HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 2007-0102v1 25/10/2488    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Aoyama, K. Articles by Bernstein, I. D. Search for Related Content PubMed PubMed Citation Articles by Aoyama, K. Articles by Bernstein, I. D.

TISSUE-SPECIFIC STEM CELLS

The Interaction of the Wnt and Notch Pathways Modulates Natural Killer Versus T Cell Differentiation

^aClinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, Washington, USA;
^bDepartment of Pediatrics, University of Washington School of Medicine, Seattle, Washington, USA;
^cHoward Hughes Medical Institute, Department of Pharmacology, and Institute for Stem Cell and Regenerative Medicine, University of Washington School of Medicine, Seattle, Washington, USA;
^dDivision of Hematology, University of Washington School of Medicine, Seattle, Washington, USA

Key Words. Umbilical cord blood • Wnt • Notch • Natural killer cells • T cells

Correspondence: Irwin D. Bernstein, M.D., Clinical Research Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Ave. N., D2-373, Seattle, Washington 98109, USA. Telephone: 206-667-4886; Fax: 206-667-6084; e-mail: ibernste{at}fhcrc.org

Received on February 13, 2007; accepted for publication on July 9, 2007.

First published online in STEM CELLS EXPRESS  July 19, 2007.

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The Wnt and Notch signaling pathways have been independently shown to play a critical role in regulating hematopoietic cell fate decisions. We previously reported that induction of Notch signaling in human CD34⁺CD38^– cord blood cells by culture with the Notch ligand Delta1 resulted in more cells with T or natural killer (NK) lymphoid precursor phenotype. Here, we show that addition of Wnt3a to Delta1 further increased the percentage of CD34^–CD7⁺ and CD34^–CD7⁺cyCD3⁺ cells with increased expression of CD3 and preT. In contrast, culture with Wnt3a alone did not increase generation of CD34^–CD7⁺ precursors or expression of CD3 or preT gene. Furthermore, Wnt3a increased the amount of activated Notch1, suggesting that Wnt modulates Notch signaling by affecting Notch protein levels. In contrast, addition of a Wnt signaling inhibitor to Delta1 increased the percentage of CD56⁺ NK cells. Overall, these results demonstrate that regulation of Notch signaling by the Wnt pathway plays a critical role in differentiation of precursors along the early T or NK differentiation pathways.

Disclosure of potential conflicts of interest is found at the end of this article.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
During hematopoietic development, the progenies of pluripotent stem cells progressively lose their potential and capacity for self-renewal and display greater commitment to a given differentiation pathway [1]. Recently, molecules that play key roles in cell-fate determination in other developmental systems have been shown to be critical for the regulation of differentiation of hematopoietic cells. Wnt and Notch are among these molecules.

The Wnt protein family consists of 19 secreted signaling factors in humans and is known to regulate cell proliferation, cell fate, and cell movements during embryogenesis in many species [2]. There are perhaps two Wnt signaling pathways in vertebrates, the Wnt/β-catenin pathway and the "noncanonical" pathway, which antagonizes the β-catenin pathway. The Wnt/β-catenin pathway is initiated by binding of secreted Wnt glycoprotein to Frizzled receptors [3, 4]. In the absence of Wnt signaling, β-catenin is phosphorylated by glycogen synthase kinase (GSK)-3β and degraded by a ubiquitin-proteasome mediated mechanism. Upon activation of the Wnt pathway, GSK-3β phosphorylation is inhibited, leading to greater stability of β-catenin and activation of transcription via a complex formed with the TCF/LEF transcription factors. In the noncanonical pathway(s), Wnt binds to the Frizzled receptor, but downstream signaling is mediated by other molecules such as Rho and Ca²⁺ [5].

In hematopoietic tissue, Wnt proteins are expressed in thymus epithelial cells, bone marrow osteoblasts, and hematopoietic stem cells [6, 7]. Evidence that a Wnt pathway is involved in the regulation of T-cell development comes from gain- and loss-of-function studies in mice [8–13]. For example, double knockout mice lacking Wnt1 and Wnt4 or TCF-1 and LEF-1 showed reduced thymic cell numbers and abnormal patterns of T-cell differentiation, whereas overexpression of Wnt resulted in increased thymic cell numbers, demonstrating that a Wnt signaling pathway plays a critical role in T-cell development [11].

Similarly, Notch receptors are widely expressed throughout the hematopoietic system, from hematopoietic stem cells to more committed progenitors and hematopoietic tissues. The clearest role for Notch signaling in hematopoietic regulation comes from gain- and loss-of-function studies, where a critical role of Notch signaling in regulating T versus B cell fate decisions has been established [14]. Further influence of Notch signaling in hematopoietic regulation has been suggested by studies showing that the Notch ligand Jagged2 promotes the development of natural killer (NK) cells from hematopoietic stem cells in mice [15]. In addition, we have previously shown that culture of human umbilical cord blood CD34⁺CD38^– cells in the presence of immobilized Notch ligand Delta1 increases the generation of CD34⁺ repopulating cells and promotes the generation of early T/NK cell precursors in vitro [16, 17]. Although the precise mechanism by which Notch signaling regulates the differentiation of T and NK cells is unknown, partial inhibition of Notch signaling has been shown to promote generation of NK cells in a thymic stromal cell environment in which T cells were normally generated [18, 19].

The existence of NK/T progenitor cells has been proposed for both humans and mice [20, 21]. Transcription factors such as those of the Id family, Ets-1 or PU.1, have been shown to be involved in NK commitment in studies using knockout mice [22]. However, no extracellular factor responsible for differentiation along the T or NK lineage has been identified.

Based on the observation that Notch signaling is required to promote NK/T precursors and Wnt signaling is essential to development of T cells, we hypothesized that Wnt may be a key factor in differentiation along the T or NK lineage by modulation of Notch signaling. Using highly purified Wnt, the Wnt antagonist Dickkopf1, and immobilized Notch ligand Delta1^ext-IgG, we show that Wnt signaling can play a significant role in early T versus NK cell differentiation in the presence of Notch signaling.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
Proteins and Reagents
Delta1^ext-IgG and Control^IgG were purified from conditioned medium generated from NSO myeloma cells that had been electroporated with the constructs expressing the ligands, as previously described [23]. Human Dickkopf1 was purchased from R&D Systems Inc., (Minneapolis, http://www.rndsystems.com). Mouse Wnt3a protein was purified according to a method previously described [24]. The activity of Wnt3a protein and Dickkopf1 was measured by luciferase assay with SuperTOPflash reporter containing eight copies of optimal TCF/LEF binding sites as described [25]. Briefly, human embryonic kidney 293T cells were transfected in 24-well plates by using Lipofectamine Plus (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). Wnt3a protein was added 24 hours post-transfection. After 6 hours of stimulation, all cells were lysed, and luciferase activity was measured with the Dual Luciferase Assay (Promega, Madison, WI, http://www.promega.com) in Topcount NXT (Packard, Meriden, CT, http://www.packardinstrument.com). Reporter expression was normalized to cotransfected Renilla luciferase. Interleukin (IL)-15 was purchased from Peprotech (Rocky Hill, NJ, http://www.peprotech.com). -Secretase inhibitor, {1S-benzyl-4R-[1-(1S-carbamoyl-2-phenylethylcarbamoyl)-1S-3-methyl-butylcarbamoyl]-2R-hydroxy-5-phenylpentyl}carbamic acid tert-butyl ester (L-685,458), was purchased from Calbiochem (San Diego, http://www.emdbiosciences.com). Since -secretase inhibitor is dissolved in dimethyl sulfoxide (DMSO), the same amount of DMSO was added to control cultures.

Cell Cultures
Human cord blood CD34⁺CD38^– cells were separated as previously described with slight modification [16]. Culture plates were precoated with 5 µg/ml Delta1^ext-IgG or Control^IgG as previously described [26] with 5 µg/ml fibronectin fragment CH-296 (Takara, Otsu, Japan, http://www.takara.co.jp). Cell cultures were performed as previously described [16]. Briefly, cells were cultured in serum-free medium (StemSpan; StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com) containing 300 ng/ml stem cell factor (SCF), 100 ng/ml thrombopoietin, 300 ng/ml flt-3 ligand, 100 ng/ml IL-6, 10 ng/ml IL-3, and 20 µg/ml low density lipoprotein. Cultures were initiated in 48-well nontissue culture treated plates at 2,500 cells per well and replated to new wells every week. Fresh media with cytokines with or without Dickkopf1 (300 ng/ml) were added every 3–4 days. Wnt3a protein (100 ng/ml) was added every day since the protein is completely inactivated after 1 day in culture medium (data not shown).

Immunofluorescence Studies
Immunofluorescence analysis was performed as previously described [16] using fluorescein isothiocyanate (FITC)-labeled antibodies against CD34 and CD3 (BD Biosciences, San Diego, http://www.bdbiosciences.com), phycoerythrin (PE)-labeled antibodies against CD7 (8H8.1), CD56 (Immunotech, Marseilles, France, http://www.beckman.com), CD4, CD45RA, CD94, and NKR-P1A, or allophycocyanin (APC)-labeled CD3 and CD8 (BD Biosciences). FITC-, PE-, or APC-conjugated isotype-matched antibodies were used as controls. Dead cells were excluded with propidium iodide staining. Cytoplasmic CD3 staining was performed after cells were stained with CD34 and CD7 and subsequent fixation and permeabilization using PermiFlow (Invirion, Oak Brook, IL, http://www.invirion.com). FITC-conjugated anti-cytoplasmic CD3 chain antibody (BD Biosciences) was used. IL-7 (100 ng/ml) was added to cultures to enhance expression of cytoplasmic CD3 antigen.

Production and Infection of a Lentiviral Reporter Construct
To construct a lentiviral reporter plasmid, 11 LEF/TCF binding sites followed by TA minimal promoter and luciferase gene were cloned from SuperTOPflash [25] into a lentiviral vector, pRRL-cPPT-X-PRE-SIN [27]. Enhanced green fluorescent protein gene with constitutive PGK promoter was also inserted into the vector. Lentivirus was produced and concentrated as previously described [28]. CD34⁺CD38^– cord blood cells were transduced overnight with a concentrated lentiviral vector stock at an multiplicity of infection of 30 in the presence of 8 µg/ml protamine sulfate. One day after infection, Wnt3a was added, and luciferase activity was measured on day 4 with the Dual Luciferase Assay in Topcount NXT.

NK Cytotoxicity Assay
NK cell lytic activity was measured using K562 cells as the target; 5 x 10⁵ K562 cells were labeled with 100 µCi of ⁵¹Cr sodium chromate for 2 hours at 37°C. Labeled K562 cells were plated in triplicate at 2 x 10³ cells per well in 96-well round-bottom plates, and effector cells were added at various effector-to-target ratios. After a 4-hour incubation, supernatant was harvested for gamma counting. Maximum release of radioactivity was obtained by adding 0.05% Nonidet P-40 (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com). Lytic activity was expressed as percent cytotoxicity as calculated by the following formula: percent cytotoxicity = ([experiment cpm] – [minimum cpm])/([maximum cpm] – [minimum cpm]) x 100.

Western Blot
Total cell lysates were prepared from 5 x 10⁵ cells (per lane) using lysis buffer (50 mmol/l Tris, pH 8.0, 0.15 mol/l NaCl, 20 mmol/l EDTA, 1.0% Triton X-100). Triton soluble proteins from lysates were separated using a 7% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis on a mini-gel apparatus (Invitrogen). Before loading gels, lysates were resuspended in reducing sample buffer (0.06 mol/l Tris, pH 6.8, 1% SDS, 12.5% glycerol, 1.25% β-mercaptoethanol, 0.025% bromophenol blue). Separated proteins were transferred to nitrocellulose (Invitrogen) and immunoblotted with Cleaved Notch 1 (Val1744) antibody (Cell Signaling Technology, Beverly, MA, http://www.cellsignal.com). Immunoreactivity was detected using a horseradish peroxidase-conjugated sheep anti-mouse IgG antibody (Amersham Biosciences, Piscataway, NJ, http://www.amersham.com) and SuperSignal Western blot reagents (Pierce, Rockford, IL, http://www.piercenet.com).

Reverse Transcription-Polymerase Chain Reaction
Total mRNA was extracted using the Absolutely RNA Miniprep Kit (Stratagene, La Jolla, CA, http://www.stratagene.com) according to the manufacturer's instructions. Reverse transcription reactions were performed at 50°C for 45 minutes with oligo(dT)₂₀ using ThermoScript RT-PCR System (Invitrogen) according to the manufacturer's instructions. Polymerase chain reactions (PCRs) were performed with Platinum Taq DNA Polymerase (Invitrogen) according to the manufacturer's instructions. Amplifications were carried out using 300 nM primers for 38 cycles of denaturation at 94°C for 15 seconds, annealing at 60°C for 20 seconds, and extension at 72°C for 1 minute in a PTC-200 Peltier Thermal Cycler (MJ Research Inc., Waltham, MA, http://www.mjr.com). All primers were designed to contain exon/exon boundaries in their products in order to avoid genomic DNA amplification. For positive controls of primers, expressed sequence tag plasmid containing cDNA clone of each gene was used for Wnt3, -3a, -5a, -7a, and -11. cDNA from K562 cell line was used for Wnt1, -2b, -10a, and -10b.

Real-time PCR was performed in 25 µl of reactions using 2.5 µl of cDNA and the SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com) according to the manufacturer's instructions. Each reaction contained 300 nM each primer, and amplifications were done in an ABI Prism 7900 thermocycler (Applied Biosystems) for 2 minutes at 50°C and 10 minutes at 95°C followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. The Eukaryotic Translation Initiation Factor 1 gene was used as an endogenous control. The Jurkat cell line was used as a standard. For each gene, a logarithmic dilution of Jurkat cDNA was done to allow quantification. The amount of mRNA of each gene was normalized to the endogenous control. The sequences of the primers were as follows:

Wnt1 forward primer, 5' CTGGAACTGTCCCACTGCTC 3'; Wnt1 reverse primer, 5' GGATTCGATGGAACCTTCTG 3';

Wnt2b forward primer, 5' AAGATGGTGCCAACTTCACCG 3'; Wnt2b reverse primer, 5' CTGCCTTCTTGGGGGCTTTGC 3';

Wnt3 forward primer, 5' CTGCCAGGAGTGTATTCGCATC 3'; Wnt3 reverse primer, 5' GAGAGCCTCCCCGTCCACAG 3';

Wnt3a forward primer, 5' TCAGCTGCCAGGAGTGCACG 3'; Wnt3a reverse primer, 5' CGCCCTCAGGGAGCAGCCTAC 3';

Wnt5a forward primer, 5' ATGAACCTGCACAACAACGA 3'; Wnt5a reverse primer, 5' CTTCTCCTTCAGGGCATCAC 3';

Wnt7a forward primer, 5' GAGAAGCAAGGCCAGTACCA 3'; Wnt7a reverse primer, 5' TAGTTGGGCGACTTCTCGAT 3';

Wnt10a forward primer, 5' CCCAATGACATTCTGGACCT 3'; Wnt10a reverse primer, 5' TAAGCGGTGCAGCTTCCTAC 3';

Wnt10b forward primer, 5' GAATGCGAATCCACAACAACAG 3'; Wnt10b reverse primer, 5' TTGCGGTTGTGGGTATCAATGAA 3';

Wnt11 forward primer, 5' GTAAGTGCCATGGGGTGTCT 3'; Wnt11 reverse primer, 5' GCTTCCGTTGGATGTCTTGT 3';

Hypoxanthine-guanine phosphoribosyl transferase (HPRT) forward primer, 5' GAACGTCTTGCTCGAGGTGT 3'; HPRT reverse primer, 5' CTGCATTGTTTTGCCAGTGT 3';

Hes1 forward primer, 5' TGGAAATGACAGTGAAGCACCT 3'; Hes1 reverse primer, 5' GTTCATGCACTCGCTGAAGC 3';

CD3 forward primer, 5' GGGGCAAGATGGTAATGAAG 3'; CD3 reverse primer, 5' CCAGGATACTGAGGGCATGT 3';

PreT forward primer, 5' CATCCTGGGAGCCTTTGGT 3'; PreT reverse primer, 5' CCGGTGTCCCCCTGAGA 3';

Eukaryotic Translation Initiation Factor 1 forward primer, 5' CATGCCCTACGTTGGTATAATCAC 3'; Eukaryotic Translation Initiation Factor 1 reverse primer, 5' ACATCGGCAGGACCAT-ATTTG 3'.

Statistical Analysis
Student's t test was used to determine statistical significance; p values less than .05 were considered significant.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
CD34⁺CD38^– Cord Blood Cells Express Endogenous Wnt and Respond to Canonical Wnt Signaling
To assess the potential role of endogenous Wnt signaling in hematopoietic precursor cells, we first examined the endogenous expression of Wnt genes in human CD34⁺CD38^– cord blood cells using reverse transcription (RT)-PCR. We examined nine Wnt family members that are reported to have effects on cellular function. Only Wnt3, which activates the Wnt/β-catenin signaling pathway [29], was detected (Fig. 1A). Other Wnt members, including Wnt5a and Wnt11, which activate the noncanonical Wnt signaling pathway, were not expressed. Continued expression of Wnt3 was also detected in cells cultured for 2 weeks with the immobilized Notch ligand, Delta1^ext-IgG, or with Control^IgG (data not shown).

View larger version (32K): [in this window] [in a new window]   Figure 1. Wnt signaling in human CD34+CD38– cord blood cells. (A): Endogenous expression of Wnt genes in human CD34+CD38– cord blood cells. CD34+CD38– cord blood cells were sorted by fluorescence-activated cell sorting analysis, placed in medium containing cytokines for 6 hours, and then subjected to reverse transcription-polymerase chain reaction for mRNA expression of nine Wnt family members. Positive controls for each Wnt family member were assessed as well as HPRT as a positive control for the reaction. Data shown are representative of three independent experiments. (B): Addition of soluble Wnt3a to culture results in increased Wnt signaling. CD34+CD38– cord blood cells were infected with a lentiviral vector containing 11 TCF/LEF binding sites and a luciferase gene as a reporter for the canonical Wnt signaling pathway (SuperTOPflash). After incubation with or without Wnt3a or the Wnt inhibitor Dickkopf1 for 3 days, luciferase activity was measured. Mean fold increase of luciferase activity ± range of two independent experiments is shown. Similar results were obtained in these experiments.

Increased Wnt Signaling Enhances the Effect of Notch Signaling on Differentiation Toward Early T-Cell Development
To assess the effect of exogenous Wnt3a on human hematopoietic progenitors, CD34⁺CD38^– cord blood cells were cultured with Wnt3a and either Control^IgG or Delta1^ext-IgG in serum-free conditions supplemented with five growth factors (SCF 300 ng/ml, Flt-3L 300 ng/ml, thrombopoietin 100 ng/ml, IL-6 100 ng/ml, and IL-3 10 ng/ml). As previously reported, after culture for 2–3 weeks, most CD34⁺CD38^– cord blood precursor cells lose expression of the CD34 antigen in the absence of Delta1^ext-IgG and differentiate into mature cells, most of which are monocytes, whereas in the presence of immobilized Delta1^ext-IgG, a significantly higher proportion of cells retain CD34 expression [16]. These conditions also generate cells with a phenotype indicative of early lymphoid progenitors (CD34⁺CD7⁺CD45RA⁺) as well as presumably more mature lymphoid precursors (CD34^–CD7⁺) [30].

As seen previously, culture of CD34⁺CD38^– cord blood cells with Delta1^ext-IgG alone resulted in an increase in the percentage and number of cells expressing the CD7 antigen as compared with CD34⁺CD38^– cells cultured with Control^IgG. The addition of purified Wnt3a (100 ng/ml) to Delta1^ext-IgG-initiated cultures consistently further increased the percentage and number of CD7⁺ cells, primarily in the presumably more mature CD34^–CD7⁺ fraction. In contrast, the addition of purified Wnt3a in the absence of Delta1^ext-IgG did not significantly affect the percentage of CD7⁺ cells (Fig. 2A, 2B). Treatment of Delta1^ext-IgG alone also generated a small amount of CD56⁺ NK cells. In contrast to the increase of CD7+ cells, the addition of Wnt3a completely inhibited the generation of these CD56⁺ cells (Fig. 2A).

View larger version (35K): [in this window] [in a new window]   Figure 2. Wnt signaling promotes early T-cell differentiation of CD34+CD38– cord blood progenitors. (A): CD34+CD38– cord blood cells were cultured with or without Wnt3a for 3 weeks on immobilized Delta1ext-IgG or ControlIgG. Cells were then analyzed by flow cytometry for CD34 and CD7 or CD3 and CD56 expression. The numbers in the corners of the flow cytometry plots represent the percentage of gated events within that quadrant. Data are representative of three independent experiments. (B): The absolute number of CD7+ cells generated. CD34+CD38– cord blood cells were cultured for 3 weeks with or without Wnt3a on immobilized Delta1ext-IgG or ControlIgG. Results are the mean (± SD) of three independent experiments; * p < .05.

View larger version (11K): [in this window] [in a new window]   Figure 3. Expression of genes and antigens associated with early T-cell development. CD34+CD38– cord blood cells were cultured on Delta1ext-IgG with or without Wnt3a or Dickkopf1 for 3 weeks. Expression of CD3 and preT genes was examined by quantitative reverse transcription-polymerase chain reaction. Results indicate the mean fold increase of gene expression normalized to ControlIgG alone ± SD in three independent experiments; * p < .05.

View larger version (37K): [in this window] [in a new window]   Figure 4. Inhibition of endogenous Wnt signaling by Dickkopf1 results in an increase of CD56+ natural killer cells. CD34+CD38– cord blood cells were cultured with or without Dickkopf1 for 2 weeks on immobilized Delta1ext-IgG or ControlIgG. (A): Cells were analyzed by flow cytometry for expression of CD34 and CD7, CD3 and CD56. The numbers in the corners of the flow cytometry plots represent the percentage of gated events within that quadrant. Data are representative of three independent experiments. (B): The absolute number of CD56+ cells generated. CD34+CD38– cord blood cells were cultured for 3 weeks with or without Dickkopf1 on immobilized Delta1ext-IgG or ControlIgG. Results are the mean (± SD) of three independent experiments; * p < .05.

View larger version (32K): [in this window] [in a new window]   Figure 5. Characterization of natural killer (NK) cells generated by culture with Delta1ext-IgG and Dickkopf1. (A): CD34+CD38– cord blood cells were cultured with or without Dickkopf1 for 2 weeks on immobilized Delta1ext-IgG or ControlIgG. Cells were then analyzed by flow cytometry for expression of CD3, CD94, and NKR-P1A (CD161). Data are representative of four independent experiments. (B): CD34+CD38– cord blood cells were cultured for 2 weeks with different densities of Delta1ext-IgG (0–10 µg/ml) with or without Dickkopf1; y-axis represents the percentage or number of CD56+ cells. The results represent the mean values of two independent experiments (± range). Similar results were obtained in these experiments. (C): Inhibition of Notch signaling by -secretase inhibitor results in decreased generation of NK cells. CD34+CD38– cord blood cells were cultured for 2 weeks in the presence of Delta1ext-IgG or ControlIgG with or without Dickkopf1. -Secretase inhibitor (10 µM) or DMSO was added to each culture condition; y-axis shows percentage or number of CD56+ cells in culture. Data are representative of two independent experiments. (D): NK cytotoxic activity of cultured cells. CD34+CD38– cord blood cells were cultured on Delta1ext-IgG with Dickkopf1 (triangle) or on ControlIgG (square) for 1 week. Interleukin-15 (20 ng/ml) was added and cultures incubated for 2 weeks prior to assay for cytotoxicity. Data represent the mean ± SD in four independent experiments. Abbreviations: DMSO, dimethyl sulfoxide; E/T, effector-to-target.

Inhibition of Notch signaling by pharmacological interference such as -secretase inhibitors [18, 32–34] or introduction of dominant negative forms of components of Notch signaling such as Mastermind-like [35] has been used to demonstrate critical roles of the Notch pathway in lymphocyte differentiation. To further confirm that Notch signaling is required to generate NK cells, Notch signaling was inhibited via introduction of a -secretase inhibitor to the cultures (Fig. 5C). Addition of a -secretase inhibitor resulted in a decreased generation of CD56⁺ cells when added to cells cultured in the presence of Delta1^ext-IgG and Dickkopf1, providing further evidence that Notch signaling is indispensable for NK cell differentiation.

In addition, to verify that the CD56⁺CD7⁺CD3^– population of cells generated with Delta1^ext-IgG and Dickkopf1 can differentiate to functional NK cells, cytotoxicity assays using the NK-sensitive cell line K562 as a target were performed. CD34⁺CD38^– cord blood cells were cultured for 1 week in the presence of Delta1^ext-IgG and Dickkopf1, and IL-15 was then added to the medium, and the cells were cultured for 2 more weeks to allow for maturation (Fig. 5D). Cells cultured under these conditions were highly cytotoxic. In contrast, cells cultured on Control^IgG with IL-15 did not have detectable cytotoxic activity.

Furthermore, when Wnt3a and Dickkopf1 were simultaneously added to cultures with Delta1^ext-IgG, cells were phenotypically similar to those cultured with Dickkopf1 and Delta1^ext-IgG and resulted in increased generation of CD56⁺CD3^– cells (Fig. 6). This is consistent with the above results in which addition of Dickkopf1 inhibited the effect of exogenous Wnt3a in inducing endogenous Wnt activity (Fig. 1B) and suggests that Dickkopf1 inhibits both endogenous and exogenous Wnt signaling. Overall, these results show that inhibition of endogenous Wnt signaling in the presence of Notch signaling enhances the generation of NK cells.

View larger version (23K): [in this window] [in a new window]   Figure 6. Dickkopf1 inhibits both endogenous and exogenous Wnt signaling. CD34+CD38– cord blood cells were cultured with or without Dickkopf1, Wnt3a, or both for 2 weeks on immobilized Delta1ext-IgG or ControlIgG. Cells were then analyzed by flow cytometry for expression of CD34 and CD7, CD3, and CD56. Data are representative of two independent experiments.

View larger version (30K): [in this window] [in a new window]   Figure 7. Wnt signaling regulates Notch signaling. (A): CD34+CD38– cord blood cells were cultured on immobilized Delta1ext-IgG or ControlIgG in the presence of Wnt3a or Dickkopf1 for 24 hours (five experiments) or 2 weeks (three experiments). Fold increase in Hes1 mRNA expression was determined by quantitative reverse transcription-polymerase chain reaction. Results indicate the mean fold increase of gene expression normalized to ControlIgG alone ± SD. (B): Western blot analysis with an antibody against the activated Notch1 intracellular domain. CD34+CD38– cord blood cells were cultured on immobilized Delta1ext-IgG or ControlIgG in the presence of Wnt3a or Dickkopf1 for 24 hours. Data are representative of three independent experiments. (C): Quantitation of Western blot results. The bands representing activated Notch intracellular domain were quantified by densitometry, and the ratio to the endogenous control was calculated. Results represent the mean fold increase ± SD in three independent experiments; * p < .01.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

We previously reported that NK/T progenitors were generated by culture in the presence of Notch ligand [16]. However, the majority of precursors with NK/T precursor cells develop into T cells in the thymus where the thymic microenvironment enhances commitment to the T-cell lineage. The bone marrow environment, however, promotes the generation of NK cells and, to date, no extracellular factor known to regulate cell-fate determination has been found to be involved in commitment to the NK versus T-cell lineage [22]. IL-15 or IL-2 are thought to have important roles in the proliferation and maturation of NK cells in bone marrow and peripheral tissues [39]. However, even in the presence of these cytokines, the generation of NK cells is inhibited by an unknown soluble factor from thymic epithelial cells [40]. Our results suggest that Wnt may be the inhibitory factor for the generation of NK cells in the thymic environment, in which Notch ligand promotes generation of NK/T-cell precursors. It is also possible that Dickkopf1 produced in the bone marrow or peripheral tissues contributes to the promotion of NK cells through inhibition of endogenous Wnt signaling, since mesenchymal stem cells in bone marrow secrete Dickkopf1 [41].

There is some inconsistency among studies of function of the Wnt signaling pathway in hematopoiesis with knockout mice. Many studies with mice lacking TCF/LEF show that the Wnt signaling pathway is required for T-cell development [8–13]. However, mice lacking β-catenin show no abnormality in hematopoiesis and lymphopoiesis [42]. It is possible, however, that this result may have been due to compensation by -catenin in hematopoietic tissue. In addition, the role of Wnt and Notch signaling in the generation of NK cells in vivo is poorly defined. Compared with wild-type, irradiated mice that received transplanted fetal liver cells lacking TCF-1 and LEF-1 had a higher percentage of NK cells relative to T cells in the spleen, but the absolute number of NK cells was lower due to a decrease in total cell number in the knockout mice [43].

Our results also suggest that both modulation in Wnt signaling and the presence of Notch signaling are required to generate NK cells. Thus, it is possible that Notch signaling and inhibition of canonical Wnt signaling synergistically induce the expression of genes required for NK cell development. However, the precise mechanism whereby Wnt and Notch signaling regulate the expression of genes involved in NK commitment remains to be elucidated.

We previously have reported that high densities of Notch ligand that induce increased amounts of Hes1 and hence stronger Notch signaling favor T-cell development over the proliferation of stem/progenitor cells [31]. Our present results suggest that addition of Wnt3a increased early T-cell development via increased activation of the Notch pathway, indicated by an increase in Hes1 expression, whereas addition of Dickkopf1 generated NK cells via decreased Hes1. Our results are consistent with those of De Smedt et al. in that stronger Notch signaling, here induced in the presence of Wnt, favors differentiation toward the T-cell lineage, whereas decrease in Notch signaling is associated with the generation of NK cells [18]. However, since differentiation along the T-cell lineage with generation of mature T cells does not occur using in vitro cell-free systems, it remains to be elucidated whether the modulation of Notch signaling by Wnt affects subsequent Notch-induced differentiation of T-cell precursors and their mature progeny.

Crosstalk between the Notch and Wnt signaling pathways has been reported in different species. In Drosophila, Disheveled has been shown to mediate the crosstalk between the two signaling pathways. However, the outcome is controversial because both positive and negative interactions are reported [44, 45]. In mammalian cell lines, it has been shown that GSK-3β, a key component of the Wnt signaling pathway, modulates Notch1- or Notch2-mediated signaling, presumably by phosphorylation of the Notch intracellular domain [46, 47]. Moreover, the phosphorylated form of the Notch1 intracellular domain interacts with a ubiquitin ligase followed by eventual proteasome degradation [38]. It is possible that Wnt modulates Notch signaling through destabilization of the Notch intracellular domain via GSK-3β in hematopoietic stem cells. In addition, our results show that Wnt3a alone increased Hes1 expression in the absence of Notch ligand. Wnt3a alone also has been reported to increase Hes1 expression in mouse hematopoietic stem cells [48], suggesting that Notch signaling presumably induced by ligand-expressing cells within the culture was affected by Wnt signaling.

Wnt3a has been reported to induce the self-renewal of murine hematopoietic stem cells [24]. However, Wnt3a did not increase the number or percentage of CD34⁺ cells in our human cord blood culture system in either the presence or absence of Notch signaling. It has also been reported that Wnt3a does not increase murine hematopoietic stem cell numbers under cytokine-rich culture conditions [49]. One possible explanation for this discrepancy is that the former study used only a low concentration of a single cytokine, SCF. However, various cytokines are produced in a physiological environment, such as the bone marrow, and the physiologic effect of Wnt on stem cells may depend on the context of cytokines.

This study provides the first evidence that an interaction between two pathways known to regulate cell fate decisions can cooperate to affect the subsequent differentiation of precursors along the early T or NK lineage. These studies may also provide therapeutic strategies to selectively increase the generation of lineage-specific cells in vitro for therapeutic purposes.

	DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The authors indicate no potential conflicts of interest.

	ACKNOWLEDGMENTS

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 
The authors thank Ajamete Kaykas, Keizo Kato, David Flowers, Steven Staats, Brian Raden, Mariko Kawabori, and Carolyn Brashem-Stein for superb technical assistance. We also thank Tetsuya Nishida and Stanley Riddell for support and technical direction of cytotoxicity assays, Katherine Beebe and Hans-Peter Kiem for production of lentivirus, and Stacey Dozono for technical support. This work was supported by R01 HL080245, P01 HL084205, P50HL54881, and K23 HL0774446 from the National Institutes of Health and W81 XWH 04-C-0139 from DARPA. K.A. was supported by a fellowship of Mitsubishi Pharma Research Foundation. A.D.K. was supported by a Kirschstein-NRSA Individual Fellowship Grant, 1 F32 HD049208-01. I.D.B. is also supported as an American Cancer Society-F.M. Kirby Clinical Research Professor. R.T.M is an investigator of the HHMI.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... Acknowledgments References

 

1. Ogawa M. Differentiation and proliferation of hematopoietic stem cells. Blood 1993;81:2844–2853.[Abstract/Free Full Text]

2. Cadigan KM, Nusse R. Wnt signaling: A common theme in animal development. Genes Dev 1997;11:3286–3305.[Free Full Text]

3. Nusse R. Wnts and hedgehogs: Lipid-modified proteins and similarities in signaling mechanisms at the cell surface. Development 2003;130:5297–5305.[Abstract/Free Full Text]

4. Staal FJ, Clevers HC. Wnt signaling in the thymus. Curr Opin Immunol 2003;15:204–208.[CrossRef][Medline]

5. Veeman MT, Axelrod JD, Moon RT. A second canon. Functions and mechanisms of β-catenin-independent Wnt signaling. Dev Cell 2003;5:367–377.[CrossRef][Medline]

6. Varas A, Hager-Theodorides AL, Sacedon R et al. The role of morphogens in T-cell development. Trends Immunol 2003;24:197–206.[CrossRef][Medline]

7. Rattis FM, Voermans C, Reya T. Wnt signaling in the stem cell niche. Curr Opin Hematol 2004;11:88–94.[CrossRef][Medline]

8. Schilham MW, Wilson A, Moerer P et al. Critical involvement of Tcf-1 in expansion of thymocytes. J Immunol 1998;161:3984–3991.[Abstract/Free Full Text]

9. Ioannidis V, Beermann F, Clevers H et al. The β-catenin-TCF-1 pathway ensures CD4(+)CD8(+) thymocyte survival. Nat Immunol 2001;2:691–697.[CrossRef][Medline]

10. Verbeek S, Izon D, Hofhuis F et al. An HMG-box-containing T-cell factor required for thymocyte differentiation. Nature 1995;374:70–74.[CrossRef][Medline]

11. Staal FJ, Meeldijk J, Moerer P et al. Wnt signaling is required for thymocyte development and activates Tcf-1 mediated transcription. Eur J Immunol 2001;31:285–293.[CrossRef][Medline]

12. Mulroy T, McMahon JA, Burakoff SJ et al. Wnt-1 and Wnt-4 regulate thymic cellularity. Eur J Immunol 2002;32:967–971.[CrossRef][Medline]

13. Okamura RM, Sigvardsson M, Galceran J et al. Redundant regulation of T cell differentiation and TCRalpha gene expression by the transcription factors LEF-1 and TCF-1. Immunity 1998;8:11–20.[CrossRef][Medline]

14. Izon DJ, Punt JA, Pear WS. Deciphering the role of Notch signaling in lymphopoiesis. Curr Opin Immunol 2002;14:192–199.[CrossRef][Medline]

15. DeHart SL, Heikens MJ, Tsai S. Jagged2 promotes the development of natural killer cells and the establishment of functional natural killer cell lines. Blood 2005;105:3521–3527.[Abstract/Free Full Text]

16. Ohishi K, Varnum-Finney B, Bernstein ID. Delta-1 enhances marrow and thymus repopulating ability of human CD34(+)CD38(-) cord blood cells. J Clin Invest 2002;110:1165–1174.[CrossRef][Medline]

17. Delaney C, Varnum-Finney B, Aoyama K et al. Dose-dependent effects of the Notch ligand Delta1 on ex vivo differentiation and in vivo marrow repopulating ability of cord blood cells. Blood 2005;106:2693–2699.[Abstract/Free Full Text]

18. De Smedt M, Hoebeke I, Reynvoet K et al. Different thresholds of Notch signaling bias human precursor cells toward B-, NK-, monocytic/dendritic-, or T-cell lineage in thymus microenvironment. Blood 2005;106:3498–3506.[Abstract/Free Full Text]

19. Schmitt TM, Ciofani M, Petrie HT et al. Maintenance of T cell specification and differentiation requires recurrent notch receptor-ligand interactions. J Exp Med 2004;200:469–479.[Abstract/Free Full Text]

20. Sanchez M, Muench M, Roncarolo M et al. Identification of a common T/natural killer cell progenitor in human fetal thymus. J Exp Med 1994;180:569–576.[Abstract/Free Full Text]

21. Carlyle JR, Michie AM, Furlonger C et al. Identification of a novel developmental stage marking lineage commitment of progenitor thymocytes. J Exp Med 1997;186:173–182.[Abstract/Free Full Text]

22. Lian RH, Kumar V. Murine natural killer cell progenitors and their requirements for development. Semin Immunol 2002;14:453–460.[CrossRef][Medline]

23. Varnum-Finney B, Wu L, Yu M et al. Immobilization of Notch ligand, Delta-1, is required for induction of notch signaling. J Cell Sci 2000;113:4313–4318.[Abstract]

24. Willert K, Brown JD, Danenberg E et al. Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 2003;423:448–452.[CrossRef][Medline]

25. Veeman MT, Slusarski DC, Kaykas A et al. Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Current Biology 2003;13:680–685.[CrossRef][Medline]

26. Varnum-Finney B, Brashem-Stein C, Bernstein ID. Combined effects of Notch signaling and cytokines induce a multiple log increase in precursors with lymphoid and myeloid reconstituting ability. Blood 2003;101:1784–1789.[Abstract/Free Full Text]

27. Barry SC, Harder B, Brzezinski M et al. Lentivirus vectors encoding both central polypurine tract and posttranscriptional regulatory element provide enhanced transduction and transgene expression. Hum Gene Ther 2001;12:1103–1108.[CrossRef][Medline]

28. Horn PA, Keyser KA, Peterson LJ et al. Efficient lentiviral gene transfer to canine repopulating cells using an overnight transduction protocol. Blood 2004;103:3710–3716.[Abstract/Free Full Text]

29. Shimizu H, Julius M, Giarre M et al. Transformation by Wnt family proteins correlates with regulation of beta-catenin. Cell Growth Differ 1997;8:1349–1358.[Abstract]

30. Hao Q-L, Zhu J, Price MA et al. Identification of a novel, human multilymphoid progenitor in cord blood. Blood 2001;97:3683–3690.[Abstract/Free Full Text]

31. Dallas MH, Varnum-Finney B, Delaney C et al. Density of the Notch ligand Delta1 determines generation of B and T cell precursors from hematopoietic stem cells. J Exp Med 2005;201:1361–1366.[Abstract/Free Full Text]

32. Wolfe MS. Gamma-secretase-intramembrane protease with a complex. Sci Aging Knowl Environ 2003;11:PE7.

33. Hadland BK, Manley NR, Su D et al. Gamma-secretase inhibitors repress thymocyte development. Proc Natl Acad Sci U S A 2001;98:7487–7491.[Abstract/Free Full Text]

34. Doerfler P, Shearman MS, Perlmutter RM. Presenilin-dependent gamma -secretase activity modulates thymocyte development. Proc Natl Acad Sci U S A 2001;98:9312–9317.[Abstract/Free Full Text]

35. Maillard I, Weng AP, Carpenter AC et al. Mastermind critically regulates Notch-mediated lymphoid cell fate decisions. Blood 2004;104:1696–1702.[Abstract/Free Full Text]

36. Mumm JS, Kopan R. Notch signaling: From the outside in. Dev Biol 2000;228:151–165.[CrossRef][Medline]

37. Phiel CJ, Wilson CA, Lee VM-Y et al. GSK-3 regulates production of Alzheimer's disease amyloid-β peptides. Nature 2003;423:435–439.[CrossRef][Medline]

38. Gupta-Rossi N, Le Bail O, Gonen H et al. Functional interaction between SEL-10, an F-box protein, and the nuclear form of activated Notch1 receptor. J Biol Chem 2001;276:34371–34378.[Abstract/Free Full Text]

39. Fehniger TA, Caligiuri MA. Interleukin 15: Biology and relevance to human disease. Blood 2001;97:14–32.[Free Full Text]

40. Le PT, Adams KL, Zaya N et al. Human thymic epithelial cells inhibit IL-15- and IL-2-driven differentiation of NK cells from the early human thymic progenitors. J Immunol 2001;166:2194–2201.[Abstract/Free Full Text]

41. Prockop DJ, Gregory CA, Spees JL. One strategy for cell and gene therapy: Harnessing the power of adult stem cells to repair tissues. Proc Natl Acad Sci U S A 2003;100:11917–11923.[Abstract/Free Full Text]

42. Cobas M, Wilson A, Ernst B et al. β-Catenin is dispensable for hematopoiesis and lymphopoiesis. J Exp Med 2004;199:221–229.[Abstract/Free Full Text]

43. Held W, Clevers H, Grosschedl R. Redundant functions of TCF-1 and LEF-1 during T and NK cell development, but unique role of TCF-1 for Ly49 NK cell receptor acquisition. Eur J Immunol 2003;33:1393–1398.[CrossRef][Medline]

44. Axelrod JD, Matsuno K, Artavanis-Tsakonas S et al. Interaction between Wingless and Notch signaling pathways mediated by dishevelled. Science 1996;271:1826–1832.[Abstract]

45. Couso JP, Knust E, Martinez Arias A. Serrate and wingless cooperate to induce vestigial gene expression and wing formation in Drosophila. Curr Biol 1995;5:1437–1448.[CrossRef][Medline]

46. Espinosa L, Ingles-Esteve J, Aguilera C et al. Phosphorylation by glycogen synthase kinase-3β down-regulates Notch activity, a link for Notch and Wnt pathways. J Biol Chem 2003;278:32227–32235.[Abstract/Free Full Text]

47. Foltz DR, Santiago MC, Berechid BE et al. Glycogen synthase kinase-3β modulates notch signaling and stability. Curr Biol 2002;12:1006–1011.[CrossRef][Medline]

48. Duncan AW, Rattis FM, DiMascio LN et al. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 2005;6:314–322.[CrossRef][Medline]

49. Zhang CC, Lodish HF. Murine hematopoietic stem cells change their surface phenotype during ex vivo expansion. Blood 2005;105:4314–4320.[Abstract/Free Full Text]

This article has been cited by other articles:

				O. H. Cho, H. M. Shin, L. Miele, T. E. Golde, A. Fauq, L. M. Minter, and B. A. Osborne Notch Regulates Cytolytic Effector Function in CD8+ T Cells J. Immunol., March 15, 2009; 182(6): 3380 - 3389. [Abstract] [Full Text] [PDF]

				C. S. Jayasena, T. Ohyama, N. Segil, and A. K. Groves Notch signaling augments the canonical Wnt pathway to specify the size of the otic placode Development, July 1, 2008; 135(13): 2251 - 2261. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 2007-0102v1 25/10/2488    most recent Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints/Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Aoyama, K. Articles by Bernstein, I. D. Search for Related Content PubMed PubMed Citation Articles by Aoyama, K. Articles by Bernstein, I. D.