First published online April 27, 2006
Stem Cells
Vol. 24 No.
9
September 2006, pp.
2060
-2070
doi:10.1634/stemcells.2005-0311; www.StemCells.com
© 2006 AlphaMed Press
TISSUE-SPECIFIC STEM CELLS |
High Yield of Cells Committed to the Photoreceptor Fate from Expanded Mouse Retinal Stem Cells
Faten Merhi-Soussi,
Brigitte Angénieux,
Kriss Canola,
Corinne Kostic,
Meriem Tekaya,
Dana Hornfeld,
Yvan Arsenijevic
Unit of Gene Therapy and Stem Cell Biology, Jules Gonin Eye Hospital, Lausanne, Switzerland
Key Words. Radial glia • Neurogenesis • Neuron differentiation • Lentivirus • Müller cells
Correspondence: Yvan Arsenijevic, Ph.D., Unit of Gene Therapy and Stem Cell Biology, Jules Gonin Eye Hospital, 15 av. de France, 1004 Lausanne, Switzerland. Telephone: +41-21-626.82.60; Fax: +41-21-626.88.88; e-mail: yvan.arsenijevic{at}ophtal.vd.ch
Received July 12, 2005;
accepted for publication April 17, 2006.
First published online in STEM CELLS EXPRESS April 27, 2006.
 |
ABSTRACT
|
|---|
The purpose of the present work was to generate, from retinal stem cells (RSCs), a large number of cells committed toward the photoreceptor fate in order to provide an unlimited cell source for neurogenesis and transplantation studies. We expanded RSCs (at least 34 passages) sharing characteristics of radial glial cells and primed the cells in vitro with fibroblast growth factor (FGF)-2 for 5 days, after which cells were treated with the B27 supplement to induce cell differentiation and maturation. Upon differentiation, cells expressed cell type-specific markers corresponding to neurons and glia. We show by immunocytochemistry analysis that a subpopulation of differentiated cells was committed to the photoreceptor lineage given that these cells expressed the photoreceptor proteins recoverin, peripherin, and rhodopsin in a same ratio. Furthermore, cells infected during the differentiation procedure with a lentiviral vector expressing green fluorescent protein (GFP) under the control of either the rhodopsin promoter or the interphotoreceptor retinoid-binding protein (IRBP) promoter, expressed GFP. FGF-2 priming increased neuronal differentiation while decreasing glia generation. Reverse transcription-polymerase chain reaction analyses revealed that the differentiated cells expressed photoreceptor-specific genes such as Crx, rhodopsin, peripherin, IRBP, and phosphodiesterase-
. Quantification of the differentiated cells showed a robust differentiation into the photoreceptor lineage: Approximately 25%35% of the total cells harbored photoreceptor markers. The generation of a significant number of nondifferentiated RSCs as well as differentiated photoreceptors will enable researchers to determine via transplantation studies which cells are the most adequate to integrate a degenerating retina.
 |
INTRODUCTION
|
|---|
Retinal degenerative diseases, including retinitis pigmentosa (RP) [1] and age-related macular degeneration (AMD) [2], affect a significant percentage of the world population. The general effect of these diseases is photoreceptor death and consequently the loss of visual function. At this point in time, no effective vision-restoring treatments are available for patients with RP and AMD. One of the treatment strategies proposed for retinal degeneration is to use retinal stem cells (RSCs) to replace the type of cells that were lost, in the present case the photoreceptors.
The retina consists of one glia, the Müller cells, and six neuronal cell types that are generated from RSCs in a stereotyped order during development [3]. The retina also contains astrocytes, which are derived from progenitors located in the optic nerve [4]. In most mammals, including mice, the generation of the different classes of retinal cells can be roughly divided into an early phase (up to embryonic day 17 [E17]) and a late phase (from E18 to postnatal day 10 [PN10]) of retinal cell differentiation. Ganglion cells, horizontal cells, cone photoreceptor cells, and most amacrine cells are born during the early phase of retinal histogenesis, whereas most rod photoreceptors, bipolar cells, and Müller glia arise in the later phase [5].
Lineage-tracing studies of single retinal progenitor cells (RPCs) have shown that retinal cells arise from multipotent progenitors [6, 7]. Thus, if they can be expanded, RSCs and RPCs represent an interesting cell source for producing large amounts of photoreceptors in vitro. RSCs have been successfully isolated from embryonic, as well as adult, eyes in rodents and humans [811]. Different studies show that RSCs and RPCs have the capacity to generate photoreceptor-like cells in vitro [1013] or after transplantation [1113], but in all cases the number of photoreceptors generated is low and necessitates the identification of specific factors to enhance the photoreceptor yield. In a promising study with E17 rat retina, Qiu et al. [13] described a method for preparation and transplantation of RPCs (passage 2) which increases the percentage of cells showing features of photoreceptor differentiation after transplantation. However, the authors did not investigate whether the RPCs maintain the capacity to generate photoreceptors after several passages. In addition, no quantification of RPCs differentiated into retina-specific neurons expressing rhodopsin in vitro was reported.
Recently, Wu et al. [14] demonstrated that an in vitro priming procedure of fetal human neural stem cells (hNSCs), which involves culturing the cells on laminin in the presence of fibroblast growth factor (FGF)-2 and heparin, followed by differentiation with the B27 supplement (containing retinoic acid), induced the in vitro development of multiple subtypes of neurons. In vitro primed cells transplanted into adult rats engrafted rapidly and generated a nearly pure population of neurons. Large numbers of cholinergic neurons were produced from primed cells both in vitro and in vivo. Interestingly, the factors used in the priming and differentiation protocol detailed by Wu et al. [14], such as S-laminin [15], basic fibroblast growth factor [16], and retinoic acid [17, 18], are known to control the generation of rod photoreceptors. Sustaining the hypothesis that many factors may act synergically to direct rod development, we hypothesized that the application of the priming procedure described by Wu et al. [14] during cell differentiation of progeny derived from RSCs should induce photoreceptor appearance in vitro. The purpose of the study described herein was to generate a large number of photoreceptors with epigenetic factors. We show that after long-term expansion, RSCs (characterized as radial glial cells) maintain the capacity to generate a large percentage of retinal neurons (approximately 57%) including cells committed to the photoreceptor pathway (approximately 25%35% of the total cell population). Moreover, analysis of the differentiated cells by multiple approaches and parameters confirmed the acquisition of the photoreceptor fate. In this study, the high yield of photoreceptors in a controlled time and environment represents a promising tool for studying neurogenesis and screen photoreceptor-protective drugs as well as for providing an unlimited cell source for transplantation studies in animal models of retinal degeneration.
 |
MATERIALS AND METHODS
|
|---|
Isolation and Expansion of RSCs
RSCs were isolated from the neural retina of PN1 DBA/2J mice as previously described [19]. Briefly, the periphery of the retina and the optic nerve stalk were removed. The retina was dissected and digested for 20 minutes at 37°C in a solution containing 0.14 mg/ml kynurenic acid, 0.67 mg/ml hyaluronidase, as well as 1.33 mg/ml trypsin, and then mechanically triturated, and spun down. The pellet was resuspended in a basic medium that consisted of Dulbeccos modified Eagles medium/F-12, 5.5 mM HEPES, 0.66% glucose, 1 mM L-glutamine, 0.12% NaHCO3, 0.1 mg/ml transferrin, 0.025 mg/ml insulin, 9.6 µg/ml putrescin, 0.125 µg/ml progesterone, and 0.1 µg/ml selenium. All these products were purchased from Sigma Fluka Chemie AG (Buchs, Switzerland, http://www.sigmaaldrich.com). Three to five x 106 isolated cells were seeded in a 75-cm2 uncoated flask at a density of 2 x 106 cells per flask (Nalge Nunc, Naperville, IL, http://www.nalgenunc.com) in the basic medium supplemented with FGF-2 and epidermal growth factor (EGF) (both 20 ng/ml; Peprotech, Rocky Hill, NJ, http://www.peprotech.com) at 37°C in 8% CO2. This technique allows isolation and propagation of a homogeneous population of radial glial cells, as previously described [19]. Once every 57 days, adherent expanded cells were passaged by dissociation into single cells with trypsin-EDTA (Sigma Fluka Chemie AG) and plated in a new 75-cm2 uncoated flask at a density of 2 x 106 cells per flask. Differentiation experiments were performed using cells expanded up to passage 20, from four independent isolations of RSCs.
Priming and Differentiation
For priming, 8 x 104 to 1.2 x 105 cells per well (up to passage 32) were seeded in 24-well culture dishes on glass coverslips precoated with 0.015 mg/ml poly(L-ornithin) (Sigma Fluka Chemie AG) and 1.1 µg/cm2 laminin (Sigma Fluka Chemie AG) and cultured in the basic medium plus FGF-2 (20 ng/ml) and heparan sulfate (2 µg/ml) (Sigma Fluka Chemie AG) for 5 days. After 5 days of FGF-2 priming, cells were switched to basic medium plus B27 (1:50) (Invitrogen, Basel, Switzerland, http://www.invitrogen.com) alone during an additional 5 days to induce cell differentiation and maturation. Cells were split into three groups: one subjected to the FGF-2 priming step only, the second group subjected to the FGF-2 priming step followed by differentiation with B27, and for the third group, cells were plated in B27-supplemented medium for 5 days without FGF-2 priming. After incubation at 37°C in 5% CO2, cells were either fixed to be processed for immunocytochemistry analysis or harvested for RNA isolation.
Lentiviral Transduction of RSCs
During the differentiation procedure, cells were infected with a replication-defective, self-inactivating lentiviral vector encoding the green fluorescent protein (GFP) reporter gene under the control of the rhodopsin promoter (LV-Rhop-GFP), which is specific for photoreceptors in vivo, as previously described [20, 21]. The bovine interphotoreceptor retinoid-binding protein (IRBP) promoter (300 to +132) (a generous gift from Drs. D.J. Zack and Q.L. Wang, Baltimore) was also used and cloned in place of the human rhodopsin promoter in the pLOX-Rhop-GFP plasmid using MluI and SpeI restriction sites. High titer preparation was performed as described by Naldini et al. [22], and the p24 antigen titer was determined by enzyme-linked immunosorbent assay. After FGF-2 priming, 30 ng of p24 LV-Rhop-GFP or LV-IRBPp-GFP was used to infect cells in the basic medium containing B27 and cells were incubated for 5 days at 37°C, 5% CO2. The cells were then fixed to be processed for GFP immunocytochemistry analysis.
Immunocytochemistry
The cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. After fixing, the cells were washed with phosphate-buffered saline (PBS) and incubated overnight or 48 hours (Ret-P1) with the primary antibody (Table 1) at 4°C in PBS buffer containing 10% normal goat serum (Dako Denmark A/S, Glostrup, Denmark, http://www.dako.dk) and 0.3% Triton X-100 (Sigma Fluka Chemie AG). After rinsing, the cells were incubated with a Cy3- or fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse or goat anti-rabbit secondary antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, http://www.jacksonimmuno.com) for 1 hour at room temperature. All cells were counterstained by incubating with 4,6-diamidino-2-phenylindole (DAPI) (0.3 µM; Molecular Probes, Eugene, OR, http://probes.invitrogen.com) for 3 minutes at room temperature followed by washing steps. For syntaxin immunocytochemistry, a biotinylated secondary antibody followed by the diaminobenzidine (DAB) peroxidase substrate system (Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com) were used. For bromodeoxyuridine (BrdU) immunocytochemistry, cells were exposed to 500 nM BrdU overnight (Sigma Fluka Chemie AG). Next day, the cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. Incorporation of BrdU was detected using a monoclonal anti-BrdU antibody (GE Healthcare, Little Chalfont, Buckinghamshire, U.K., http://www.amershambiosciences.com) according to manufacturers instructions.
For quantitative analyses of labeled RSCs primed and/or differentiated in vitro, six monolayer fields were randomly chosen for each sample for each experiment. As a control, all antibodies labeled their cell-specific antigens in cryosections of the adult mouse retina. Control retina labeling of the Rho1D4 and the Ret-P1 antibodies are presented in supplemental online Fig. 1S.
Measurement of Cell Viability
Cell survival was assessed using the double-labeling fluorescence technique fluorescein diacetate (FDA)/propidium iodide (PI) from Sigma Fluka Chemie AG, as previously described [23]. The cultures were immersed in an FDA-PI mix (FDA 15 µg/ml and PI 15 µg/ml) diluted in the Locks solution for 5 minutes at 37°C. They were then rinsed with the Locks solution. After this procedure, viable cells emitted green fluorescence and nonviable cells emitted red fluorescence. The viability was determined as the percentage of viable cells from a total of 1,600 cells.
Reverse Transcription-Polymerase Chain Reaction
Total RNA was extracted from differentiated cells using the Trizol reagent according to the manufacturers instructions (Invitrogen). RNA pellets were washed with cold 75% ethanol, dried, reconstituted with sterile water, and quantified by spectrometry. The presence of equivalent concentrations of intact RNA from all samples was confirmed by electrophoresis in denaturating ethidium bromide-stained agarose gels. Identical amounts of RNA (1 µg) were reverse-transcribed using AMV-RT (Promega, Madison, WI, http://www.promega.com), random primers, and RNAsin ribonuclease inhibitor from Promega and dNTPs (GE Healthcare) in a total volume of 30 µl. Template cDNAs (5 µl) were then amplified in a typical 50-µl polymerase chain reaction (PCR) containing 2 ng/µl of the respective primers, 200 µM dNTP, and 2.5 units of Taq DNA polymerase (Invitrogen). The magnesium chloride concentration was 1.75 mM. The absence of DNA contamination in RNA preparations was tested by including RNA samples that had not been reverse-transcribed. Amplifications were carried out under the following conditions: denaturation for 5 minutes at 94°C, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing for 60 seconds at 57°C (for Crx, IRBP, peripherin, and rhodopsin) or 55°C (for phosphodiesterase-
[PDE-
]) or touch down 60°C-50°C (for Mash1), and extension at 72°C for 60 seconds, with a final extension at 72°C for 10 minutes. In the case of rhodopsin and PDE-
, it was necessary to perform a second PCR of 30 cycles on 2 µl of cDNA from the first PCR of B27-differentiated cells or of adult retina (for rhodopsin) to reveal the amplified sequence. PCR products were visualized by ethidium bromide/1.5% agarose gels. Sequences of gene-specific primers used in the PCRs were as follows:
- Crx (636 bp), 5'-TTCAAGAATCGTAGGGC/5'-TGAAACTTCCAGGCACTCTG
- IRBP (576 bp), 5'-CCTGACAGTAAGTCTGCCTC/5'-GTCCCAGGGAGCATTTTCTG
- Mash1 (266 bp), 5'-TTGAACTCTATGGCGGGTTC/5'-GGTTGGCTGTCTGGTTTGTT
- PDE-
(717 bp), 5'-CTCCATGGGTCCTCCATC/5'-CTGGATGCAACAGGACTT
- Peripherin (644 bp), 5'-CAGATACGGCGGCCTAGATT/5'CGTTGTTCCCACAGCACTTG
- Rhodopsin (490 bp), 5'-CTTTACCTAAGGGCCTCCAC/5'-GCAGCTTCTTGTGCTGTACG. All PCR products were sequenced.
Statistical Analysis
Values are presented as means ± SEM of several (n) independent experiments from two to four different culture preparations of RSCs. Data for nestin and BrdU labelings (three groups each) were compared by analysis of variance/Scheffe test, and data for ß-tubulin-III and glial fibrillary acidic protein (GFAP) stainings (two groups each) were compared by students t test. P values less than .05 were considered as statistically significant.
 |
RESULTS
|
|---|
Progressive Decrease of RSC Number During a Two-Step Procedure
We have previously isolated a homogeneous population of radial glial cells from PN1 mice retinas which proliferates on a long-term basis (34 passages) and contains cells behaving like RSCs [19]. RSCs proliferate, in uncoated flasks, when maintained in a serum-free defined culture medium supplemented with EGF and FGF-2. In our study, RSCs were passaged continuously in vitro for more than 1 year (at least 34 passages) without changing their proliferation patterns and expressed the intermediate neurofilament nestin, a marker for nondifferentiated cells (96% ± 1%) (Fig. 1A, 1C). In vivo nestin expression is localized in proliferating nondifferentiated central nervous system (CNS) cells, and the loss of nestin expression coincides with differentiation [24]. To prime the cells toward a neuronal fate, the expanded RSCs (up to passage 32) were plated onto poly(L-ornithin) and laminin-coated coverslips and treated with FGF-2 for 5 days. Such stimulation produced a massive proliferation with a dense cell concentration. Indeed, the combination consisting of FGF-2 and laminin has been described as a procedure having a priming effect on the generation of neurons from fetal hNSCs [14]. After FGF-2 priming, we treated cells with the B27 supplement alone for another 5 days to induce full cell differentiation and maturation. After 3 days, numerous cells died after the B27 stimulation, whereas the remaining cells underwent cell differentiation. The proportion of nestin-positive cells decreased by 46% upon the FGF-2 priming procedure (51% ± 5% nestin-positive, Fig. 1C; n = 5, p < .001) and by 60% after 5 days of further differentiation in medium containing B27 (39% ± 3% nestin-positive, Fig. 1C; n = 5, p < .01), suggesting that RSCs were engaged in a process of differentiation. To investigate the proliferative potential before or after FGF-2 priming and B27 stimulation of RSCs, the cells were incubated with the thymidine analogue BrdU during 24 hours, the first and the fourth days of FGF-2 priming, as well as the fourth day of B27 incubation. The proportion of BrdU-positive cells during the first day of FGF-2 priming, which represents the first day after plating onto poly(L-ornithin) and laminin-coated coverslips, was 46% ± 0.7% (Fig. 1D; n = 3). The percentage of BrdU-positive cells was significantly lower after 5 days of FGF-2 priming (33.7% ± 5.3% BrdU-positive, Fig. 1B, 1D; n = 3, p < .05) and decreased dramatically upon 5 days of B27 treatment (1.47% ± 0.69% BrdU-positive, Fig. 1D; n = 3, p < .001), showing that the B27 treatment leads to cell cycle exit.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1. Nestin expression and RSC proliferation during expansion, cell priming, and cell differentiation. (A): Immunocytochemistry for nestin on RSCs cultured in medium containing EGF and FGF-2. (B): Immunocytochemistry for BrdU after 5 days of FGF-2 priming. (C): Quantitative analysis of nestin-positive cells in EGF+FGF-2 after 5 days of FGF-2 priming (FGF-2 DIV#5) and after 5 days of FGF-2 priming followed by 5 days of B27 differentiation (B27 DIV#10) (n = 5 for all conditions). (D): Quantitative analysis of BrdU-positive cells, BrdU incubated during 24 hours of the first day of FGF-2 priming (FGF-2 DIV#1), the last 24 hours of the 5 days of FGF-2 priming (FGF-2 DIV#5), and the last 24 hours of the 5 days of FGF-2 priming plus 5 days of B27 differentiation (B27 DIV#10) (n = 3 for all conditions). The number of cells expressing nestin or BrdU decreased significantly after 5 days of FGF-2 priming and 5 days of B27 differentiation. Results are presented as mean ± SEM. *p < .05 as compared with the EGF+FGF-2 condition for nestin (C) and compared with the FGF-2 DIV#1 condition for BrdU (D); p < .05 as compared with the condition FGF-2 DIV#5 (C, D). Magnifications: x200 (A), x400 (B). Abbreviations: BrdU, bromodeoxyuridine; DIV, day in vitro; EGF, epidermal growth factor; FGF, fibroblast growth factor; RSC, retinal stem cell.
|
|
RSCs Differentiate into Retinal Neurons and Glial Cells
To further characterize the cells generated before and during this two-step procedure, we plated the expanded RSCs on poly(L-ornithin) and laminin-coated coverslips in the expansion medium and fixed them as soon as they adhered (after a few hours) in order to process the RSCs for immunocytochemistry. Our results showed that no markers of the differentiated state such as ß-tubulin-III, an early neuronal marker, or GFAP, a marker of glial cells, were observed before the FGF-2 priming (Table 2). We then characterized the cells after the priming procedure. After 5 days of FGF-2 priming, RSCs generated a large percentage of cells adopting the neuronal fate: 57.4% ± 6.9% of the cells expressed ß-tubulin-III (Table 2, n = 3). Note that the neuron-like cells expressing the ß-tubulin-III filament are very immature and that they present few or no neurites, suggesting that these cells are composed by neuroblasts and immature neurons (Fig. 2A, 2B). High cell density (8 x 104 to 1.2 x 105 cells/well) was necessary to obtain such a percentage of cells committed to the neuronal fate. After 5 days of FGF-2 stimulation, we observed only a low percentage of mature neurons with neuritis, as previously described [19]. At this stage, no cells expressed GFAP (Table 2). After the two-step procedure, FGF-2 priming and differentiation with B27, many cells presented a variety of neuronal as well as glial cell markers (Fig. 2). Multipolar neuron-like cells expressing ß-tubulin-III were observed (Fig. 2C2E and Table 2, 21.3% ± 4.4%, n = 11, three RSC culture preparations, passages 317); 13.5% ± 0.5% of the B27-differentiated cells expressing ß-tubulin-III also expressed nestin (data not shown). Some differentiated cells were also immunoreactive for GFAP (Fig. 2D, 2E and Table 2, 34% ± 2.5%, n = 4, two RSC culture preparations, passages 310); 39.2% ± 3.9% of the differentiated cells presenting a morphology of glial cells were also positive for glutamine synthetase, which is expressed in Müller cells (Fig. 2F and Table 2, n = 9, four RSC culture preparations, passages 319). The GFAP-expressing cells were likely Müller glia, because the percentage of GFAP expression is comparable with the percentage of glutamine synthetase-expressing cells. The nestin-positive cell population likely also represents GFAP-positive cells, which are known to express nestin [25]. Furthermore, a subpopulation of the FGF-2-primed and B27-differentiated cells expressed syntaxin (Fig. 2G and Table 2, 22.5% ± 2.9%, n = 4, two RSC culture preparations, passage 3 and passage 14), a marker of amacrine cells. For syntaxin immunocytochemistry, we used a biotinylated secondary antibody followed by the DAB peroxidase substrate which, in this case, gives a better sensitivity than immunofluorescence.

View larger version (91K):
[in this window]
[in a new window]
|
Figure 2. RSCs possess the potential to differentiate along neural and glial cell lineages after FGF-2 and B27 stimulations. (A): Numerous FGF-2-primed cells started to express the early neuronal marker ß-tubulin-III. Note that the cells expressing the ß-tubulin-III filament are very immature and that they present few or no neuritis. (B): Enlargement of ß-tubulin-III-stained cells marked by a white square in (A). A ß-tubulin-III-positive cell is indicated with an arrow and a ß-tubulin-III-negative cell with an arrowhead. (CG): After FGF-2 priming and differentiation with B27, cells differentiated along neural and glial lineages. (C): Exposure to B27 for 5 days sustained neuronal maturation, as revealed by the appearance of long neurites. (D): An illustration of ß-tubulin-III (arrows), Cy3 red signal, and GFAP (a marker of glial cells) (arrowhead), FITC green signal, double-labeled cells. (E): Phase-contrast image of (D) in which cells adopt a variety of neuronal (arrows) as well as glial (arrowhead) cell morphologies. (F): GS (Müller cells), Cy3 red signal; the nuclei of all cells are stained with DAPI (blue signal) in (AD, F). (G): Syntaxin-positive cells (arrows) (marker of amacrine cells) and -negative cells (arrowhead). Magnifications: x200 (A, D, E), x400 (C, F, G). Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; FGF, fibroblast growth factor; FITC, fluorescein isothiocyanate; GFAP, glial fibrillary acidic protein; GS, glutamine synthetase; RSC, retinal stem cell.
|
|
A direct incubation of the expanded RSCs in a medium containing the B27 supplement, without FGF-2 priming, had a significantly weaker effect on neuronal differentiation (6.1% ± 0.7% ß-tubulin-III-positive cells) and increased glia generation (69.9% ± 2.8% GFAP-positive cells) as compared with our standard two-step procedure (ß-tubulin-III-positive: 21.3% ± 4.4% and glial cells: 34% ± 2.5%, respectively) (Table 2). These results show that priming is necessary to obtain a large number of neurons and that B27 treatment induces retinal cell differentiation along the neural and glial lineages. In parallel experiments, we studied the potential contribution of laminin and heparan sulfate to the priming effect, independent of FGF-2. Laminin alone (in the absence of FGF-2 and heparan sulfate) had no effect: All the cells died within 48 to 72 hours (n = 3). Furthermore, cells plated on laminin in the medium plus heparan sulfate, in the absence of FGF-2, also died within 48 to 72 hours (n = 3). In the presence of FGF-2, 93.7% ± 1.54% (n = 3) of the cells were viable after 5 days of culture. Addition of the heparan sulfate proteoglycan could prevent FGF-2 degradation [26] but had no priming effect independent of FGF-2, in our conditions. These results demonstrate that, in our culture conditions, FGF-2 is the factor necessary to prime RSCs into a neuronal fate, prior to the B27 switch.
Expression of Photoreceptor Markers by the Primed and Differentiated Cells
We investigated the potential of the FGF-2-primed and B27-differentiated RSCs to express photoreceptor markers. After 5 days of FGF-2 priming followed by 5 days of B27 treatment, we observed numerous bright cells with a neuronal morphology (Fig. 3A). Immunocytochemistry revealed that these bright cells expressed recoverin (Fig. 3B), a soluble calcium-binding protein, usually located in photoreceptors and in few bipolar cells [27]. However, we did not detect any bipolar cells in the B27-differentiated cells, using the anti-protein kinase C antibody. Quantification of recoverin-positive cells showed that this cell population represents 30.7% ± 4.6% of the total cell population (n = 8, four RSC culture preparations, passages 320; Table 2). The DAPI staining showed that recoverin-expressing cells have a more condensed chromatin in comparison with the other cells (Fig. 3C). This is consistent with the in vivo analysis showing that the chromatin of photoreceptors (located in the outer nuclear layer) is more dense in comparison with all the other cells of the retina (Fig. 3D), as previously described [28, 29]. Furthermore, we also analyzed the expression of specific rod photoreceptor proteins such as peripherin-2 and rhodopsin. Peripherin-2 is a protein essential for rod outer segment morphogenesis and structure [30]. Rhodopsin is the major protein of rod outer segment that is required for the outer segment morphogenesis and plays a key role in the initiation of phototransduction [31]. The FGF-2-primed and B27-differentiated cells also expressed both peripherin-2 (Fig. 3E) and rhodopsin (Fig. 4A) as revealed by the use of the Rho1D4 antibody. The DAPI staining shows that peripherin-2- and rhodopsin-labeled cells possess a more condensed chromatin (Figs. 3F and 4B, respectively) in comparison with other cells. The peripherin-2- and rhodopsin-positive cells represent 30.9% ± 4% (n = 5, two RSC culture preparations, passage 3 and passage 14) and 34.8% ± 2.8% (n = 8, three RSC culture preparations, passages 320) of the total cell population, respectively (Table 2). No recoverin- or rhodopsin-positive cells were observed before FGF-2 priming or after 5 days of FGF-2 priming (Table 2). Furthermore, few cells positive for recoverin (3.2% ± 1.3%) or rhodopsin (3.7% ± 1.5%) (Table 2) were observed when the cells were cultured 5 days in the B27 supplement only, in the absence of the first priming step. The Rho1D4 antibody is specifically directed against the C-terminus of rhodopsin [32, 33]. We confirmed the expression of rhodopsin after the B27 stimulation using a second specific antibody against rhodopsin, the mouse anti-Ret-P1 antibody, which recognizes an epitope located at the N-terminus of the Rhodopsin molecule [34, 35] (supplemental online Fig. 2S). Double-immunolabeling against recoverin and rhodopsin (Ret-P1 antibody) revealed that 99% of the rhodopsin-expressing cells were also positive for recoverin and that 100% of the recoverin-positive cells expressed rhodopsin (318 cells analyzed at passage five and 32; supplemental online Fig. 2S).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 3. RSC-derived cells expressed photoreceptor markers after FGF-2 priming and B27-stimulation. After a first step of FGF-2 priming of 5 days, cells were incubated with the B27 supplement for another 5 days. (A): Phase-contrast after FGF-2 and B27 stimulations. Note the numerous bright cells with a neuronal morphology (arrows). (B): Numerous bright cells of (A) are positive for recoverin (red labeling), a marker for photoreceptors and rare bipolar cells. (C): DAPI staining of nuclei of (B) showing that recoverin-expressing cells have a more condensed chromatin (arrows) in comparison with the other cells (arrowhead). (D): The chromatin of the photoreceptors located in the ONL is more dense in comparison with all the other cells of the retina (PN12). This difference also remains during adulthood. (E): Peripherin staining (green labeling) and (F) DAPI staining of the cells in (E). Magnifications: x400 (AC, E, F), x200 (D). Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; FGF, fibroblast growth factor; GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer (photoreceptor layers); PN, postnatal day.
|
|

View larger version (57K):
[in this window]
[in a new window]
|
Figure 4. RSCs possess the potential to differentiate along the photoreceptor lineage. (A): After FGF-2 priming and B27 stimulation, the differentiated cells expressed rhodopsin (arrows), an essential protein for phototransduction in photoreceptors. Some apoptotic cells (arrowhead) showed non-specific staining. These cells were not taken into account for the cell count. (B): DAPI staining of the nuclei of (A) showing that rhodopsin-expressing cells have a more condensed chromatin (arrows) in comparison with the other cells. Apoptotic cells (arrowhead) were not taken into account for the total cell count. (C, D): Primary cultures of PN1 retinal cells in FGF-2 and B27 showed that photoreceptors also have long neurites in these conditions, as revealed by rhodopsin labeling (C) and phase-contrast (D). (E, F): Cells were infected with a lentivirus expressing GFP under the control of the rhodopsin promoter ( -GFP) (E) or under the control of the IRBP promoter (IRBP-GFP) (F) during the procedure of differentiation with the B27 supplement. GFP-positive cells are green. (G): Phase-contrast of (E). (H): Phase-contrast of (F). Magnification: x400. For quantification, see Table 2. Abbreviations: DAPI, 4,6-diamidino-2-phenylindole; FGF, fibroblast growth factor; GFP, green fluorescent protein; IRBP, interphotoreceptor retinoid-binding protein; PN, postnatal day; Rho, rhodopsin.
|
|
These results demonstrate that the two-step procedure, FGF-2 priming and B27 treatment, is necessary for obtaining a large number of cells committed to the photoreceptor fate.
In addition, we analyzed the expression of rhodopsin (using the Rho1D4 antibody) on primary cultures of photoreceptors and the morphology of these cells following the two-step procedure. PN1 primary retinal cells harbored a neuronal morphology in culture (Fig. 4D), and numerous cells were positive for the Rho1D4 antibody against rhodopsin (Fig. 4C). In our culture conditions, these photoreceptors also present neurites rather than being round as previously reported in studies using other media.
To analyze the activation of the rhodopsin promoter in the differentiated cells derived from the expanded RSCs, we plated 8 x 105 cells onto poly(L-ornithin) and laminin and primed these cells with FGF-2 during 5 days. Then, the cells were infected with a lentivirus expressing GFP under the control of the rhodopsin promoter (LV-Rhop-GFP) and exposed to B27 for five additional days. Immunocytochemistry using an antibody against GFP showed that 25.5% ± 4.3% (Table 2, n = 3) of the total cells were GFP-positive (Fig. 4E), showing an activation of the rhodopsin promoter by these cells. The GFP-positive cells harbored a neuronal morphology (Fig. 4G). Similarly, 29.95% ± 3.34% (Table 2; Fig. 4F, 4H) of the differentiated cells infected with a lentiviral vector expressing GFP under the control of the IRBP promoter (LV-IRBPp-GFP) expressed GFP. IRBP is a gene encoding for a protein expressed early during rodent retinal development [36] which binds retinoids in the interphotoreceptor matrix [37].
Detection of Transcripts Specific for Photoreceptors in Primed and Differentiated Cells
We analyzed the ability of the differentiated RSCs to express regulatory genes that have been shown to be expressed in photoreceptors. As expected, we observed by reverse transcription-PCR (Fig. 5) that FGF-2 priming and B27 differentiation of RSCs resulted in the expression of peripherin-2, rhodopsin, and IRBP, as shown above by immunocytochemistry or lentiviral vector reporter activity. In the case of rhodopsin, it was necessary to perform a second PCR on cDNA of B27-differentiated cells to reveal the amplified product. A second PCR was also necessary to detect the amplified product for the positive control which represents the RNA extracted from adult retina, suggesting that we lack optimal conditions to amplify rhodopsin, which explains the discrepancy in immunocytochemistry results that show 34.8% ± 2.8% of differentiated rhodopsin-positive cells. In addition, we detected the expression of PDE-
, a gene encoding for components of the phototransduction pathway [38]. A second PCR on cDNA of B27-differentiated cells was also necessary to detect PDE-
, whereas one PCR was performed on cDNA from adult retina, suggesting that the PDE-
gene was weakly expressed in the differentiated cells. Furthermore, we detected the expression of Crx, a homeobox gene expressed in both rods and cones and required for the expression of a variety of photoreceptor-specific genes [39, 40]. We also observed expression of Mash1, a basic helix-loop-helix (bHLH) gene that promotes neuronal differentiation and is associated with photoreceptor gene expression [41]. It was also shown that Mash1 is expressed in RSCs [42] as well as radial glia [43]. In agreement with these reports, we reported that Mash1 is also expressed in the expanded RSCs [19]. All these results corroborate the immunocytochemical observations that the FGF-2-primed and B27-differentiated RSCs acquire a photoreceptor phenotype.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5. RT-PCR of FGF-2-primed and B27-differentiated RSCs revealed genes expressed in photoreceptors. Cells differentiated in the B27 supplement after an FGF-2 priming step were harvested to undergo RT-PCR analysis. This figure is representative of three independent experiments showing the same results. After RT, the cDNA of the differentiated cells (RT+), the original RNA extract (negative control RT), and the cDNA of adult retina as a positive control (C+) were amplified with specific primers. Differentiated cells expressed specific photoreceptor genes such as Crx, Mash1, rhodopsin, peripherin, IRBP, and PDE- . In the case of rhodopsin and PDE- , it was necessary to perform a second PCR on cDNA of B27-differentiated cells and cDNA of adult retina (for rhodopsin) to reveal the amplified sequence. Abbreviations: C+, positive control; FGF, fibroblast growth factor; IRBP, interphotoreceptor retinoid-binding protein; PDE, phosphodiesterase; RSC, retinal stem cell; RT, reverse transcription; RT-PCR, reverse transcription-polymerase chain reaction.
|
|
 |
DISCUSSION
|
|---|
Herein, we describe specific conditions for the differentiation of expanded RSCs that produce a large number of cells committed to the photoreceptor fate as attested by the numerous photoreceptor markers expressed during the course of neuronal differentiation. This protocol offers an easy way to study photoreceptor neurogenesis and to provide a large source of retinal cells for transplantation studies.
We have previously shown that the culture of radial glial cells derived from newborn mice contains a significant number of adherent RSCs able to expand up to 34 passages (1046 cells generated from one eye) without changing their proliferation rate and potential [19]. The present study reveals that even after sustained expansion, postnatal RSCs maintain their potential to generate a large number of retinal neurons, a behavior not observed with RPCs derived from the E18 rat retina [44]. Similarly, Conti et al. [45] showed that long-term expanded neural stem cells, derived from the radial glia and also stimulated by FGF-2 and EGF, remain able to differentiate efficiently into neurons and astrocytes in vitro and upon transplantation into the adult brain.
The induction of the cell fate of RSCs is controlled by not only intrinsic but also extrinsic signals arising from the microenvironment [46]. Indeed, several molecules, including S-laminin [15], FGF-2 [16], taurine [3, 18, 47], activin A [48], retinoic acid [17], or sonic hedgehog [49], have been previously identified in vitro to influence rod development. These studies uncovered epigenetic factors that influence the differentiation of RPCs, isolated directly either at E1718 or P0, into photoreceptors. We investigated whether expanded RSCs conserved the responsiveness to some of these factors to undergo photoreceptor commitment and differentiation. Wu et al. [14] reported a priming procedure to treat fetal hNSCs in vitro before further differentiation and transplantation in vivo. This procedure allowed them to obtain cholinergic neurons in vitro, as well as a nearly pure population of neurons in vivo, from long-term mitogen-expanded fetal hNSCs. In the present study, we investigated whether the priming and differentiation protocol described by Wu et al. [14], who report factors known to be implicated in photoreceptor differentiation, would work on RSCs to induce the formation of photoreceptors in vitro. We showed that the FGF-2 and laminin cocktail in a first priming step allows a large number of RSCs committed to the neuronal lineage to be obtained (approximately 57%). Such an amount depended on the cell density used at plating, allowing a generation of neuronal cells higher than previously reported [19]. No cells expressed recoverin or rhodopsin at this stage. After a second step of differentiation with B27, we found a robust differentiation of RSCs, up to at least passage 20, into the amacrine cell phenotype (approximately 23%) and into the photoreceptor lineage; in each passage tested, approximately 25%35% of the total cells expressed several photoreceptor markers. The different factors used in the two-step protocol testedFGF-2, retinoic acid, and thyroid hormoneare known to promote rod differentiation; the latter two are contained in the B27 supplement. Kelley et al. [17] showed that the addition of exogenous retinoic acid in E18 rat retinal cultures caused a dose-dependent, specific increase in the number of cells that developed as photoreceptors. Hicks and Courtois [16] demonstrated that addition of exogenous FGF-2 to dissociated P0 rat retinal cells grown as monolayers caused a sixfold increase in the number of cells that express rhodopsin. The authors suggest that FGF-2 is a differentiation factor for immature rods. Zhao and Barnstable [50], however, in an earlier developmental stage, reported that in explants of E16 rat retina, exogenous FGF-2 did not have an effect on rhodopsin expression. In our study, we also did not observe expression of photoreceptor markers such as recoverin and rhodopsin after 5 days of FGF-2 stimulation of expanded RSCs, suggesting that our culture conditions maintain a large number of cells in a primitive stage. Our results show that FGF-2 priming induces neuronal commitment and that the B27 supplement directs subpopulations of these neurons toward a photoreceptor and an amacrine cell fate. All these results suggest that FGF-2 has a different action depending on the cell identity.
FGF-2 priming and B27 differentiation also generated a moderate percentage of glial cells (39%) and a high percentage of retinal neurons (57%, including cells committed to the photoreceptor and amacrine cell phenotypes) in comparison with other methods generally used to induce cell differentiation. We showed that direct plating of mitogen-expanded RSCs onto laminin-coated coverslips and incubation with B27, without FGF-2 priming, generated a large number of glial cells (69%) and few neurons (6%), showing that the FGF-2 priming procedure is necessary to generate numerous neurons (57%). Our results correlate with those of Wu et al. [14], which show that priming with FGF-2, heparin, and laminin was necessary to obtain a specific CNS neuron phenotype from fetal hNSCs in vitro. Interestingly, FGF-2 was shown to stimulate the proliferation of bipotent CNS precursor cells generating neurons and glia [51] and neuroblasts [51, 52]. In a previous clonal analysis study, we showed that after a two-step protocol (FGF-2 for 5 days and B27 supplement for additional 5 days), 45.3% of the clones contained only neurons, 15.5% only glial cells, and 39.2% were composed of neurons and glia [19]. These data and our present results suggest that FGF-2 had stimulated neuroblast and bipotent precursor proliferation, thus enhancing the yield of neurons.
Our results showed that even after extensive amplification, B27-differentiated RSCs primed with FGF-2 expressed photoreceptor regulatory genes such as the homeobox gene Crx and the bHLH gene Mash1. Crx and Mash1 have been described as being important for photoreceptor development [39, 40, 53, 54], which suggests that B27-differentiated cells recruit mechanisms involved during photoreceptor development in the retina. Hatakeyama and Kageyama [55] proposed that bHLH and homeodomain genes cooperatively interact to specify the neuronal subtype. In our conditions of differentiation, it is likely that co-expression of Crx and Mash1 is involved in photoreceptor development. Differentiated cells also expressed the IRBP gene, encoding for a protein expressed early during rodent retinal development [36]. IRBP is one of the main soluble components of the interphotoreceptor matrix, playing a role in the retinal development and in the retinoid cycle (reviewed in [37]). The B27-differentiated cells also expressed phototransduction genes such as PDE-
[38], as well as rhodopsin [31], and a gene that is needed to maintain the structural integrity of photoreceptors, peripherin-2 [30]; the presence of the two latter were also confirmed at the protein level. In addition, differentiated cells expressed the recoverin protein controlling Ca2+ trafficking. These observations show that the differentiated cells initiate and undergo a robust program of photoreceptor differentiation at multiple gene levels. However, we did not detect any expression of the phototransduction gene PDE-ß, and the level of expression of PDE-
was weak; we performed two PCRs reaching a total of 60 cycles of amplification to detect this product, indicating that our differentiation conditions can be improved in order to obtain fully differentiated photoreceptors. Moreover, further experiments are necessary to determine whether the photoreceptor cells derived from RSCs can become functional.
As mentioned above, the B27-differentiated cells also expressed rhodopsin, a phototransduction gene. Several studies have indicated that Crx is responsible for controlling the expression of photoreceptor genes, including rhodopsin and Crx itself [39, 40, 5658]. Misexpression of Crx [59, 60] and Otx2 [60] induces the generation of photoreceptor phenotypes from iris- and ciliary-derived cells, which is very promising for future transplantation studies. However, the level of opsin in a cell may be a problem because the overexpression of the normal opsin level by only approximately 23% leads to photoreceptor death [61]. Given that Crx controls opsin expression, it is important to evaluate and control such expression to optimize the photoreceptor survival after transplantation. This work and our study open the question of which cells are the most adequate for integrating a degenerating retina and for leading to photoreceptor survival: stem cells, or cells already differentiated into photoreceptors expressing normal levels of opsin, or overexpressing opsin. In our culture conditions, differentiated cells expressed mature photoreceptor markers and displayed neuronal morphologies. However, these cells did not show mature photoreceptor morphology with outer segments. Nevertheless, Coles et al. [11] reported that in vitro human RSCs produce photoreceptors with only a round morphology, whereas after transplantation, RSCs generate cells with photoreceptor morphology and markers.
 |
CONCLUSION
|
|---|
Previous studies of transplantation of progenitor cells into animal models of retinal degeneration have shown photoreceptor differentiation of grafted cells but limited levels of graft-host integration [12, 42, 62]. Interestingly, Qiu et al. [13] observed that a high number of grafted rat E17 RPCs differentiated into photoreceptors in vivo. However, these cells underwent only two passages before transplantation and the authors did not investigate whether such results could be obtained after several passages. Here, we generate a large number of expanded RSCs and differentiated cells committed to the photoreceptor phenotype in a repetitive and reliable manner. In the future, these cells will enable us to answer the question of whether the cells most adequate to integrate a degenerating retina are RSCs or cells already differentiated into photoreceptors. The availability of such cells can serve for understanding mechanisms that regulate the specification of retinal neurons and also provide an unlimited cell source for studying cell replacement for degenerative diseases of the retina.
 |
DISCLOSURES
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
We thank R.D.G. McKay for the generous gift of the anti-nestin antibody, Gabriel H. Travis and Walid N. Moghrabi for the anti-peripherin antibody, Jean Bennett for the rhodopsin promoter, Donald Zack and Q.L. Wang for the IRBP promoter, D. Hornfeld for editing help, and A. Bemelmans for scientific discussions. This work was supported by the Swiss National Science Foundation, the ProVisu Foundation, the Velux Foundation, and the French Association Against Myopathies.
 |
REFERENCES
|
|---|
- Hims MM, Diager SP, Inglehearn CF. Retinitis pigmentosa: Genes, proteins and prospects. Dev Ophthalmol 2003;37:109125.[CrossRef][Medline]
- Fine SL. Age-related macular degeneration 19692004: A 35-year personal perspective. Am J Ophthalmol 2005;139:405420.[CrossRef][Medline]
- Young TL, Cepko CL. A role for ligand-gated ion channels in rod photoreceptor development. Neuron 2004;41:867879.[CrossRef][Medline]
- Watanabe T, Raff MC. Retinal astrocytes are immigrants from the optic nerve. Nature 1988;332:834837.[CrossRef][Medline]
- Alexiades MR, Cepko CL. Subsets of retinal progenitors display temporally regulated and distinct biases in the fates of their progeny. Development 1997;124:11191131.[Abstract]
- Turner DL, Cepko CL. A common progenitor for neurons and glia persists in rat retina late in development. Nature 1987;328:131136.[CrossRef][Medline]
- Turner DL, Snyder EY, Cepko CL. Lineage-independent determination of cell type in the embryonic mouse retina. Neuron 1990;4:833845.[CrossRef][Medline]
- Ahmad I, Dooley CM, Thoreson WB et al. In vitro analysis of a mammalian retinal progenitor that gives rise to neurons and glia. Brain Res 1999;831:110.[CrossRef][Medline]
- Ahmad I, Tang L, Pham H. Identification of neural progenitors in the adult mammalian eye. Biochem Biophys Res Commun 2000;270:517521.[CrossRef][Medline]
- Tropepe V, Coles BL, Chiasson BJ et al. Retinal stem cells in the adult mammalian eye. Science 2000;287:20322036.[Abstract/Free Full Text]
- Coles BL, Angenieux B, Inoue T et al. Facile isolation and the characterization of human retinal stem cells. Proc Natl Acad Sci U S A 2004;101:1577215777.[Abstract/Free Full Text]
- Chacko DM, Rogers JA, Turner JE et al. Survival and differentiation of cultured retinal progenitors transplanted in the subretinal space of the rat. Biochem Biophys Res Commun 2000;268:842846.[CrossRef][Medline]
- Qiu G, Seiler MJ, Mui C et al. Photoreceptor differentiation and integration of retinal progenitor cells transplanted into transgenic rats. Exp Eye Res 2005;80:515525.[CrossRef][Medline]
- Wu P, Tarasenko YI, Gu Y et al. Region-specific generation of cholinergic neurons from fetal human neural stem cells grafted in adult rat. Nat Neurosci 2002;5:12711278.[CrossRef][Medline]
- Hunter DD, Murphy MD, Olsson CV et al. S-laminin expression in adult and developing retinae: A potential cue for photoreceptor morphogenesis. Neuron 1992;8:399413.[CrossRef][Medline]
- Hicks D, Courtois Y. Fibroblast growth factor stimulates photoreceptor differentiation in vitro. J Neurosci 1992;12:20222033.[Abstract]
- Kelley MW, Turner JK, Reh TA. Retinoic acid promotes differentiation of photoreceptors in vitro. Development 1994;120:20912102.[Abstract]
- Wallace VA, Jensen AM. IBMX, taurine and 9-cis retinoic acid all act to accelerate rhodopsin expression in postmitotic cells. Exp Eye Res 1999;69:617627.[CrossRef][Medline]
- Angenieux B, Schorderet DF, Arsenijevic Y. Epidermal growth factor is a neuronal differentiation factor for retinal stem cells in vitro. STEM CELLS 2006;24:696706.[Abstract/Free Full Text]
- Bennett J, Tanabe T, Sun D et al. Photoreceptor cell rescue in retinal degeneration (rd) mice by in vivo gene therapy. Nat Med 1996;2:649654.[CrossRef][Medline]
- Kostic C, Chiodini F, Salmon P et al. Activity analysis of housekeeping promoters using self-inactivating lentiviral vector delivery into the mouse retina. Gene Ther 2003;10:818821.[CrossRef][Medline]
- Naldini L, Blomer U, Gallay P et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996;272:263267.[Abstract]
- Jones KH, Senft JA. An improved method to determine cell viability by simultaneous staining with fluorescein diacetate-propidium iodide. J Histochem Cytochem 1985;33:7779.[Abstract]
- Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new class of intermediate filament protein. Cell 1990;60:585595.[CrossRef][Medline]
- Mayer EJ, Hughes EH, Carter DA et al. Nestin positive cells in adult human retina and in epiretinal membranes. Br J Ophthalmol 2003;87:11541158.[Abstract/Free Full Text]
- Caldwell MA, Garcion E, terBorg MG et al. Heparin stabilizes FGF-2 and modulates striatal precursor cell behavior in response to EGF. Exp Neurol 2004;188:408420.[CrossRef][Medline]
- Milam AH, Dacey DM, Dizhoor AM. Recoverin immunoreactivity in mammalian cone bipolar cells. Vis Neurosci 1993;10:112.[Medline]
- Cayouette M, Raff M. The orientation of cell division influences cell-fate choice in the developing mammalian retina. Development 2003;130:23292339.[Abstract/Free Full Text]
- Neophytou C, Vernallis AB, Smith A et al. Muller-cell-derived leukaemia inhibitory factor arrests rod photoreceptor differentiation at a postmitotic pre-rod stage of development. Development 1997;124:23452354.[Abstract]
- Kedzierski W, Nusinowitz S, Birch D et al. Deficiency of rds/peripherin causes photoreceptor death in mouse models of digenic and dominant retinitis pigmentosa. Proc Natl Acad Sci U S A 2001;98:77187723.[Abstract/Free Full Text]
- Hargrave PA, McDowell JH. Rhodopsin and phototransduction: a model system for G protein-linked receptors. FASEB J 1992;6:23232331.[Abstract]
- Molday RS, MacKenzie D. Monoclonal antibodies to rhodopsin: characterization, cross-reactivity, and application as structural probes. Biochemistry 1983;22:653660.[CrossRef][Medline]
- Noorwez SM, Kuksa V, Imanishi Y et al. Pharmacological chaperone-mediated in vivo folding and stabilization of the P23H-opsin mutant associated with autosomal dominant retinitis pigmentosa. J Biol Chem 2003;278:1444214450.[Abstract/Free Full Text]
- Barnstable CJ. Monoclonal antibodies which recognize different cell types in the rat retina. Nature 1980;286:231235.[CrossRef][Medline]
- Graham DR, Overbeek PA, Ash JD. Leukemia inhibitory factor blocks expression of Crx and Nrl transcription factors to inhibit photoreceptor differentiation. Invest Ophthalmol Vis Sci 2005;46:26012610.[Abstract/Free Full Text]
- Fei Y, Matragoon S, Smith SB et al. Functional dissection of the promoter of the interphotoreceptor retinoid-binding protein gene: The cone-rod-homeobox element is essential for photoreceptor-specific expression in vivo. J Biochem (Tokyo) 1999;125:11891199.[Abstract/Free Full Text]
- Gonzalez-Fernandez F. Interphotoreceptor retinoid-binding proteinan old gene for new eyes. Vision Res 2003;43:30213036.[CrossRef][Medline]
- Koutalos Y, Nakatani K, Yau KW. The cGMP-phosphodiesterase and its contribution to sensitivity regulation in retinal rods. J Gen Physiol 1995;106:891921.[Abstract/Free Full Text]
- Chen S, Wang QL, Nie Z et al. Crx, a novel Otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron 1997;19:10171030.[CrossRef][Medline]
- Furukawa T, Morrow EM, Cepko CL. Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell 1997;91:531541.[CrossRef][Medline]
- Ahmad I. Mash-1 is expressed during ROD photoreceptor differentiation and binds an E-box, E(opsin)-1 in the rat opsin gene. Brain Res Dev Brain Res 1995;90:184189.[Medline]
- Klassen HJ, Ng TF, Kurimoto Y et al. Multipotent retinal progenitors express developmental markers, differentiate into retinal neurons, and preserve light-mediated behavior. Invest Ophthalmol Vis Sci 2004;45:41674173.[Abstract/Free Full Text]
- Hartfuss E, Galli R, Heins N et al. Characterization of CNS precursor subtypes and radial glia. Dev Biol 2001;229:1530.[CrossRef][Medline]
- Akagi T, Haruta M, Akita J et al. Different characteristics of rat retinal progenitor cells from different culture periods. Neurosci Lett 2003;341:213216.[CrossRef][Medline]
- Conti L, Pollard SM, Gorba T et al. Niche-independent symmetrical self-renewal of a mammalian tissue stem cell. PLoS Biol 2005;3:e283.[CrossRef][Medline]
- Cepko CL, Austin CP, Yang X et al. Cell fate determination in the vertebrate retina. Proc Natl Acad Sci U S A 1996;93:589595.[Abstract/Free Full Text]
- Altshuler D, Lo Turco JJ, Rush J et al. Taurine promotes the differentiation of a vertebrate retinal cell type in vitro. Development 1993;119:13171328.[Abstract]
- Davis AA, Matzuk MM, Reh TA. Activin A promotes progenitor differentiation into photoreceptors in rodent retina. Mol Cell Neurosci 2000;15:1121.[CrossRef][Medline]
- Levine EM, Roelink H, Turner J et al. Sonic hedgehog promotes rod photoreceptor differentiation in mammalian retinal cells in vitro. J Neurosci 1997;17:62776288.[Abstract/Free Full Text]
- Zhao S, Barnstable CJ. Differential effects of bFGF on development of the rat retina. Brain Res 1996;723:169176.[CrossRef][Medline]
- Vescovi AL, Reynolds BA, Fraser DD et al. bFGF regulates the proliferative fate of unipotent (neuronal) and bipotent (neuronal/astroglial) EGF-generated CNS progenitor cells. Neuron 1993;11:951966.[CrossRef][Medline]
- Tao Y, Black IB, DiCicco-Bloom E. Neurogenesis in neonatal rat brain is regulated by peripheral injection of basic fibroblast growth factor (bFGF). J Comp Neurol 1996;376:653663.[CrossRef][Medline]
- Freund CL, Gregory-Evans CY, Furukawa T et al. Cone-rod dystrophy due to mutations in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell 1997;91:543553.[CrossRef][Medline]
- Tomita K, Nakanishi S, Guillemot F et al. Mash1 promotes neuronal differentiation in the retina. Genes Cells 1996;1:765774.[Abstract]
- Hatakeyama J, Kageyama R. Retinal cell fate determination and bHLH factors. Semin Cell Dev Biol 2004;15:8389.[CrossRef][Medline]
- Furukawa A, Koike C, Lippincott P et al. The mouse Crx 5'-upstream transgene sequence directs cell-specific and developmentally regulated expression in retinal photoreceptor cells. J Neurosci 2002;22:16401647.[Abstract/Free Full Text]
- Furukawa T, Morrow EM, Li T et al. Retinopathy and attenuated circadian entrainment in Crx-deficient mice. Nat Genet 1999;23:466470.[CrossRef][Medline]
- Livesey FJ, Furukawa T, Steffen MA et al. Microarray analysis of the transcriptional network controlled by the photoreceptor homeobox gene Crx. Curr Biol 2000;10:301310.[CrossRef][Medline]
- Haruta M, Kosaka M, Kanegae Y et al. Induction of photoreceptor-specific phenotypes in adult mammalian iris tissue. Nat Neurosci 2001;4:11631164.[CrossRef][Medline]
- Akagi T, Mandai M, Ooto S et al. Otx2 homeobox gene induces photoreceptor-specific phenotypes in cells derived from adult iris and ciliary tissue. Invest Ophthalmol Vis Sci 2004;45:45704575.[Abstract/Free Full Text]
- Tan E, Wang Q, Quiambao AB et al. The relationship between opsin overexpression and photoreceptor degeneration. Invest Ophthalmol Vis Sci 2001;42:589600.[Abstract/Free Full Text]
- Chacko DM, Das AV, Zhao X et al. Transplantation of ocular stem cells: The role of injury in incorporation and differentiation of grafted cells in the retina. Vision Res 2003;43:937946.[CrossRef][Medline]