First published online September 28, 2006
Stem Cells
Vol. 25 No.
1
January 2007, pp.
132
-138
doi:10.1634/stemcells.2006-0032; www.StemCells.com
© 2007 AlphaMed Press
TISSUE-SPECIFIC STEM CELLS |
Stem/Progenitor Cell-Specific Enhanced Green Fluorescent Protein Expression Driven by the Endogenous Mcm2 Promoter
Alexander Y. Maslova,
Kimberly J. Baileya,
Lawrence M. Mielnickia,
Amy L. Freelanda,
Xiaolei Sunb,
William C. Burhansc,
Steven C. Pruitta
aDepartment of Molecular and Cellular Biology,
bDepartment of Surgical Oncology, and
cDepartment of Cell Stress Biology, Roswell Park Cancer Institute, Buffalo, New York, USA
Key Words. Enhanced green fluorescent protein • Mcm2 • Transgenic mouse • Somatic stem cells • Progenitor cells
Correspondence: Steven C. Pruitt, Ph.D., Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, New York, New York 14263, USA. Telephone: 716-845-3589; Fax: 716-845-5908; e-mail: steven.pruitt{at}roswellpark.org
Received on January 17, 2006;
accepted for publication on September 19, 2006.
First published online in STEM CELLS EXPRESS September 28, 2006.
 |
ABSTRACT
|
|---|
Previous studies have demonstrated expression of the minichromosome maintenance protein Mcm2 in cells that remain competent to divide, including stem/progenitor cells of the subventricular zone (SVZ) within the brain. Here, a transgenic mouse line in which the Mcm2 gene drives expression of enhanced green fluorescent protein (EGFP) was constructed by insertion of an internal ribosomal entry site (IRES)-EGFP cassette into the last exon of the gene, 3' to the stop codon. In these mice, expression of EGFP is observed in the SVZ and several other tissues with high proliferative activity, including the spleen, intestine, hair follicles, and bone marrow. These observations suggest that EGFP fluorescence in this mouse line provides an index of the proliferative capacity of different tissues. Immunohistological analysis demonstrates a direct concordance between expression of EGFP and Mcm2, consistent with a transcriptional level downregulation of Mcm2 expression in postmitotic cells. To test the utility of EGFP expression for recovery of live cells retaining the capacity to divide, EGFP-expressing and -nonexpressing cells from bone marrow and brain were isolated from an adult Mcm2IRES-EGFP mouse by fluorescence-activated cell sorting and assayed for clonal growth. The EGFP-positive fraction contained the entire clonogenic population of the bone marrow and greater than 90% of neurosphere-forming cells from the brain. Brain-derived clonogenic cells were shown to remain competent to differentiate towards all three neural lineages. These studies demonstrate that the Mcm2IRES-EGFP transgenic line constructed here can be used for recovery of proliferation competent cells from different tissue types.
 |
INTRODUCTION
|
|---|
Most tissues of adult mammals are maintained through the presence of a population of stem cells that divide asymmetrically to both replace themselves and to yield daughter cells (the proliferative progenitor or transiently amplifying cells), which, following an additional more rapid series of divisions, differentiate into cell lineages that are appropriate for the cognate tissue. The quintessential feature of somatic stem cells/proliferative progenitors, which distinguishes them from the majority of differentiated cells comprising the various tissues, is that they remain competent to divide.
Minichromosome maintenance (MCM) proteins play an essential role in eukaryotic cell division. Together with origin recognition complex and CDC6 proteins, six members of MCM family (MCM27) are required for the initiation of DNA replication and prevention of additional rounds of DNA synthesis within a given S phase. This group of proteins forms prereplicative complexes at replication origins that give "license" for use of these origins during replication in the subsequent S phase [13].
Prior localization of Mcm2 expression in vivo suggested that this protein is not detectable in most nonreplicating cells in a variety of tissues [4, 5]. Nonetheless, Mcm2 is expressed not only within proliferative progenitors but also within the slowly cycling neural stem cells of the brain, which have a cycle time of approximately 15 days [6]. Here, we demonstrate that a transgenic mouse line expressing enhanced green fluorescent protein (EGFP) from the endogenous Mcm2 locus recapitulates the pattern of Mcm2 expression in several tissues and that this expression can be used for isolation of stem/progenitor cells from both bone marrow and the subventricular zone (SVZ) of the brain.
 |
MATERIALS AND METHODS
|
|---|
Plasmid Construction and ES Cell Transfection
A 9-kilobase (kb) EcoRI-EcoRI fragment of Mcm2 genomic sequence containing the last (16th) exon was obtained from RPCI22 bacterial artificial chromosome and cloned into the EcoRI site of pBS-SK(+) plasmid. The internal ribosomal entry site (IRES)-EGFP-phosphoglycerate kinase promoter (PGK)-Neo cassette was excised by Xba1 from pHTP-IresEGFP-PGK-Neo-GT plasmid (L. M. Mielnicki, not published) and subcloned into the XbaI site of EcoRI-EcoRI fragment Mcm2 genomic DNA. The homology arms were designed to deliver the insert into the last exon of the Mcm2 gene after the TGA codon. W4 ES cells were transfected by electroporation with an NsiI-NsiI fragment of pMcm2-IRES-EGFP and cultured in the presence of Geneticin (G-418) (200 µg/ml; Invitrogen, Carlsbad, CA, http://www.invitrogen.com) on neo-resistant feeders (mouse embryonic fibroblasts). neo-resistant individual clones expressing EGFP were picked and amplified. Genomic DNA was isolated and analyzed for the correct homologous recombination event by polymerase chain reaction (PCR) and Southern blot analysis.
Generation of Mcm2IRES-EGFP Transgenic Mice
All procedures involving animals were approved by the Institutional Animal Care and Use Committee. The Mcm2IRES-EGFP ES cells from clones with correct integration events were used for creation of chimeric animals by microinjection of ES cells into early blastocysts. The resulting chimeric males were mated with wild-type 129/Sv females. Progeny were checked for the presence of the Mcm2IRES-EGFP allele by PCR analysis and by observation of green fluorescence in hair follicles of tail clips. Positive offspring were mated to each other to establish homozygous lines. E11.5 embryos obtained from mating of heterozygous animals were harvested and total RNA assessed by Northern blot analysis for the presence of wild-type and knock-in Mcm2 alleles.
PCR Analysis
Genomic DNA obtained from ES cell clones and tail clips by standard methods was analyzed by PCR assay with the primer pairs mcm2F1geno (TGGCTTAATGCAGACCTTTAC) and mcm2-reverse (r) (AAGCAGCCAGAGATGACCTGTGAA), which amplify a 1,273-base pair (bp) product for the wild-type Mcm2 allele; neo-forward (f) (TGATATTGCTGAAGAGCTTGGCGG) and mcm2-r, which amplify a 1,318-bp product for the knocked-in mcm2 allele; and EGFP-f (TCTTCTTCAAGGACGACGGCAACT) and EGFP-r (TGTGGCGGATCTTGAAGTTCACCT), which amplify a 216-bp product for the EGFP insert.
Collection of Tissue Samples and Immunohistological Analysis
Tissue preparation, immunostaining, and image collection were performed as described previously [6]. The primary antibodies used were mouse monoclonal anti-BM28 (1:200; Transduction Laboratories, Lexington, KY, http://www.bdbiosciences.com/pharmingen), goat polyclonal anti-Mcm2 (1:200; Santa Cruz Biotechnology, Santa Cruz, CA, http://www.scbt.com), goat polyclonal anti-EGFP (1:200; Abcam, Cambridge, MA, http://www.abcam.com), mouse monoclonal anti-glial fibrillary acidic protein (GFAP) (1:200; Calbiochem, San Diego, http://www.emdbiosciences.com), goat polyclonal anti-myelin basic protein (MBP) (1:200; Santa Cruz Biotechnology), mouse monoclonal anti-ß-III tubulin (1:200; Promega, Madison, WI, http://www.promega.com), and rabbit polyclonal anti-Musashi (1:500; Chemicon, Temecula, CA, http://www.chemicon.com). The secondary antibodies used were Alexa Fluor 488-conjugated donkey anti-goat (1:500; Molecular Probes, Eugene, OR, http://probes.invitrogen.com) and Alexa Fluor 488- or 594-conjugated donkey anti-mouse (1:500; Molecular Probes).
Colony-Forming Assay
Colony-forming units from the granulocyte-macrophage fraction were generated from freshly isolated and flow cytometry-sorted bone marrow cells. The clonogenic assay was performed on each of the four flow cytometry-sorted groups as follows. Viable cells were counted using methylene blue and were plated in duplicate on 24-well plates at a concentration of 30,000 cells/ml in semisolid culture medium plus Dulbecco's modified Eagle's medium (DMEM) (1% methylcellulose, Methocult M3534; Stem Cell Technologies, Vancouver, BC, Canada, http://www.stemcell.com) at 37°C and 5% CO2. Colonies were counted on day 7 of culture.
Neurosphere Culture
The SVZ regions were dissected from 129/Sv and Mcm2IRES-EGFPmouse brains and dissociated in 0.25% trypsin solution in DMEM. Cells were separated on the basis of EGFP expression by fluorescence-activated cell sorting (FACS); viable cells were counted using methylene blue and seeded into 96-well microtiter plates (nontissue culture grade; ICN Biomedicals, Aurora, OH) containing culture media at 37°C and 5% CO2. The culture medium was DMEM/F-12 (Invitrogen) supplemented with fibroblast growth factor-2 (20 ng/ml; Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), epidermal growth factor (20 ng/ml; Peprotech, Rocky Hill, NJ, http://www.peprotech.com), and B27 supplement (Invitrogen). Medium was changed on days 2 and 4 after seeding. On day 8, neurospheres were counted on a per well basis.
 |
RESULTS
|
|---|
Mcm2IRES-EGFP Mouse Exhibits Coexpression of Mcm2 and EGFP
A transgenic mouse line in which expression of EGFP is directed by the Mcm2 gene was constructed using a knock-in approach to insert an IRES-EGFP cassette into the 3'-untranslated region of the Mcm2 gene (Fig. 1A). W4 ES cells were electroporated with an NsiI-NsiI fragment of pMcm2-IRES-EGFP construct and grown in the presence of G418. Fifty neo-resistant clones were picked and assessed for correct integration event by Southern blot method (Fig. 1B). Two clones demonstrated a single integration of the reporter cassette into the Mcm2 locus. These clones also exhibited green fluorescence. Generation of chimeric embryos and germ line transmission was achieved for each of the lines. A PCR assay with a set of primers allowing detection of both the Mcm2 knock-in and wild-type alleles was used for genotyping, and results were confirmed by visual assessment of tail clips for the presence of green fluorescence in hair follicles (Fig. 2H, 2I). Homozygotes were produced at the expected frequencies from the mating of heterozygous animals and demonstrated a higher level of EGFP fluorescence relative to heterozygotes. Further breeding showed that homozygotes are fertile and do not have an overt phenotype by more than 1 year of age. To confirm that the targeted locus gives the expected Mcm2IRES-EGFP transcript, Northern blot analysis was performed. Total RNA obtained from E11.5 nontransgenic, heterozygote, and homozygote embryos was probed for Mcm2 (Fig. 1C, top panel) or EGFP (Fig. 1C, bottom panel). Bands of the predicted sizes for Mcm2 (3.3 kb) and Mcm2-EGFP (4.3 kb) transcripts were observed. (Note that the difference in signal intensity between the Mcm2 and Mcm2-EGFP transcripts is likely to result from occlusion of Mcm2-EGFP by comigrating 28S rRNA.) This interpretation is supported by the observation that there is no difference in Mcm2 signal level between Mcm2wt/wt and Mcm2IRES-EGFP/IRES-EGFP homozygous animals when sections from the SVZ and other tissues are stained using
-Mcm2 antibodies (Fig. 1D).

View larger version (53K):
[in this window]
[in a new window]
|
Figure 1. Targeted integration of EGFP into the Mcm2 gene. (A): Top, the structure of the targeted region of endogenous Mcm2 gene; middle, the targeting construct in which an IRES-EGFP cassette was cloned into a 9-kilobase (kb) fragment of Mcm2 genomic sequence containing the last (16th) exon 3' to the stop codon; bottom, the anticipated structure following homologous recombination of the targeting construct into genomic DNA of W4 ES cells. In all cases, Mcm2 exons not contained within the targeting construct are shown in open boxes, Mcm2 exon sequences contained within the targeting construct are shown in light gray boxes, and the IRES-EGFP-PGK-Neo expression/selection cassette is shown as dark boxes. (B): Southern blot analysis of genomic DNA digested with EcoRI from selected ES clones, where M is HindIII-digested DNA; W4 is control DNA from ES cells; C31 and C33 are clones with correct integration events; and C1, C2, and C32 are clones with incorrect integrations. Arrowheads designate bands originating from Mcm2wt (13.3 kbp, top arrowhead) and Mcm2IRES-EGFP (2.1 kbp, bottom arrowhead) alleles. (C): Northern blot of total RNA obtained from Mcm2wt/wt, Mcm2IRES-EGFP/IRES-EGFP homozygote, and Mcm2IRES-EGFP/wt heterozygote (±)E11.5 embryos. The top panel shows a blot was probed for Mcm2, and the bottom panel shows a blot probed for EGFP. Filled arrowheads mark in both panels positions of 28S and 18S ribosomal RNA. Hollow arrowheads show in the bottom panel positions of Mcm2wt (3.3 kb, bottom) and Mcm2IRES-EGFP (4.3 kb, top) transcripts. (D): Mcm2-specific immunofluorescence from 129/Sv mice carrying Mcm2wt/wt (left panels) or Mcm2Ires-EGFP/Ires-EGFP (right panels) genotypes following staining with two different anti-Mcm2 antibodies (Ab1, -MCM2; Santa Cruz Biotechnologies; and Ab2, BM28; Transduction Laboratories). Abbreviations: Ab, antibody; EGFP, enhanced green fluorescent protein; Ex, exon; IRES, internal ribosomal entry site; PGK, phosphoglycerate kinase promoter; wt, wild type.
|
|

View larger version (67K):
[in this window]
[in a new window]
|
Figure 2. EGFP expression in Mcm2IRES-EGFP transgenic mice marks regions with high proliferative activity. Stereomicroscopic bright-field (A) and fluorescence (B) images of spleen from Mcm2IRES-EGFP mouse. Mcm2 and EGFP demonstrate coexpression in spleen germinal centers (C, immunostained for Mcm2; D, EGFP; E, merged; bar = 50 µm). (F) (bright field) and (G) (fluorescence): Images of whole-mount samples of small intestine from 129/Sv (top half) and Mcm2IRES-EGFP animals (bottom half). Stereomicroscopic bright-field (H) and fluorescence (I) images of tail clip from transgenic animal. (J) (bright field) and (K) (fluorescence): Stereomicroscopic cross-section images of Mcm2IRES-EGFP mouse brain showing green fluorescence in the subventricular zone (SVZ) region, where the box in K marks the approximate location shown in (LN) and (RW). (LN): SVZ of Mcm2IRES-EGFP mouse stained for Mcm2 (L) and EGFP (M); (N) is a merged image, bar = 50 µm; (RW) are colocalization studies for Musashi (R, U) and EGFP (S, V) and overlays (T, W), where (RT) are transmission fluorescence micrographs and (UW) are confocal fluorescence micrographs (bars = 50 µm). (RW) were counterstained with 4,6-diamidino-2-phenylindole (DAPI) (blue). (XAA): Comparisons of EGFP and proliferating cell nuclear antigen (PCNA) (X, EGFP = red, PCNA = green), TuJ1 (Y, EGFP = green, TuJ1 = red), GFAP (Z, EGFP = red, GFAP = green), and 3-day chlorodeoxyuridine (CldU)-labeled (AA, EGFP = red, CldU = green) cells where Z and AA are from the same field. (OQ): Subgranular zone of hippocampus from the region indicated by a box in the DAPI-stained low-magnification inset in O, stained for Mcm2 (O) and EGFP (P); (Q) is a merged image, bar = 50 µm. (BB) (phase contrast) and (CC) (fluorescence): Images of neurospheres derived from fluorescence-activated cell-sorted brain cells of Mcm2IRES-EGFP and 129/Sv animals (bar = 200 µm). Differentiated neurospheres from Mcm2IRES-EGFP mouse stained for neural lineage markers. (DD): ßIII-tubulin (red) and MBP (green) immunostaining; (EE) GFAP (red) and MBP (green) immunostaining (bar = 200 µm). Abbreviations: GFAP, glial fibrillary acidic protein; EGFP, enhanced green fluorescent protein; IRES, internal ribosomal entry site; MBP, myelin basic protein.
|
|
Mcm2IRES-EGFP mice were initially characterized for the presence of green fluorescence in regions with a high level of proliferation. In embryos, high levels of green fluorescence were observed from all tissues and organs (data not shown), consistent with their rapid proliferation. Unlike embryos, adult animals retain detectable fluorescence only in that subset of regions known to be highly proliferative (Fig. 2), including the spleen (Fig. 2A, 2B), small intestine (Fig. 2F, 2G), colon (not shown), hair follicles (Fig. 2H, 2I), and SVZ of the brain (Fig. 2J, 2K). Another organ with a high level of proliferative activity in adults is the bone marrow (BM). EGFP expression was easily detectable in the majority of BM cells by fluorescence microscopy (data not shown) and by FACS analysis (Fig. 3E, 3F).

View larger version (43K):
[in this window]
[in a new window]
|
Figure 3. Stem/progenitor cells are preferentially present in EGFP-positive fraction of bone marrow (BM) and brain from adult Mcm2IRES-EGFP mouse. Fluorescence-activated cell sorting (FACS) of bone marrow cells obtained from 129/Sv (AC) and Mcm2IRES-EGFP (DF). Cells were gated on both forward and side scatter (R1 region, A, D) and sorted into green fluorescent (R3 region) and non-green (R2 region) fractions (B, E). (C, F): Distribution of EGFP expression in ungated BM cells. FACS of brain cells from a 129/Sv mouse (G, H) and an Mcm2IRES-EGFP mouse (I, J). (K): Summary of results showing efficiency of hematopoietic colonies and neurospheres recovery from different fractions of sorted cells from BM (AF, left table) and brain (GJ, right table). Abbreviations: EGFP, enhanced green fluorescent protein; FSC, forward scatter; SSC, side scatter.
|
|
Within the SVZ of the brain, prior studies [6] have demonstrated Mcm2 expression in the nuclei of both rapidly cycling proliferative progenitors and more slowly cycling cells that previous studies have shown are the stem cells [7]. The ratio of rapidly cycling to slowly cycling cells is approximately 10:1, where the slowly cycling cells are generally located adjacent to the ependymal layer [6, 7]. To determine whether EGFP expression is detectable in all of the Mcm2-expressing cells, a direct comparison of EGFP expression with that of Mcm2 was performed immunohistologically and is shown in Figure 2L2N. These studies demonstrate that greater than 99.5% of the Mcm2-positive cells examined (n = 600) also express EGFP (two cells with marginal signal for EGFP were counted as negative). Two cases in which EGFP expression was detected in the absence of Mcm2 were also found, consistent with the possibility that the EGFP protein is somewhat more stable that Mcm2. The finding that all Mcm2-positive cells also express EGFP strongly implies that EGFP expression is detectable in not only the proliferative progenitors but also the slowly cycling neural stem cell component of the SVZ. A similar comparison of EGFP and Mcm2 expression was performed for the spleen (Fig. 2C2E) and subgranular zone of the dentate gyrus of the brain (Fig. 2O2Q; the inset in O shows a low-magnification 4,6-diamidino-2-phenylindole stain, where the box indicates the approximate location of the EGFP/Mcm2-expressing cells). In each of these cases, EGFP and Mcm2 expression were also tightly correlated. Prior studies have also demonstrated expression of Musashi in neural stem cells [6, 8]. Figure 2R2W shows double immunoassays for Musashi and EGFP in Mcm2IRES-EGFP transgenic mice. Similar to the case for Musashi and Mcm2 [6], Musashi and EGFP expression show a tight correlation (
98% of EGFP-positive cells also express Musashi) on a cell basis, although confocal microscopy (Fig. 2U2W) reveals some differences in intracellular location. Expression of EGFP in comparison with proliferating cell nuclear antigen (PCNA) (Fig. 2X), TuJ (Fig. 2Y), GFAP (Fig. 2Z), and 3-day chlorodeoxyuridine (CldU)-labeled cells (Fig. 2AA, same field as in panel Z) was also examined. As expected from previous studies characterizing Mcm2 expression [6], there is a high degree of overlap between EGFP expression and that of PCNA and CldU, each of which is expressed predominately in rapidly dividing proliferative progenitors. However, EGFP (similar to Mcm2 [6]) also marks cells, which cycle more slowly and do not express either PCNA or CldU. A fraction of the EGFP-positive cells (
10%15%) also express an intermediate level of the TuJ antigen (ßIII-tubulin) consistent with the known expression of this antigen in the early stages of neuroblast differentiation [7]. Less than 1% of the EGFP-positive cells coexpress GFAP and, similar to previous observations characterizing Mcm2 expression [6], coexpression is not observed in the slowly cycling EGFP-positive/CldU-negative fraction of cells (compare Fig. 2Z and 2AA).
Proliferation-Competent Cells Are Contained Within the EGFP-Expressing Fraction of Mcm2IRES-EGFP Transgenic Mouse Bone Marrow
Continuous 5-bromo-2'-deoxyuridine (BrdU) labeling studies of mouse bone marrow have shown that approximately 88% of nucleated cells replicate over a period of 2 days [9]. This fraction is similar to the proportion of nucleated cells that show elevated fluorescence in BM derived from the Mcm2IRES-EGFP transgenic mouse. To determine whether the EGFP-expressing population contains the replication competent fraction of the BM, EGFP-expressing and -nonexpressing cells were fractionated by FACS and assayed for the ability to form colonies in a methylcellulose culture assay. For FACS, cells were initially gated using forward and side scatter on the region R1 (Fig. 3A, 3D) to eliminate un-nucleated cells and debris. Virtually all of the fluorescent cells were contained within the R1 region (Fig. 3F). R1-gated cells were further fractionated based on fluorescence in the green channel (Fig. 3B, 3E), where R2 defines nonfluorescent cells and R3 defines fluorescent cells, using bone marrow cells from a nontransgenic 129/Sv mouse to establish region R2. The R2 and R3 fractions from an Mcm2IRES-EGFP transgenic mouse were recovered, and viable cells were counted using methylene blue. The R2 and R3 fractions were plated separately to methylcellulose in 24-well plates at a density of 1,000 viable cells per well. After 10 days of incubation, no colonies were present in samples derived from the EGFP-negative fraction. In contrast, the EGFP-positive R3 fraction yielded
12 colonies per well or 138 total. The total number of colonies recovered from nontransgenic mice in a parallel experiment was 107. These results suggest that essentially all of the clonogenic cells derived from Mcm2IRES-EGFP transgenic mice exhibit fluorescent protein expression.
Neurosphere-Forming Cells Are Contained Within the EGFP-Expressing Fraction of Mcm2IRES-EGFP Transgenic Mouse Brain
Slowly dividing neurosphere-forming cells (NSCs) of mouse central nervous system can be detected in situ based on expression of Mcm2 protein [6], and immunohistological analysis of regenerative regions of Mcm2IRES-EGFP mouse brain revealed coexpression of EGFP and Mcm2 proteins in both SVZ and DG (Fig. 2, discussed above). Despite the much lower proportion of replication competent cells, these observations suggest that it should be possible to isolate living stem/progenitor cells directly from adult brain similar to the case for BM. To test this possibility the SVZ region was dissected from a 4-week-old Mcm2IRES-EGFP mouse, trypsinized to obtain a single cell suspension, and sorted by FACS. The SVZ from a nontransgenic 129/Sv mouse of matching age and gender was prepared in parallel as a control. Cells were gated initially on region R1 (Fig. 3G, 3I) to eliminate debris. Nonfluorescent (R2) and fluorescent (R3) regions were established in the green channel based on the profile for the nontransgenic sample (Fig. 3H) such that greater than 90% of the cells were contained within R2 and less than 0.5% of the cells were contained within R3. FACS analysis of cells obtained from the Mcm2IRES-EGFP mouse showed a similar fraction of cells within R2 but the presence of 1.4% of the total within R3 (Fig. 3J).
All of the cells recovered from either the R2 or R3 fractions from the Mcm2IRES-EGFP sample were seeded into 96-well microtiter plates and cultured under conditions allowing neurosphere growth. The resulting seeding density was 1,000 cells per well for the negative fraction (R2) and 10 cells per well for positive fraction (R3) as determined by methylene blue exclusion to identify living cells. The R2 fraction from the nontransgenic control was cultured in parallel. Neurosphere formation was assessed on day 8 of cultivation, where the R2 fraction from the control sample yielded 34 (0.35 per 1,000 cells) clones and the R2 fraction from the Mcm2IRES-EGFP sample produced only two (0.02 per 1,000 cells) clones (each of which exhibited green fluorescence). The vast majority of neurospheres, 29 (30 per 1,000 cells), from Mcm2IRES-EGFP mouse were recovered from the R3 fraction. The total yield of neurospheres recovered from the Mcm2IRES-EGFP transgenic mouse was similar to that from the control mouse. To determine whether neurospheres recovered from the EGFP-positive fraction were multipotent, individual neurospheres were cultured under conditions allowing differentiation (10% fetal bovine serum in DMEM on an adherent substratum for 3 days), methanol-fixed (which eliminates EGFP fluorescence), and assessed for the expression of markers for neurons (ßIII-tubulin), astrocytes (GFAP), and oligodendrocytes (MBP) pairwise by immunofluorescence. All of three individual neurospheres assayed contained cells expressing ßIII-tubulin (Fig. 2DD) or GFAP (Fig. 2EE), and of six individual neurospheres assayed for GFAP and MBP, all contained GFAP-expressing cells, although three also contained MBP-expressing cells. These observations suggest that most neurospheres recovered from the EGFP-positive fraction were multipotent.
 |
DISCUSSION
|
|---|
In the present study a transgenic mouse line is described in which the fluorescent reporter protein EGFP is expressed under control of the promoter for the Mcm2 gene. Mcm2 is a component of a protein complex that binds to origins of replication and is required for their utilization in S phase. The origin binding complex, including Mcm2, is assembled early in the G1 phase of the cell cycle and previous studies imply that its expression, at the protein level, is a useful marker for cells that are capable of replicating [5, 6, 10]. Direct examination of that fraction of long-term label retaining cells which remain in the cell cycle has shown that expression of the Mcm2 protein occurs in the large majority of these cells within subventricular zone of the brain [6]. Consistent with previous studies, Mcm2 was not detected in newly derived or pre-existing cells that had withdrawn from the cell cycle, suggesting that its expression is downregulated during terminal differentiation. Characterization of the transgenic mouse line developed in the present study demonstrates that EGFP expression driven from the endogenous Mcm2 promoter parallels that of the Mcm2 protein.
Because the Mcm2 promoter has not been characterized, the Mcm2IRES-EGFP transgenic mouse line was generated using targeted recombination to insert an IRES-EGFP cassette into the untranslated region of the last exon of endogenous Mcm2 gene. The integration event results in a bicistronic mRNA encoding two separate proteins, Mcm2 and EGFP. It was anticipated that this configuration would allow linkage of EGFP expression to transcription from the Mcm2 promoter and simultaneous normal expression of Mcm2 protein, avoiding any potential lethality associated with Mcm2 haplo-insufficiency or dominant-negative effects of a fusion protein. Mcm2IRES-EGFP/IRES-EGFP homozygous mice are viable and fertile. No overt phenotype has been observed in mice older than 1 year of age.
A direct comparison of Mcm2 and EGFP expression by immunofluorescence shows a tight correlation between the expression of these two proteins in the SVZ and dentate gyrus of the brain and the spleen in Mcm2IRES-EGFP transgenic mice. These observations are consistent with regulation of Mcm2 expression at the transcriptional level. EGFP expression was also detectable by fluorescence in several additional tissues where a high level of proliferation is known to occur, including the hair follicles, small intestine, colon, and bone marrow. These observations suggest the EGFP expression in this transgenic line provides a readout of active and/or potential cellular proliferation within a tissue. In addition, regions of EGFP expression associated with abnormal growth have been observed in several of the transgenic mice and suggest that it may be possible to use this transgenic mouse as an efficient strain in which to detect hyperplastic growth or early tumorigenesis (data not shown).
Fluorescent protein expression in Mcm2IRES-EGFP transgenic mice should provide a means by which stem/proliferative progenitors can be isolated from a given tissue. Here, the utility of these mice in the isolation of stem/proliferative progenitors from the bone marrow and SVZ of the brain was assessed. In the case of bone marrow, prior studies using continuous BrdU administration have shown that approximately 88% of the cells replicate over a period of 2 days [7]. This is similar to the fraction of EGFP-expressing cells recovered from the bone marrow of Mcm2IRES-EGFP transgenic mice by FACS. All of the cells capable of clonal growth in methylcellulose were contained within the EGFP positive fraction, demonstrating that replication competent cells can be recovered on the basis of EGFP expression. However, hematopoietic stem cells constitute only a small fraction, less than 0.05%, of the bone marrow [11], and the present studies do not address whether this cell is present in the EGFP-positive fraction. The Mcm2IRES-EGFP transgenic mice should make it possible to address whether hematopoietic stem cells rest in a "licensed" state by determining whether the EGFP-positive or -negative bone marrow fraction contains cells capable of reconstituting the hematopoietic system.
EGFP-positive cells recovered by FACS from the SVZ of the brains of Mcm2IRES-EGFP transgenic mice also contained the large majority of replication competent cells when assayed for the ability to form neurospheres. The neurospheres recovered from this fraction were multipotent and gave rise to the major neural cell types (neurons, astrocytes, and oligodendrocytes). Here again, however, the present study does not demonstrate that neural stem cells were contained within the EGFP-positive fraction because proliferative progenitors can form multipotent neurospheres in this assay [12]. Nonetheless, prior studies have shown that neural stem cells are present in the SVZ in situ at a frequency of approximately one NSC for every 10 proliferative progenitors [6, 13] and that these cells express Mcm2 [6]. In the present study, immunofluorescence analyses demonstrate that 99.5% of the Mcm2-positive cells examined (n = 600) also express EGFP (two cells with marginal signal for EGFP were counted as negative). Hence, it is likely that neural stem cells are included in the EGFP-positive fraction.
The best evidence that a cellular fraction contains a stem cell population is provided by the demonstration that the cells are capable of reconstituting stem cell function when transplanted to a recipient host, as has been shown for hematopoietic stem cells. Although transplanted neurospheres have been shown to differentiate towards neural lineages following transplantation [14, 15], reconstitution of the neural stem cell compartment per se has not been demonstrated. In part, the failure to demonstrate reconstitution of the NSC compartment may result from changes in these cells during culture, similar to the case for mesenchymal stem cells [16]. The Mcm2IRES-EGFP transgenic line described here provides a potential means by which primary neural stem cells could be isolated for use in reconstitution studies.
 |
DISCLOSURES
|
|---|
S.P. owns stock in and has served as an officer or member of the Board of Buffalo Molecular Target Laboratories. S.P. also owns Buffalo Molecular Target Laboratories.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Debra A. Tabaczynski, Michelle M. Appenheimer, and Laura Cataldi for an excellent technical assistance. This work was supported by National Institutes of Health Grants R03AG019863 and R01AG020946 to S.C.P. and RO1CA84086 to W.C.B., and a Comprehensive Cancer Center Support Grant P30CA016056.
 |
REFERENCES
|
|---|
- Stillman B. Cell cycle control of DNA replication. Science 1996;274:16591664.[Abstract/Free Full Text]
- Ritzi M, Knippers R. Initiation of genome replication: assembly and disassembly of replication-competent chromatin. Gene 2000;245:1320.[CrossRef][Medline]
- Stoeber K, Tlsty TD, Happerfield L et al. DNA replication licensing and human cell proliferation. J Cell Sci 2001;114:20272041.[Abstract/Free Full Text]
- Todorov IT, Attaran A, Kearsey SE. BM28, a human member of the MCM23-5 family, is displaced from chromatin during DNA replication. J Cell Biol 1995;129:14331445.[Abstract/Free Full Text]
- Meng MV, Grossfeld GD, Williams GH et al. Minichromosome maintenance protein 2 expression in prostate: characterization and association with outcome after therapy for cancer. Clin Cancer Res 2001;7:27122718.[Abstract/Free Full Text]
- Maslov AY, Barone TA, Plunkett RJ et al. Neural stem cell detection, characterization, and age-related changes in the subventricular zone of mice. J Neurosci 2004;24:17261733.[Abstract/Free Full Text]
- Doetsch F, Garcia-Verdugo JM, Alvarez-Buylla A. Regeneration of a germinal layer in the adult mammalian brain. Proc Natl Acad Sci U S A 1999;96:1161911624.[Abstract/Free Full Text]
- Kaneko Y, Sakakibara S, Imai T et al. Musashi1: An evolutionally conserved marker for CNS progenitor cells including neural stem cells. Dev Neurosci 2000;22:139153.[CrossRef][Medline]
- Crippen TL, Jones IM. Cell proliferation in the bone marrow, thymus and spleen of mice studied by continuous, in vivo bromodeoxycytidine labelling and flow cytometric analysis. Cell Tissue Kinet 1989;22:203212.[Medline]
- Freeman A, Morris LS, Mills AD et al. Minichromosome maintenance proteins as biological markers of dysplasia and malignancy. Clin Cancer Res 1999;5:21212132.[Abstract/Free Full Text]
- Uchida N, Jerabek L, Weissman IL. Searching for hematopoietic stem cells. II. The heterogeneity of Thy-1.1(lo)Lin(/lo)Sca-1+ mouse hematopoietic stem cells separated by counterflow centrifugal elutriation. Exp Hematol 1996;24:649659.[Medline]
- Doetsch F, Petreanu L, Caille I et al. EGF converts transit-amplifying neurogenic precursors in the adult brain into multipotent stem cells. Neuron 2002;36:10211034.[CrossRef][Medline]
- Morshead CM, Craig CG, van der Kooy D. In vivo clonal analyses reveal the properties of endogenous neural stem cell proliferation in the adult mammalian forebrain. Development 1998;125:22512261.[Abstract]
- Akiyama Y, Honmou O, Kato T et al. Transplantation of clonal neural precursor cells derived from adult human brain establishes functional peripheral myelin in the rat spinal cord. Exp Neurol 2001;167:2739.[CrossRef][Medline]
- Tamaki S, Eckert K, He D et al. Engraftment of sorted/expanded human central nervous system stem cells from fetal brain. J Neurosci Res 2002;69:976986.[CrossRef][Medline]
- Rombouts WJ, Ploemacher RE. Primary murine MSC show highly efficient homing to the bone marrow but lose homing ability following culture. Leukemia 2003;17:160170.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
S. C. Pruitt, K. J. Bailey, and A. Freeland
Reduced Mcm2 Expression Results in Severe Stem/Progenitor Cell Deficiency and Cancer
Stem Cells,
December 1, 2007;
25(12):
3121 - 3132.
[Abstract]
[Full Text]
[PDF]
|
 |
|