| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
TISSUE-SPECIFIC STEM CELLS |
Academic Rheumatology, Department of Clinical Science at North Bristol, University of Bristol, United Kingdom
Key Words. Nuclear receptor • Stem cell • Retinoic acid receptor • Cartilage • Tissue engineering
Correspondence: Anthony Hollander, Ph.D., University of Bristol Academic Rheumatology, AMBI, Avon Orthopaedic Centre, Southmead Hospital, Bristol BS10 5NB, U.K. Telephone: 44-117-959-5918; Fax: 44-117-959-6187; e-mail: a.hollander{at}bristol.ac.uk
Received on January 24, 2007;
accepted for publication on June 22, 2007.
First published online in STEM CELLS EXPRESS July 5, 2007.
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
and RARβ receptors was able to induce chondrogenic differentiation of mesenchymal stem cells derived from osteoarthritis patients, in the absence of serum and growth factors. Furthermore, the pathway is independent of SOX9 upregulation and does not lead to hypertrophy. When mesenchymal cells were seeded on to polyglycolic acid scaffolds and cultured with LE135, there was a dose-dependent formation of cartilage, demonstrated both histologically and by biochemical analysis of the collagen component of the extracellular matrix. These results demonstrate the feasibility of a pharmacological approach to the regulation of stem cell function. Disclosure of potential conflicts of interest is found at the end of this article.
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
An intact articular cartilage surface is essential for normal joint function [9]. Loss of articular cartilage is a well-described feature of osteoarthritis [9–12] and is a result of the lack of any intrinsic repair capacity, presumably because it is an avascular tissue [13, 14]. Despite intensive research into the use of proteinase inhibitors to prevent cartilage loss in osteoarthritis [15], no effective pharmaceutical therapies have emerged [16, 17]. A pharmacological strategy directed at activation of endogenous stem cells requires those cells to have the capacity to respond appropriately. We have recently demonstrated that BMSCs derived from elderly osteoarthritis patients retain the capacity to produce cartilage when activated by TGF-β [1]. This raises the possibility that BMSCs from these patients will also respond to pharmacological signals.
Established strategies for regulating the differentiation of stem cells include the use of specific cytokines and growth factors, manipulation of culture conditions, and coculture with tissue-derived differentiated cells [3, 6, 18]. With each of these approaches, there are limited opportunities for improving efficacy and few chances, if any, of creating drugs that can be administered systemically to recruit stem cells in vivo. Identification of synthetic molecules that can drive stem cell differentiation will offer the possibility of screening chemical libraries to identify the most effective molecules that could then be formulated for systemic activity.
Nuclear receptors are ligand-activated transcription factors that play a central role in the growth and differentiation of tissues [19]. The class I subfamily includes thyroid hormone receptor, retinoic acid receptor (RAR), vitamin D receptor, and peroxisome proliferator-activated receptor (PPAR). Other subfamily classes encompass variant retinoic acid receptors (retinoic acid X receptor [RXR] and retinoid Z receptor [RZR]) and estrogen receptors (ER and ERβ) [19]. There is little information on nuclear receptor involvement in the process of stem cell differentiation through the chondrogenic lineage. A comprehensive and systematic analysis of the role of nuclear receptors in chondrocyte formation from stem cells is essential to learn how to regulate this process pharmacologically for therapeutic stem cell delivery or for in vivo manipulation of stem cells. The aim of this study was to investigate the nuclear receptor superfamily as a possible target for pharmacological induction of stem cell chondrogenesis.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
Analysis of BMSC Cell-Surface Mesenchymal Marker Epitopes by Fluorescence-Activated Cell Sorting
The cells were suspended in phosphate-buffered saline (PBS) at a concentration of approximately 100,000 cells per milliliter, fixed in 4% (wt/vol) paraformaldehyde at 4°C for 10 minutes, and washed with PBS. Nonspecific antigens were blocked by incubating the cells at room temperature for 1 hour in a blocking solution containing 1% (wt/vol) bovine serum albumin (BSA), 5% (vol/vol) fetal calf serum (FCS) (Sigma-Aldrich), and 10% (vol/vol) human serum (Sigma-Aldrich). The cells were washed by centrifugation in 3 volumes of PBS, and the cell pellet was suspended in 100 µl of a primary antibody solution containing 20–100 µg/ml of antibody in blocking solution. After incubation for 40 minutes at 4°C, the cells were washed in PBS. All the primary antibodies were mouse anti-human, obtained from R&D Systems (Minneapolis, http://www.rndsystems.com). For an isotype control, nonspecific mouse IgG (Sigma-Aldrich) was substituted for the primary antibody. For antibodies that required a second antibody for detection, the cells were incubated under the same conditions for 20 minutes with anti-mouse IgG labeled with fluorescein isothiocyanate (FITC) (DAKO, Glostrup, Denmark, http://www.dako.com). The cells were then washed in PBS and suspended in 1 ml of PBS for analysis on a FACSCalibur flow cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). Positive expression was defined as the level of fluorescence greater than that of 95% of corresponding isotype-matched control antibodies.
Analysis of Nuclear Receptors by Fluorescence-Activated Cell Sorting
BMSCs from passage 2 or 3 were trypsinized and suspended in PBS at a concentration of approximately 100,000 cells per milliliter, fixed in 4% (wt/vol) paraformaldehyde at 4°C for 10 minutes, and washed with PBS. The cells were rinsed with cold 150 mM sodium citrate solution and then incubated with a membrane permeabilization solution (0.5% [vol/vol] saponin in PBS) for 30 minutes at 37°C with occasional mixing. Nonspecific antigens were blocked by incubating the cells at room temperature for 1 hour in a blocking solution containing 1% (wt/vol) BSA, 5% (vol/vol) FCS (Sigma-Aldrich), and 10% (vol/vol) human serum (Sigma-Aldrich). The cells were washed by centrifugation in 3 volumes of PBS, and the cell pellet was suspended in 100 µl of a primary antibody solution containing 20–100 µg/ml of antibody in blocking solution. After incubation for 40 minutes at 4°C, the cells were washed in PBS. Nuclear receptor primary antibodies were all mouse or rabbit anti-human antibodies obtained from Affinity BioReagents (Golden, CO, http://www.bioreagents.com) (PPAR, PPAR
, and RXRβ) and Santa Cruz Biotechnology (Santa Cruz, CA, http://www.scbt.com; PPAR
, RAR, RARβ, RAR, RXR, and RXR). For an isotype control, nonspecific mouse or rabbit IgG (Sigma-Aldrich) was substituted for the primary antibody. For antibodies that required a second antibody for detection, the cells were incubated under the same conditions for 20 minutes with anti-mouse or anti-rabbit IgG labeled with FITC (DAKO). The cells were then washed in PBS and suspended in 1 ml of PBS for analysis on a FACSCalibur flow cytometer (Becton Dickinson). Positive expression was defined as the level of fluorescence greater than that of 95% of corresponding isotype-matched control antibodies.
RNA Isolation and Reverse Transcription
RNA was extracted from cell cultures using Invitrogen's ChargeSwitch Total RNA kit, according to the manufacturer's instructions. Reverse transcription (RT) was carried out using the Superscript III system (Invitrogen). Total RNA (2 µg) was reverse-transcribed in a 20-µl reaction volume containing Superscript III (200 U), random primers (25 µM), and dNTP (0.5 mM each) at 50°C for 60 minutes.
Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction
Quantitative real-time polymerase chain reaction was performed as described recently [1]. A 25-µl reaction consisted of 12.5 µl of the SYBR Green Ex-Taq Premix (Takara, Otsu, Japan, http://www.takara.co.jp), 5 µl of the RT reaction mixture, and 300 nM primers using the Smart Cycler II System (Cepheid, Sunnyvale, CA, http://www.cepheid.com). The amplification program consisted of initial denaturation at 95°C (2 minutes) followed by 40 cycles of denaturation at 95°C (15 seconds) and annealing/extension at 58°C (30 seconds). After amplification, melt analysis was performed by heating the reaction mixture from 60°C to 95°C at a rate of 0.2°C/second. The cycle threshold (Ct) value for each gene of interest was measured for each RT sample. The Ct value for β-actin was used as an endogenous reference for normalization. Real-time RT-polymerase chain reaction (PCR) assays were done in duplicate or triplicate and repeated two to four times. Specific primers for human nuclear receptors were purchased from SuperArray (Frederick, MD, http://www.superarray.com; proprietary primers, sequence not disclosed). Primers were checked for product size and absence of primer dimers using gel electrophoresis (data not shown). Primers for cartilage-specific genes were designed and optimized as previously described [1]. The sequence of the primers used was as follows: SOX9 (forward [F]), CTTTGGTTTGTGTTCGTGTTTTG; SOX9 (reverse [R]), AGAGAAAGAAAAAGGGAAAGGTAAG-TTT; Aggrecan (F), AGGGCGAGTGGAATGATGTT; Aggrecan (R), GGTGGCTGTGCCCTTTTTAC; Collagen X (F), GACACAGTTC-TTCATTCCCTACAC; Collagen X 1 (R), GCAACCCTGGCTCT-CCTT; Collagen II 1 (A+B) (F), CAACACTGCCAACGTCCAGAT; Collagen II 1 (A+B) (R), CTGCTTCGTCCAGATAGGCAAT; β-Actin (F), GACAGGATGCAGAAGGAGATTACT; β-Actin (R), TG-ATCCACATCTGCTGGAAGGT.
Chondrogenic Monolayer Cultures Using BMSCs
Expanded BMSCs were plated at 100,000 cells per well in a six-well plate and allowed to adhere for 24 hours. Chondrogenic differentiation was stimulated by adding differentiation medium consisting of DMEM containing 4.5 g/l glucose supplemented with 10 ng/ml TGF-β3 (R&D Systems) or RARβ antagonist (LE135; Tocris Bioscience, Bristol, U.K., http://www.tocris.com) at the indicated concentrations, 1 mM sodium pyruvate (Sigma-Aldrich), 50 µg/ml ascorbic acid-2-phosphate (Sigma-Aldrich), 1 x 10–7 M dexamethasone (Sigma-Aldrich), 1% insulin-transferrin-selenium (ITS) (Invitrogen), and 1% (vol/vol) penicillin (100 U/ml)/streptomycin (100 µg/ml) (Invitrogen). Medium was changed every 2–3 days. Differentiated cells were harvested at 3 or 6 days for mRNA analysis.
Tissue Engineering Using BMSCs
Three-dimensional cartilage engineering was carried out essentially as described earlier [1]. Briefly, polyglycholic acid (PGA) scaffolds (a kind gift from Dr. James Huckle, Smith & Nephew, York, U.K.) produced as 5-mm-diameter x 2-mm-thick discs were presoaked in 100 µg/ml human fibronectin (Sigma-Aldrich) in PBS to support BMSC adherence to PGA fibers. BMSCs from passage 2 or 3 were trypsinized and suspended in 30 µl of expansion medium. The suspension was loaded dropwise onto the scaffold in tissue culture wells precoated with 1% (wt/vol) agarose (Sigma-Aldrich) to prevent cell adherence to plastic. The constructs were maintained in chondrogenic differentiation medium, as described above for monolayer cultures. After the first week the medium was further supplemented with 50 µg/ml insulin (Peprotech, Rocky Hill, NJ, http://www.peprotech.com) until the end of culture. The medium was changed three times a week. The constructs were incubated at 37°C, 5% CO2 on a rotating platform at 50 rpm for 3 weeks. Harvested samples were digested with collagenase to release the cells, which were stored at –70°C for subsequent RNA extraction. Other samples were stored at –20°C prior to quantitative biochemical analysis (see below).
Osteogenic Cultures
BMSCs were plated at 1,000 cells per cm2 in 2-cm2 wells and grown to 50%–70% confluence. For positive controls, they were then incubated in osteogenic medium containing 10–8 M dexamethasone, 0.2 mM ascorbic acid, and 10 mM β-glycerophosphate (Sigma-Aldrich). LE135 at 0.1 and 1.0 µM was used in place of β-glycerophosphate where indicated. Negative controls were cultured with no stimulus. In all cultures, the medium was replaced every 3–4 days for a period of 21 days. The cells were then washed with PBS, fixed in a solution of ice-cold 70% ethanol for 1 hour, and stained for 10 minutes with 1 ml of 40 mM alizarin red (pH 4.1; Sigma-Aldrich).
Adipogenic Cultures
For adipogenic differentiation, 50%–70% confluent BMSCs were incubated in complete medium supplemented, in positive control cultures, with 0.5 µM hydrocortisone, 0.5 mM isobutylmethylxanthine, and 60 µM indomethacin (all from Sigma-Aldrich). These supplements were replaced with 0.1 and 1.0 µM LE135 where indicated. Negative controls were cultured with no stimulus. In all cultures, the medium was replaced every 3–4 days for a period of 21 days. Cells were washed with PBS, fixed in 10% formalin for 10 minutes, and stained for 15 minutes with fresh oil red O solution (Sigma-Aldrich).
Histological Analyses of Engineered Cartilage
Cartilage engineered from stem cells was frozen in O.C.T. embedding matrix (BDH; VWR International Ltd., Leicestershire, UK, http://uk.vwr.com). Full-depth sections (thickness, 7 µm) were cut with a cryostat and fixed in 4% (wt/vol) paraformaldehyde (Sigma-Aldrich) in PBS, pH 7.6. Some sections were stained with H&E or 0.1% (wt/vol) Safranin O (both from Sigma-Aldrich) to evaluate matrix and proteoglycan distribution, respectively. Other sections were immunostained with monoclonal antibodies against collagen type II (Southern Biotechnology). Biotinylated secondary antibodies were detected with a peroxidase-labeled biotin-streptavidin complex (Vectastain Elite kit; Vector Laboratories, Peterborough, U.K., http://www.vectorlabs.com) with diaminobenzidine substrate (Vector Laboratories).
Quantitative Biochemical Analyses of Engineered Cartilage
Dry weights of the constructs were determined after freeze-drying. The samples were then solubilized with trypsin and processed for biochemical analysis of type I collagen and type II collagen as recently described [21]. The extracts were assayed by inhibition enzyme-linked immunosorbent assay (ELISA) using a mouse IgG monoclonal antibody to denatured type II collagen, COL2–3/4m, as previously described [10]. The extracts were also assayed by inhibition ELISA using a rabbit antipeptide antibody to type I collagen, as previously described [21].
Short Interfering RNA Knockdown Analysis
Short interfering RNA (siRNA) (50 pmol) was introduced into cells by complexing with Lipofectamine 2000 transfection reagent (Invitrogen). The transfected cultures were incubated with TGF-β3 (10 ng/ml) or LE135 (1 µM) for 72 hours, and then cells were harvested for mRNA analysis using real-time RT-PCR analysis. Transfection efficiency and cell viability were optimized using BLOCK-iT Fluorescent Oligos (Invitrogen). The resultant transfection efficiency and cell viability were both >90%. Stealth Select RNAi sequence (Invitrogen) specific for human SOX9 was used in the experiments. The sequence was as follows: UGAGCUGUGUGUAGACGGGUUGUUC; Stealth RNAi Med GC sequence was used as negative control.
Statistical Analysis
Comparison of differences in nuclear receptor expression between paired samples was by the two-tailed paired t test. Analyses between individual groups was by the two-tailed Mann-Whitney U test. Multiple comparisons of LE135 doses were by Kruskal-Wallis analysis of variance followed by two-tailed Mann-Whitney U test with a Dunn post hoc correction. In all tests, p < .05 was taken as significant.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
Expression Profile of Nuclear Receptors
Undifferentiated adherent cells from passage 2 or 3 were analyzed by fluorescence-activated cell sorting to assess the expression profile of PPARs, RARs, and RXRs. For each of five different patients, the undifferentiated cells expressed all of the nuclear receptor proteins that were analyzed (Table 1). However, there was clear heterogeneity in the level of expression, ranging from less than 1% of BMSCs positive for RAR to more than 80% positive for RXRβ.
|
, RAR, PPAR, and PPAR as a result of chondrogenesis. There were also apparent increases in all three RXRs, as well as PPARβ; however, for these genes, the effect was more variable and did not reach statistical significance. In contrast, mRNA for RARβ fell by 75% as a result of chondrogenesis, and this downregulation was statistically significant (Fig. 1A).
|
and RARβ but no other retinoid receptors, and it is approximately sixfold more selective for the β over the receptor. In initial experiments, it was used in BMSC monolayer cultures at a concentration of 1 µM in the absence of serum and growth factors. After 3 days of culture with TGF-β3, there was a small increase in chondrogenic markers SOX9 (Fig. 2A), aggrecan (Fig. 2B), and type II collagen (Fig. 2C), as well as the hypertrophic marker type X collagen (Fig. 2D). The equivalent 3-day culture results for LE135 were not significantly different from that of TGF-β3 for any of the markers, although there was a trend toward lower type X collagen synthesis (Fig. 2). After 6 days of culture with TGF-β3, there was a sustained increase in SOX9, aggrecan, and type II collagen and a large increase in type X collagen synthesis to almost 150-fold over the negative control (Fig. 2). At 6 days, there was still no significant difference between LE135 and TGF-β3 with respect to aggrecan and type II collagen synthesis (Fig. 2B, 2C). However, there was significantly less SOX9 (Fig. 2A) and complete suppression of type X collagen (Fig. 2D). These observations indicate that LE135 can induce BMSCs to differentiate to chondrocytes without subsequent hypertrophy and that upregulation of SOX9 may not be required for this effect.
|
|
Histological Analysis of Chondrogenesis in LE135 and TGF-β Cultures
The macroscopic observations of chondrogenesis shown in Figure 3A led us to undertake a more detailed investigation of the extent to which LE135 induces chondrogenesis, in comparison with TGF-β. Figure 4 shows the results of histological staining after BMSCs were used to engineer cartilage in cultures driven by LE135 or TGF-β3. With both stimuli, there was an extensive extracellular matrix containing rounded cells within lacunae (Fig. 4A, 4B). However, the extracellular matrix was clearly more abundant with TGF-β. With both stimuli, there was positive staining with Safranin O for proteoglycans, although again this was more extensive in TGF-β cultures (Fig. 4C, 4D). There was also clear evidence of an extensive type II collagen fibrillar network with both LE135 and TGF-β (Fig. 4E, 4F, compared with negative controls in Fig. 4G, 4H).
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
and RARβ can induce BMSCs in a simple tissue engineering procedure to become chondrocyte-like cells that are capable of generating a 3D matrix containing detectable levels of type II collagen and proteoglycan but little type I collagen. Furthermore, this pharmacologically induced chondrogenic pathway is different from that induced by TGF-β in that it is not dependent on SOX9 upregulation and does not lead to upregulation of type X collagen, a marker of hypertrophy. These results demonstrate the feasibility of a pharmacological approach to the regulation of stem cell function both in vitro and, potentially, in vivo. Although our results clearly show upregulation of type II collagen by LE135, the induction of aggrecan was clearly less efficient than with TGF-β (compare Fig. 4C with Fig. 4D). This suggests that the inhibitor induces only incomplete chondrogenesis, which may explain why there was no hypertrophy in these cultures. It remains to be established whether the partially formed cartilage has the capacity to mature further either in vitro or when implanted into an articulating joint.
This study has used a well-characterized stem cell population derived from osteoarthritis patients by standard techniques for growing and maintaining bone marrow mesenchymal stem cells [1, 22]. We have for the first time surveyed the expression of common nuclear receptors in this undifferentiated stem cell population and found that all variants of PPARs, RARs, and RXRs were present. As we aimed to identify differential expression of nuclear receptor before and after chondrogenic stimulation, this group of nuclear receptor was selected based on their potential involvement in mouse limb bud mesenchyme differentiation into chondrocytes [19, 24]. The expression varied among those nuclear receptors studied from being almost absent (RAR) to being highly expressed (RXRβ), suggesting that there may be subtypes of BMSCs represented by the differences in nuclear receptor expression. It remains to be investigated whether the ubiquitous expression of these nuclear receptors plays a role in the maintenance of the undifferentiated phenotype of BMSCs and whether loss of each one might be associated with a specific differentiation pathway.
Our analysis revealed that only RARβ is downregulated upon TGF-β3-driven chondrogenic differentiation of human BMSCs. This suggested a possible interaction of RARs and the TGF-β signaling pathway in driving chondrogenesis. TGF-β was recently shown to upregulate chondrogenic markers of differentiating human BMSCs through a Smad2/3 signaling pathway [25]. Interestingly, Smad-driven transcription can be potentiated using RAR antagonists [26], implying that the absence of RARβ could be vital for the chondrogenic differentiation of stem cells. We have tested this hypothesis by incubating BMSCs in monolayer with the commercially available RARβ antagonist LE135 and analyzing its chondrogenic potential. LE135 displays moderate selectivity for RARβ over RAR (Ki values are 0.22 and 1.4 mM, respectively), and it is highly selective for RARβ over RAR and RXR [27]. The upregulation of chondrogenic markers demonstrated in the presence of LE135 was clear, although not as extensive as in the positive controls using TGF-β3. This novel finding in human BMSCs supports and builds on the work of others who have shown that RAR antagonists can drive the chondrogenic differentiation of mouse limb bud mesenchyme [28–30]. Retinoid signaling is thought to play a major role in early skeletal development. The importance of this pathway is highlighted by the fact that skeletal malformations induced by retinoic acid are most severe when it is applied during the period of cartilage development. Numerous studies have subsequently demonstrated, more directly, an inhibition of cartilage differentiation by retinoic acid [24]. More recently, the focus has shifted toward uncovering the role of RARs during skeletogenesis. During the early development and outgrowth of mouse limbs, RARs are expressed throughout the limb mesenchyme. However, as mesenchymal cells condense and differentiate, RARs are downregulated and become largely restricted to the surrounding perichondrium and interdigital region. Conversely, the overexpression of RARs, particularly RAR, or the presence of ligand-activated RARs results in skeletal malformation [28, 29].
Previous studies [6, 31] have shown that the TGF-βs promote the formation of hypertrophic chondrocytes in differentiating BMSCs, as shown by upregulation of type X collagen mRNA. The presence of type X collagen and hypertrophic chondrocytes leads ultimately to cartilage calcification [32], a phenomenon that may hinder the use of TGF-β to derive chondrogenic stem cells for therapeutic delivery. Strikingly, LE135 did not upregulate type X collagen in our chondrogenic cultures, suggesting that it is acting through a signaling pathway divergent from or completely different from the TGF-β pathway [29]. A recent report demonstrated that retinoic acid agonists stimulate type X collagen transcription directly in prehypertrophic chondrocytes through the activation of RARs [33]. Furthermore, stimulation of type X collagen gene expression by retinoids was found to occur in part through the bone morphogenetic protein (BMP) signaling pathway [34]. BMPs are part of the TGF superfamily and are known to drive chondrogenic differentiation of adult human stem cells. Taken together with our findings, this suggests that RAR antagonists may act by preventing the binding of active RARs to the retinoic acid response element implicated in stimulating type X collagen expression. This theory requires further investigation.
Our results suggest that LE135-driven chondrogenic differentiation is not dependent on SOX9 upregulation. This contradicts an earlier finding with mouse primary limb mesenchymal cultures, where inhibition of RAR signaling with RAR-selective antagonists induced SOX9 expression and activity [30]. There may be a number of explanations for this discrepancy; our findings are based on using human rather than rodent mesenchymal cells. For example, first, RAR agonists were found to upregulate SOX9 in human breast cancer cell lines [35]; second, the limb bud mesenchyme chondrogenic response to RAR modulation appears to be restricted to cells committed to the chondrocytic lineage, as SOX9 activity is unaffected in an early undifferentiated cell line [30]; and finally, other SOX molecules, such as SOX5 and SOX6, may compensate for the lack of SOX9 in driving the chondrogenic differentiation in this system [7, 8]. On the other hand, SOX9-specific siRNA downregulates the chondrogenic markers in TGF-β3-driven differentiation (Fig. 6). This may not be surprising, given that the BMP pathway, for example, appears to function either upstream of or in a separate pathway from the retinoid signaling pathway within the chondrogenic program of limb bud mesenchyme [29].
Our demonstration that RARβ plays a role in the chondrogenic differentiation of adult BMSCs has several important implications. First, we have been able to engineer cartilage that approaches the quality of that achieved with the widely used standard TGF-β3. This is the first example of pharmacological control of stem cell chondrogenesis and highlights the need for an extensive screen of other families of small synthetic molecules both for cartilage formation and to regulate other differentiation pathways. Second, we have shown that the RARβ chondrogenic pathway is independent of upregulation in SOX9 and does not lead to hypertrophy. This would seem to suggest that SOX9 is essential for the formation of hypertrophic chondrocytes but not those found at sites outside of the growth plate, although this conclusion requires further analysis of cartilage matrix protein formation after knockdown of the SOX9 gene. Third, our observations suggest that systemic administration of pharmacological agents could be used to treat patients by targeting either their endogenous or donated stem cells.
In conclusion, targeting nuclear receptors pharmacologically for the purpose of modulating stem cells functions is a promising area in regenerative medicine. By identifying the role of specific nuclear receptors in these cells and developing corresponding specific ligands as modulators, the therapeutic delivery of stem cells will become more controlled and efficient.
|
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
|
ACKNOWLEDGMENTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosure of Potential...AcknowledgmentsReferences |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |
