, GFP⁺/mCD45.1⁺cells were barely detectable in mice that had been tertiary transplanted with BHES1- or control lentivector–transduced cells (Fig. 6B, 6C). However, GFP⁺/mCD45.1⁺ cells were easily detected in the blood of each recipient mouse (n = 4) in the wtHES1-transduced group (Fig. 6B, 6C).

View larger version (36K): [in this window] [in a new window]   Figure 6. Enforced HES1 expression maintained levels of blood cells in serial competitive transplantation experiments. (A): 8 weeks post-transplantation, GFP+ BM cells pooled from three of eight primary transplanted mice from each group were mixed with untransduced BM cells from naïve CD45.1+ mice. This cell mixture was transplanted iv into secondary recipient CD45.2+ mice (five mice per group). Mice were bled every 2–3 weeks, and the percent GFP+/mCD45.1+ cells was measured by FACS. The above secondary competitive transplant experiment was repeated using three of five remaining mice from each group at 9 weeks post-transplant. p < .05 versus control or BHES1, at 3 weeks post-transplantation. (B): GFP+ bone marrow cells pooled from four mice 8 weeks post secondary transplantation were used for a tertiary competitive transplantation (four mice per group). The percent GFP+/mCD45.1+ cells in the blood of each mouse was measured by FACS. The data are presented as a column scatter plot (each dot for one mouse) with a line as the mean. p values were determined by Student t test. (C): Representative FACS dot plots of mouse blood cells for each of the three groups at 3 weeks after tertiary transplant. (D): The cell cycle status of aliquots of GFP+/mCD45.1+ cells used to initiate tertiary transplants was determined by propidium iodide staining for DNA. DNA content was computed using the Dean-Jett-Fox model and FlowJo software. Percent cells in the G0/G1 and S/G2/M phases are indicated. Abbreviations: BHES1, DNA-binding mutant HES1; GFP, green fluorescent protein; HES1, hairy and enhancer of split 1; NS, not significant; wtHES1, wild-type HES1.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
In this study we found that HES1, a major downstream target of the Notch signaling pathway, was preferentially expressed in the small (CD34⁺ /[CD38/Lin]^–/low) subset of human HSPCs that is enriched for primitive human HSCs. In contrast, average HES1 expression was low in subsets of CD34⁺ cells enriched in hematopoietic progenitor cells and known to be more actively cell cycling [39–41]. In addition, HES1 expression was high in the fraction of the human CD34⁺ cell subset that had remained quiescent during a 7-day ex vivo culture period but low in the CD34⁺ cell fraction that had divided extensively. Constitutive or inducible expression of HES1 reduced the proliferation of human and mouse progenitor/precursor cells, as assayed by in vitro assays. Enforced expression of HES1 in HSPCs appeared to reduce short-term donor cell reconstitution in vivo but did not reduce long-term engraftment capacity. We detected no significant effect of HES1 on apoptosis; instead, enforced HES1 expression reduced cell cycling both in vitro and in vivo. These inhibitory effects on cell proliferation were dependent on the presence of the HES1 DNA–binding domain.

Our observations are consistent with previous reports that HES1 inhibited erythropoiesis from in vitro cultured cells (by suppressing GATA-1) [42] and that overexpression of Notch1 or Notch4 inhibited mouse erythroid and myeloid colony formation [43, 44]. A recent paper reported that high levels of the Delta1 Notch ligand increased HES1 gene expression in CB CD34⁺ /CD38^– cells by more than fivefold and decreased generation of myeloid cells and NOD-scid repopulation [45]. Taken together, these results suggest that enforced expression of HES1 may be sufficient to phenocopy the inhibitory effect of upstream Notch signaling on HSPC proliferation, reminiscent of findings that HES1 overexpression may be sufficient to explain the ability of activated Notch1 to inhibit B-lymphoid cell proliferation [46].

The inhibitory effect of HES1 on human and mouse HSPC proliferation is not fully understood. As a bHLH protein, HES1 could block other essential bHLH proteins either by heterodimerization or by transcriptional regulatory effects. Indeed, DNA-binding–independent activities have been shown for several bHLH transcription factors [47]. For example, a mutant of the SCL/Tal-1 bHLH protein lacking DNA-binding capacity rescued primitive hematopoiesis in SCL^–/– mouse embryoid bodies and zebrafish [48], and the DNA-binding activity of SCL was not required to induce leukemia in mice [49]. furthermore, it has been hypothesized that dimerization of HES1 with other proteins, including SCL, might be important in hematopoiesis [28, 49]. Similarly, the inhibitor of differentiation subfamily of bHLH proteins lacking DNA-binding capacity can dimerize with and sequester various bHLH proteins and thereby block cell proliferation or differentiation. Our data do not support this protein–protein mechanism for the effects we observed with HES1, as transduction of the BHES1 mutant defective in DNA-binding function had no detectable effects in transduced HSPCs, in vitro or in vivo.

Enforced HES1 expression did not cause HSPC death, consistent with a previous report that blocking Notch signaling did not affect viability of nontransformed hematopoietic cells [50]. Instead, enforced HES1 expression inhibited cell cycling with G₁ arrest. The inhibition (but not complete block) of cell cycle progression by wtHES1, as assessed by both DNA content and BrdU incorporation assays, was DNA-binding domain-dependent. Cell progression through the G1 phase requires activation of cyclin-dependent kinase (CDK) 2, CDK4, and CDK6. The activity of CDKs can be inhibited by CDK inhibitors, such as members of the INK4 and Cip/Kip protein families; the latter include p21, p27, and p57 [51]. It has been shown previously that p21 holds HSCs in the G₀/G1 phase and that deficiency of p21 results in increased cycling of HSCs but not committed progenitor cells [52]. The upregulation of p21 in certain cell lines resulted in growth arrest and monocytic differentiation [53, 54]. An association of p21 with enhanced proliferation was also observed [55, 56]. Thus, the actions of p21 in committed myeloid progenitor cells are complex. Potential HES1 binding sites have been identified in the p21 and p27 promoter regions [30, 57], but the effect of HES1 on the regulation of different CDK inhibitors and cell proliferation appears to be dependent on cellular context [30, 57]. In this study, p21 was induced approximately fivefold in HES1-transduced human CD34⁺ cells, dependent on an intact DNA-binding domain (Fig. 4E). In vitro proliferation was reduced in erythroid and granulocytic but not monocytic progenitor cells that overexpressed HES1, possibly due to different cellular contexts (Fig. 3). In addition, enforced expression of HES1 appeared to inhibit in vivo proliferation of short-term hematopoietic reconstituting cells, but did not affect long-term reconstituting capacity. One possible interpretation is that enforced HES1 expression may enhance quiescence of HSCs. Since HSCs in p21^–/– mice (and Gli-1^–/– mice in which p21 is dramatically downregulated) have reduced quiescence and exhibit exaggerated exhaustion, especially on the stress of serial transplantation [52, 58], the elevated p21 levels that we observed accompanying enforced HES1 expression may enhance quiescence and reduce exhaustion of HSCs.

Our model regarding the role of HES1 is consistent with considerable published data examining the function of HES1 and Notch signaling in hematopoiesis. Taking our results together with several other reports, it appears that relatively high levels of cellular HES1 inhibit hematopoietic progenitor/precursor cell proliferation, with reductions in proliferation and CFC numbers in vitro and short-term hematopoietic reconstitution in vivo [28, 29, 43, 59]. On the other hand, high levels of HES1 may help preserve or maintain HSCs, resulting in increased long-term repopulating capacity, as shown here and in other reports [29, 43]. In contrast to some of these results, Shojaei et al. [60] recently reported that retroviral vector–transduced HES1 expression had little effect on hematopoietic CFCs assayed in vitro but enhanced short-term hematopoietic reconstitution in vivo.

The following differences between our studies and those of Shojaei et al. should be considered. First, we used recently developed lentivectors, while Shojaei et al. used retroviral vectors. Consequently, Shojaei had to use a 6-day culture and stimulation protocol, as only proliferating cells can be transduced by retroviral vectors; using lentivectors, our transductions could be completed in 48 hours and a higher proportion of the earlier, less-proliferative cells were effectively transduced. Second, transduction efficiencies in the Shojaei study were quite low: < 1% of cells still expressing CD34 and <4% of cells that had matured beyond the CD34⁺ stage; these transduced cells generated only 1%–2% GFP⁺ human cells in vivo in the control vector group and ~8% in the HES1-transduced group. In contrast, using HES1-expressing lentivectors, we obtained trans-duction efficiencies of at least ~25% GFP⁺ cells (nearly all CD34⁺) that generated ~25% GFP⁺ human cells in vivo. Third, the constitutive promoters of the EF1 and Ubc housekeeping genes were used in our lentivectors to allow constant transgene expression. In comparison, the retroviral vector used the viral LTR as the promoter, which is known to vary expression with cell cycle status and to be susceptible to gene expression silencing, especially in vivo [61–63]. In addition, data were not available to verify the HES1 activity transduced by Shojaei’s HES1 vectors in an independent functional assay, and they did not test whether the HES1 DNA–binding domain was required for the observed effects.

In summary, our data indicate that expression of this single downstream Notch pathway effector, HES1, was sufficient to mediate the reported inhibition by Notch signaling of hematopoietic progenitor cell proliferation in vitro and short-term hematopoietic reconstitution in vivo. However, there was no inhibitory effect of enforced HES1 expression on long-term reconstitution.

	ACKNOWLEDGMENTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
This research was supported in part by grants from the National Foundation for Cancer Research and NIH (CA070970 and HL072229 to C.I.C.; HL073781 to L.C.). We thank Dr. Vivek M. Tanavde for excellent technical advice and members of the Civin lab for helpful discussions.

	DISCLOSURES

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The Johns Hopkins University holds patents on CD34 monoclonal antibodies and related inventions. Dr. Civin is entitled to a share of the sales royalty received by the university under licensing agreements between the university, Becton, Dickinson and Company and Baxter HealthCare Corporation. The terms of these arrangements have been reviewed and approved by the University in accordance with its conflicts-of-interest policies.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Selkoe DJ. Notch and presenilins in vertebrates and invertebrates: implications for neuronal development and degeneration. Curr Opin Neurobiol 2000;10:50–57.[CrossRef][Medline]

2. Lewis J. Notch signalling and the control of cell fate choices in vertebrates. Semin Cell Dev Biol 1998;9:583–589.[CrossRef][Medline]

3. Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999;284:770–776.[Abstract/Free Full Text]

4. Ellisen LW, Bird J, West DC et al. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 1991;66:649–661.[CrossRef][Medline]

5. Gridley T. Notch signaling in vertebrate development and disease. Mol Cell Neurosci 1997;9:103–108.[Medline]

6. Joutel A, Corpechot C, Ducros A et al. Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature 1996;383:707–710.[CrossRef][Medline]

7. Lee JM, Lee KH, Weidner M et al. Epstein-Barr virus EBNA2 blocks Nur77- mediated apoptosis. Proc Natl Acad Sci U S A 2002;99:11878–11883.[Abstract/Free Full Text]

8. Miele L, Osborne B. Arbiter of differentiation and death: notch signaling meets apoptosis. J Cell Physiol 1999;181:393–409.[CrossRef][Medline]

9. Qi H, Rand MD, Wu X et al. Processing of the notch ligand delta by the metalloprotease Kuzbanian. Science 1999;283:91–94.[Abstract/Free Full Text]

10. Schroeter EH, Kisslinger JA, Kopan R. Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 1998; 393:382–386.[CrossRef][Medline]

11. Wu L, Aster JC, Blacklow SC et al. MAML1, a human homologue of Drosophila mastermind, is a transcriptional co-activator for NOTCH receptors. Nat Genet 2000;26:484–489.[CrossRef][Medline]

12. Cayouette M, Whitmore AV, Jeffery G et al. Asymmetric segregation of Numb in retinal development and the influence of the pigmented epithelium. J Neurosci 2001;21:5643–5651.[Abstract/Free Full Text]

13. Tsunematsu R, Nakayama K, Oike Y et al. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation during vascular development. J Biol Chem 2004;279:9417–9423.[Abstract/Free Full Text]

14. Zhou S, Hayward SD. Nuclear localization of CBF1 is regulated by interactions with the SMRT corepressor complex. Mol Cell Biol 2001; 21:6222–6232.[Abstract/Free Full Text]

15. Maillard I, Fang T, Pear WS. Regulation of lymphoid development, differentiation, and function by the Notch pathway. Annu Rev Immunol 2005;23:945–974.[CrossRef][Medline]

16. Kumano K, Chiba S, Kunisato A et al. Notch1 but not Notch2 is essential for generating hematopoietic stem cells from endothelial cells. Immunity 2003;18:699–711.[CrossRef][Medline]

17. Radtke F, Wilson A, Stark G et al. Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 1999;10:547–558.[CrossRef][Medline]

18. Kageyama R, Nakanishi S. Helix-loop-helix factors in growth and differentiation of the vertebrate nervous system. Curr Opin Genet Dev 1997;7:659–665.[CrossRef][Medline]

19. Davis RL, Turner DL. Vertebrate hairy and enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene 2001;20:8342–8357.[CrossRef][Medline]

20. Giagtzoglou N, Alifragis P, Koumbanakis KA et al. Two modes of recruitment of E(spl) repressors onto target genes. Development 2003; 130:259–270.[Abstract/Free Full Text]

21. Sasai Y, Kageyama R, Tagawa Y et al. Two mammalian helix-loop-helix factors structurally related to Drosophila hairy and enhancer of split. Genes Dev 1992;6:2620–2634.[Abstract/Free Full Text]

22. Alifragis P, Poortinga G, Parkhurst SM et al. A network of interacting transcriptional regulators involved in Drosophila neural fate specification revealed by the yeast two-hybrid system. Proc Natl Acad Sci U S A 1997;94:13099–13104.[Abstract/Free Full Text]

23. Chen H, Thiagalingam A, Chopra H et al. Conservation of the Drosophila lateral inhibition pathway in human lung cancer: a hairy-related protein (HES-1) directly represses achaetescute homolog-1 expression. Proc Natl Acad Sci U S A 1997;94:5355–5360.[Abstract/Free Full Text]

24. Paroush Z, Finley RL, Jr., Kidd T et al. Groucho is required for Drosophila neurogenesis, segmentation, and sex determination and interacts directly with hairy-related bHLH proteins. Cell 1994;79:805–815.[CrossRef][Medline]

25. Naar AM, Lemon BD, Tjian R. Transcriptional coactivator complexes. Annu Rev Biochem 2001;70:475–501.[CrossRef][Medline]

26. Littlewood TD, Hancock DC, Danielian PS et al. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res 1995;23:1686–1690.[Abstract/Free Full Text]

27. Tomita K, Hattori M, Nakamura E et al. The bHLH gene Hes1 is essential for expansion of early T cell precursors. Genes Dev 1999;13: 1203–1210.[Abstract/Free Full Text]

28. Kawamata S, Du C, Li K et al. Overexpression of the Notch target genes HES in vivo induces lymphoid and myeloid alterations. Oncogene 2002; 21:3855–3863.[CrossRef][Medline]

29. Kunisato A, Chiba S, Nakagami-Yamaguchi E et al. HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood 2003;101:1777–1783.[Abstract/Free Full Text]

30. Castella P, Sawai S, Nakao K et al. HES-1 repression of differentiation and proliferation in PC12 cells: role for the helix 3-helix 4 domain in transcription repression. Mol Cell Biol 2000;20:6170–6183.[Abstract/Free Full Text]

31. Furukawa T, Mukherjee S, Bao ZZ et al. rax, HES1, and notch1 promote the formation of Muller glia by postnatal retinal progenitor cells. Neuron 2000;26:383–394.[CrossRef][Medline]

32. Yu X, Zhan X, D’Costa J et al. Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells. Mol Ther 2003;7:827–838.[CrossRef][Medline]

33. Lois C, Hong EJ, Pease S et al. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science 2002; 295:868–872.[Abstract/Free Full Text]

34. Blyth K, Stewart M, Bell M et al. Sensitivity to myc-induced apoptosis is retained in spontaneous and transplanted lymphomas of CD2-mycER mice. Oncogene 2000;19:773–782.[CrossRef][Medline]

35. Pelengaris S, Khan M, Evan GI. Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell 2002;109:321–334.[CrossRef][Medline]

36. Yu X, Shacka JJ, Eells JB et al. Erythropoietin receptor signalling is required for normal brain development. Development 2002;129:505–516.[Medline]

37. Cao W, Britos-Bray M, Claxton DF et al. CBF beta-SMMHC, expressed in M4Eo AML, reduced CBF DNA-binding and inhibited the G1 to S cell cycle transition at the restriction point in myeloid and lymphoid cells. Oncogene 1997;15:1315–1327.[CrossRef][Medline]

38. Tanavde VM, Malehorn MT, Lumkul R et al. Human stem-progenitor cells from neonatal cord blood have greater hematopoietic expansion capacity than those from mobilized adult blood. Exp Hematol 2002;30: 816–823.[CrossRef][Medline]

39. Uchida N, He D, Friera AM et al. The unexpected G0/G1 cell cycle status of mobilized hematopoietic stem cells from peripheral blood. Blood 1997;89:465–472.[Abstract/Free Full Text]

40. Gothot A, Pyatt R, McMahel J et al. Functional heterogeneity of human CD34(+) cells isolated in subcompartments of the G0 /G1 phase of the cell cycle. Blood 1997;90:4384–4393.[Abstract/Free Full Text]

41. Srour EF, Tong X, Sung KW et al. Modulation of in vitro proliferation kinetics and primitive hematopoietic potential of individual human CD34+CD38-/lo cells in G0. Blood 2005;105:3109–3116.[Abstract/Free Full Text]

42. Ishiko E, Matsumura I, Ezoe S et al. Notch signals inhibit the development of erythroid/megakaryocytic cells by suppressing GATA-1 activity through the induction of HES1. J Biol Chem 2005;280:4929–4939.[Abstract/Free Full Text]

43. Stier S, Cheng T, Dombkowski D et al. Notch1 activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid lineage outcome. Blood 2002;99:2369–2378.[Abstract/Free Full Text]

44. Vercauteren SM, Sutherland HJ. Constitutively active Notch4 promotes early human hematopoietic progenitor cell maintenance while inhibiting differentiation and causes lymphoid abnormalities in vivo. Blood 2004; 104:2315–2322.[Abstract/Free Full Text]

45. Delaney C, Varnum-Finney B, Aoyama K et al. Dose-dependent effects of the Notch ligand Delta1 on ex vivo differentiation and in vivo marrow repopulating ability of cord blood cells. Blood 2005;106:2693–2699.[Abstract/Free Full Text]

46. Zweidler-McKay PA, He Y, Xu L et al. Notch signaling is a potent inducer of growth arrest and apoptosis in a wide range of B-cell malignancies. Blood 2005;106:3898–3906.[Abstract/Free Full Text]

47. Atchley WR, Fitch WM. A natural classification of the basic helix-loop-helix class of transcription factors. Proc Natl Acad Sci U S A 1997;94: 5172–5176.[Abstract/Free Full Text]

48. Porcher C, Liao EC, Fujiwara Y et al. Specification of hematopoietic and vascular development by the bHLH transcription factor SCL without direct DNA binding. Development 1999;126:4603–4615.[Abstract]

49. O’Neil J, Billa M, Oikemus S et al. The DNA binding activity of TAL-1 is not required to induce leukemia/lymphoma in mice. Oncogene 2001; 20:3897–3905.[CrossRef][Medline]

50. Duncan AW, Rattis FM, DiMascio LN et al. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 2005;6:314–322.[CrossRef][Medline]

51. Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev 1999;13:1501–1512.[Free Full Text]

52. Cheng T, Rodrigues N, Shen H et al. Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science 2000;287:1804–1808.[Abstract/Free Full Text]

53. Liu M, Lee MH, Cohen M et al. Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 leads to the induced differentiation of the myelomonocytic cell line U937. Genes Dev 1996;10:142–153.[Abstract/Free Full Text]

54. Zhang W, Grasso L, McClain CD et al. p53-independent induction of WAF1/CIP1 in human leukemia cells is correlated with growth arrest accompanying monocyte/macrophage differentiation. Cancer Res 1995; 55:668–674.[Abstract/Free Full Text]

55. Mantel C, Luo Z, Canfield J et al. Involvement of p21cip-1 and p27kip-1 in the molecular mechanisms of steel factor-induced proliferative synergy in vitro and of p21cip-1 in the maintenance of stem/progenitor cells in vivo. Blood 1996;88:3710–3719.[Abstract/Free Full Text]

56. Braun SE, Mantel C, Rosenthal M et al. A positive effect of p21cip1/waf1 in the colony formation from murine myeloid progenitor cells as assessed by retroviral-mediated gene transfer. Blood Cells Mol Dis 1998;24:138–148.[CrossRef][Medline]

57. Murata K, Hattori M, Hirai N et al. HES1 directly controls cell proliferation through the transcriptional repression of p27Kip1. Mol Cell Biol 2005;25:4262–4271.[Abstract/Free Full Text]

58. Hock H, Hamblen MJ, Rooke HM et al. Gfi-1 restricts proliferation and preserves functional integrity of haematopoietic stem cells. Nature 2004; 431:1002–1007.[CrossRef]