Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online August 2, 2007
Stem Cells Vol. 25 No. 11 November 2007, pp. 2809 -2819
doi:10.1634/stemcells.2006-0602; www.StemCells.com
© 2007 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0602v1
25/11/2809    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moody, J. L.
Right arrow Articles by Karlsson, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moody, J. L.
Right arrow Articles by Karlsson, S.

TISSUE-SPECIFIC STEM CELLS

Endoglin Is Not Critical for Hematopoietic Stem Cell Engraftment and Reconstitution but Regulates Adult Erythroid Development

Jennifer L. Moodya, Sofie Singbranta, Göran Karlssona, Ulrika Blanka, Marie Asplinga, Johan Flygarea, David Bryderb, Stefan Karlssona

aMolecular Medicine and Gene Therapy, Institute of Laboratory Medicine, Lund Strategic Research Center for Stem Cell Biology and Cell Therapy, Lund University Hospital, Lund, Sweden;
bImmunology Unit, Department of Experimental Medical Science, Lund University, Lund, Sweden

Key Words. Hematopoiesis • Stem cells • RNA interference • Erythropoiesis

Correspondence: Stefan Karlsson, M.D., Ph.D., Molecular Medicine and Gene Therapy, Lund University Hospital, BMC A12, 221 84 Lund, Sweden. Telephone: 46-46-222-0577; Fax: 46-46-222-05-78; e-mail: Stefan.Karlsson{at}med.lu.se

Received on October 27, 2006; accepted for publication on July 19, 2007.

First published online in STEM CELLS EXPRESS  August 2, 2007.

    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Endoglin is a transforming growth factor-β (TGF-β) accessory receptor recently identified as being highly expressed on long-term repopulating hematopoietic stem cells (HSC). However, little is known regarding its function in these cells. We have used two complementary approaches toward understanding endoglin's role in HSC biology: one that efficiently knocks down expression via lentiviral-driven short hairpin RNA and another that uses retroviral-mediated overexpression. Altering endoglin expression had functional consequences for hematopoietic progenitors in vitro such that endoglin-suppressed myeloid progenitors (colony-forming unit-granulocyte macrophage) displayed a higher degree of sensitivity to TGF-β-mediated growth inhibition, whereas endoglin-overexpressing cells were partially resistant. However, transplantation of transduced bone marrow enriched in primitive hematopoietic stem and progenitor cells revealed that neither endoglin suppression nor endoglin overexpression affected the ability of stem cells to short-term or long-term repopulate recipient marrow. Furthermore, transplantation of cells altered in endoglin expression yielded normal white blood cell proportions and peripheral blood platelets. Interestingly, decreasing endoglin expression increased the clonogenic capacity of early blast-forming unit-erythroid progenitors, whereas overexpression compromised erythroid differentiation at the basophilic erythroblast phase, suggesting a pivotal role for endoglin at key stages of adult erythropoietic development.

Disclosure of potential conflicts of interest is found at the end of this article.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Hematopoiesis is the process whereby hematopoietic stem cells (HSC) supply billions of cells a day to the blood system while still maintaining their own numbers to sustain this role throughout the lifetime of an individual. Attempts to identify genes important for the unique functional capacity of these cells have identified cell surface receptors that have refined the isolation of HSC to near purity [13]. It follows then that studies aimed at investigating the function of such defining markers are important for dissecting mechanisms involved in extrinsic stem cell regulation.

Endoglin is one such surface molecule, identified as differentially expressed in HSC and as a marker defining functional long-term repopulating stem cells [1, 2, 4]. Also known as CD105, endoglin is a member of the transforming growth factor-β (TGF-β) superfamily, a group of molecules that includes a significant array of ligands and molecules, some with well-defined effects on hematopoiesis (reviewed in [5, 6]). Endoglin is considered an accessory receptor for TGF-β in that it is capable of binding several superfamily ligands, but only when it is associated with a type I/type II receptor complex (reviewed in [7]). Its function has been best characterized in endothelial cells, where it serves to modulate TGF-β signaling through two receptor types, balancing activation signals with inhibitory ones [810]. The potential relevance of endoglin in hematopoiesis can be insinuated from its expression on various human hematopoietic populations, including early B cell progenitors and erythroblasts in fetal bone marrow [11], proerythroblasts in adult bone marrow [11, 12], CD34+ cord blood cells [13], macrophages [14], and CD4+ T cells [15]. Studies in the murine system have revealed that complete deletion of endoglin in mice leads to embryonic lethality at approximately embryonic day 10 because of abnormal yolk sac vasculature and cardiac defects [1618]. The abnormal yolk sac angiogenesis in endoglin knockout (eng–/–) mice in the latter study was accompanied by anemia in the embryo proper; however, pools of red blood cells could occasionally be found in distended yolk sac vessels, suggesting that hematopoiesis per se may not have been completely impaired. Although there is evidence from studies examining hematopoietic in vitro differentiation of murine embryonic stem (ES) cells that implicates endoglin in erythroid and myeloid differentiation [19], the function of endoglin in primary adult hematopoietic cells has not previously been characterized.

Here, we have used viral vectors to both knock down and overexpress endoglin in murine HSC. Our results suggest that the engraftment and reconstituting capacities of HSC are not critically dependent on endoglin. However, altered endoglin expression impacts erythroid proliferation and differentiation at distinct stages.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Construction of Viral Vectors
To amplify the endoglin cDNA, RNA was isolated from murine embryonic endothelial cells using the RNeasy kit (Invitrogen, Inchinnan, U.K., http://www.invitrogen.com). cDNA was synthesized using Superscript III (Invitrogen) and random hexamers. The endoglin cDNA was then polymerase chain reaction (PCR)-amplified using Thermococcus kodakaraensis high-fidelity Taq polymerase (Merck Biosciences, Nottingham, U.K., http://www.merck.com). The primers used in the amplification included an EcoRI site at the 5' end and an XhoI site at the 3' end that facilitated the cloning of the 2.1-kilobase fragment into the MIG vector. The fidelity of the amplification was verified by sequence comparison to NM007932.

To construct the endoglin and scrambled knockdown vectors, 64-nucleotide oligos were synthesized (Invitrogen) for annealing and ligation into the pSuper RNAi system (OligoEngine, Seattle, WA, http://www.oligoengine.com). Among nine sequences tested, the most effective oligo designed against endoglin was GATCCCCGGTACA- GTGCATCGACATGTTCAAGAGACATGTCGATGCACTGT- ACCTTTTTGGAAA, and the sequence for scrambled was GATCCCCGACACGCGACTTGTACCACTTCAAGAGAGTG- GTACAAGTCGCGTGTCTTTTTGGAAA, where sense and antisense short hairpin RNA (shRNA) sequences are shown in boldface and the linker region is underlined. Hybridized oligonucleotides were phosphorylated by T4 DNA kinase (In Vitro Sweden, Stockholm, Sweden, http://www.invitro.se) and were subsequently ligated into the pSuper vector (OligoEngine) via the BglII-HindIII site, downstream of the H1 promoter. The H1 hairpin precursor cassette was excised from pSuper with EcoR1 and Cla1 and further cloned into the pLV-TH plasmid [20].

Generation of Virus
The MIG vector is a murine stem cell-based vector (MSCV) [21]. MIG control producer cell lines have been previously described, and the MIG endoglin stable producer cell line (GP-E86 ecotropic) was produced in a similar manner [22]. To concentrate supernatants, cell lines were grown in Dulbecco's modified Eagle's medium (Invitrogen) with 1% penicillin/streptomycin (P/S) and 5% fetal calf serum (FCS) for 48 hours, and supernatants were concentrated approximately 15x using Centriprep columns (Millipore, Solna, Sweden, http://www.millipore.com). Titers of concentrated virus were determined by infection of NIH 3T3 cells and exceeded 5 x 105 transducing units/ml. Lentivirus was produced by transient transfection of 293T cells, as previously described [23]. Titers approximated 1 x 108 transducing units/ml, as assessed on Hela cells.

Infection of Primary Cells
Bone marrow (BM) cells from 5-fluorouracil (5-FU)-treated mice were obtained and prestimulated in X-VIVO medium (Cambrex Karlskoga AB, Karlskoga, Sweden, http://www.cambrex.com) as previously described [24] with 50 ng/ml murine stem cell factor, 100 ng/ml murine interleukin (IL)-3, and 50 ng/ml human IL-6 for 48 hours for retroviral transduction (RV cytokines) and in 25 ng/ml murine stem cell factor, 50 ng/ml human IL-6, 50 ng/ml human thrombopoietin, and 50 ng/ml recombinant human fms-related tyrosine kinase-3 ligand (LV cytokines) for 24 hours for lentiviral transduction (cytokines from Peprotech [Rocky Hill, NJ, http://www.peprotech.com], except for hIL-6, a kind gift from Novartis International [Basel, Switzerland, http://www.novartis.com]). Retroviral transductions were carried out by spinoculation of prestimulated cells with freshly generated viral supernatant (1,500 rpm for 90 minutes at room temperature) followed by resuspension in Iscove's modified Dulbecco's medium + 20% FCS, 1% P/S, 1% L-glutamine, 10–4mM 2-mercaptoethanol, 6 µg/ml protamine sulfate, and the above-described RV cytokines. Cells were then plated onto retronectin-coated plates preloaded with concentrated viral supernatant, followed by culture at 37°C, 5% CO2 for 48 hours. Lentiviral transductions were performed on 24-hour-prestimulated cells by plating cells onto retronectin-coated plates preloaded with concentrated vector (multiplicity of infection = 10), in the presence of LV cytokines. Twenty-four hours later, the cells were resuspended in fresh X-vivo medium supplemented as described above and were cultured for an additional 48 hours.

Quantitative Real-Time PCR
RNA isolation and cDNA synthesis were performed as previously described [25] using BM populations stained and sorted for particular compartments or on sorted green fluorescent protein (GFP)+ cells. Quantitation and normalization of endoglin RNA levels was also done as previously described [25], using the TaqMan system and primers (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com).

Western Blot Analysis
Cells were retrovirally transduced and expanded for 6 days in culture, and Western lysates were prepared and analyzed under denaturing conditions as previously described [25], using an anti-endoglin antibody (SouthernBiotech, Birmingham, AL, http://www.southernbiotech.com) with an anti-rat-horseradish peroxidase secondary antibody (Dako, Glostrup, Denmark, http://www.dako.com).

Methylcellulose Assays
Lentivirally or retrovirally transduced cells were sorted as GFP+, and 200 cells per milliliter were seeded into 3 ml of 0.8% methylcellulose (M3231; Stem Cell Technologies, Vancouver, BC, Canada, http://www.stemcell.com), supplemented with 50 ng/ml mSCF, 10 ng/ml hIL-6, and 10 ng/ml mIL-3 and with or without TGF-β at the indicated concentrations. For erythroid/megakaryocyte (Mk) colonies, cells were harvested from recipients of transduced cells 5–6 weeks post-transplant. GFP+ lin, c-kit+, Sca-1, CD150+ cells were sorted to minimize myeloid colony background and enrich for erythroid/Mk progenitors (D. Bryder, manuscript submitted for publication). Seven hundred fifty sorted cells were plated in methylcellulose (M3231; Stem Cell Technologies) supplemented with 50 ng/ml mSCF, 10 ng/ml mIL-3 and 3 U of recombinant human erythropoietin (Janssen-Cilag, Sollentuna, Sweden, http://www.janssen-cilag.com). Colonies were scored 7–8 days after plating.

Mice and Transplantations
Mice were bred and maintained in the barrier facility at Lund University, and all experiments were performed under ethical guidelines set by Lund University. Unsorted transduced cells (1 x 105) from Ly5.1+ mice (7–12 weeks old) together with 2 x 105 fresh Ly5.1+/5.2+ whole BM support cells were injected into lethally irradiated (900 cGy, cesium source) Ly5.1+/5.2+ C57Bl/6.SJL (8–12 weeks old) recipients. Transduction efficiencies in these experiments were as follows: MIG, 21%–49%; MIG endoglin, 11%–41%; scrambled knockdown, 15%–40%; and endoglin knockdown, 15%–26%. For transplantations without support (for both reconstitution evaluation and for short-term harvests for erythroid colonies) 3–5 x 105 unsorted transduced Ly5.1+ cells were injected into sublethally irradiated (800 cGy) Ly5.1+/5.2+ C57Bl/6.SJL or c-kit W41/W41 (Ly5.2+) recipients. Transplantation into either of these recipient strains resulted in donor contributions of 90%–95%. In these experiments, the initial transduction efficiencies before transplant were higher and more equal between compared sets (MIG, 62%–68%, and MIG endoglin, 50%–53%; scrambled shRNA, 34%–41%, and endoglin shRNA, 38%–47%). Transplanted mice were given Ciproxin (Bayer, Göteborg, Germany, http://www.bayer.com) in their drinking water for 2 weeks after irradiation and after transplantation.

Cell Suspensions, Fluorescence-Activated Cell Sorting Antibodies, Analysis, and Cell Sorting
Recipient cells were obtained from either peripheral blood or BM and red blood cells were lysed with ammonium chloride (Stem Cell Technologies). In some experiments, marrow samples were enriched for c-kit+ cells using positive magnetic selection (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com). Alternatively, BM samples were lineage-depleted using a lineage panel of unconjugated antibodies directed against B220, Ter119, Gr-1, CD8, CD4, and CD5 (BD Pharmingen, San Diego, http://www.bdbiosciences.com/pharmingen), followed by magnetic bead depletion (Dynal Biotech, Carlsbad, CA http://www.invitrogen.com/dynal). Residual lin+ cells were identified with anti-rat-conjugated antibodies (Caltag Laboratories, Burlingame, CA, http://www.caltag.com). Plasma for platelets was obtained by spinning heparinized blood samples at 2,000 rpm for 4 minutes, followed by sampling from the resulting upper phase. The following fluorochrome or biotin-conjugated antibodies were used: B220, CD3, Mac, Sca-1, c-kit, CD71, Ter119, Ly5.1, and Ly5.2. Biotin-conjugated antibodies were recognized with fluorochrome-tagged streptavidin (BD Pharmingen). The CD150 antibody was purchased from Biolegend (San Diego, http://www.biolegend.com), and the endoglin antibody was purchased from either Santa Cruz Biotechnology Inc. (SC18893; Santa Cruz, CA, http://www.scbt.com) or eBiosciences (Nordic Biosite, Täby, Sweden, http://www.biosite.se). Cell surface staining, collection, and analysis were performed on a FACSCalibur machine, whereas experiments requiring sorting were performed on either the FACSDiva or FACSAria (all machines from BD Biosciences, San Diego, http://www.bdbiosciences.com). Analysis was performed using FlowJo software (Tree Star, Ashland, OR, http://www.treestar.com).

Statistical Analysis
Statistics were determined using Student's t test or a paired Student's t test, and p values <0.05 were considered significant.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Endoglin Expression Is High in Primitive Murine Hematopoietic Populations
Endoglin has been defined as a marker present on murine long-term repopulating stem cells [1, 4], but the level of expression in various BM populations has not previously been reported. By sorting several different cell populations from murine marrow and subsequently analyzing expression by quantitative real-time PCR (Q-RT-PCR), we found that endoglin was expressed at the highest level in the lin Sca-1+c-kit+CD34 (LSKCD34) compartment (Fig. 1A), a population highly enriched for long-term repopulating stem cell activity [26]. The examination of more differentiated cell populations, including the short-term repopulating LSKCD34+ compartment [26, 27], progenitor-enriched lin-Sca-1+ cells, and cells committed to myeloid (Mac-1+Gr-1+), B-lineage (B220+), and erythroid (Ter119+) lineages, demonstrated various levels of endoglin expression that were consistently reduced compared with that seen in the most primitive compartment (Fig. 1A). Furthermore, we discovered that 5-FU treatment, a cytostatic agent that selectively targets cycling progenitors, thereby selectively enriching for rarely cycling primitive cells [28, 29], resulted in high percentages of endoglin+ cells assessed by fluorescence-activated cell sorting (FACS) (Fig. 1B). Taken together and in agreement with previous data, these results show that endoglin expression is selectively high in long-term repopulating stem cells. Furthermore, a severe hematopoietic stress, such as that induced here by 5-FU, leads to a strong increase of cells with high endoglin cell surface expression.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Figure 1. Endoglin is highly expressed in primitive murine bone marrow (BM) populations. (A): Murine BM cells were stained and sorted on the basis of cell surface phenotype for quantitative real-time polymerase chain reaction analysis. Values are expressed relative to hypoxanthine guanine phosphoribosyl transferase expression in each population. (B): Percentage of endoglin expression assessed by fluorescence-activated cell sorting in whole BM cells evaluated before 5-FU treatment (day 0) and at the indicated time points after treatment ± SEM. Abbreviation: 5-FU, 5-fluorouracil; HPRT, hypoxanthine guanine phosphoribosyl transferase.

 
Endoglin Expression Can Be Modulated Using Viral Vectors
To alter endoglin levels in primary hematopoietic cells, we used both lentiviral and retroviral transduction of 5-FU-treated BM cells (Fig. 2A). To knock down endoglin expression, cells were transduced with a lentivirus driving the expression of a specifically designed shRNA against endoglin (endoglin, knockdown) or a control virus containing a scrambled shRNA (scrambled, knockdown) that does not recognize any target in the mouse genome (Fig. 2B; described in Materials and Methods). The shRNA targets base pairs 1,680–1,689 in the mRNA sequence and should thus knock down the two reported isoforms of endoglin [30]. Three days post-transduction, a reduction in surface endoglin could be seen in GFP+ endoglin KD cells (Fig. 2C, right plot). This time point was deemed sufficient to evaluate the degree of reduction, as cell surface levels did not decrease further when evaluated up to 6 days post-transduction (data not shown). The percentage of GFP+ endoglin+ cells was typically 20%–30% of that seen in scrambled KD cells, but notably, the majority of endoglin KD GFP+ cells were negative for surface expression, whereas cells that were "positive" expressed very low levels. Correspondingly, Q-RT-PCR analysis of RNA from GFP+ sorted cells demonstrated endoglin expression levels that averaged 20% of scrambled levels (Fig. 2D). We therefore estimated that we could achieve approximately 80% knockdown of endoglin expression using our shRNA strategy.


Figure 2
View larger version (37K):
[in this window]
[in a new window]

 
Figure 2. Endoglin levels can be modulated using viral transduction approaches. (A): An outline of the viral transduction procedures used in this study. (B): The lentiviral vector pLV-TH used in this study to drive expression of endoglin or scrambled shRNA is schematically depicted. H1 and EF-1a are promoter sequences. (C): Suppressed cell surface expression of endoglin measured by fluorescence-activated cell sorting 72 hours post-transduction in endoglin KD cells (right) compared with scrambled KD cells (left). (D): Quantitative real-time polymerase chain reaction (Q-RT-PCR) analysis of endoglin mRNA on sorted GFP+ cells 72 hours post-transduction expressed relative to HPRT (n = 3, ± SEM). (E): Schematic depiction of the retroviral vectors used herein to either control transduce (MIG) or overexpress endoglin (MIG endoglin). (F): Western analysis of endoglin protein (95-kDa monomer) in whole cell lysates of MIG- and MIG endoglin-transduced primary cells. (G): Q-RT-PCR of endoglin mRNA on sorted GFP+ cells 48 hours post-transduction expressed relative to HPRT (n = 3, ± SEM). Abbreviations: 5-FU, 5-fluorouracil; cPPT, central polypurine tract; GFP, green fluorescent protein; HPRT, hypoxanthine guanine phosphoribosyl transferase; IRES, intraribosomal entry site; LTR, long terminal repeat; shRNA, short hairpin RNA; SIN, self-inactivating long-terminal repeat sequence; WPRE, woodchuck response element.

 
To overexpress endoglin, we transduced cells using an MSCV-based control vector and a vector containing the murine cDNA for endoglin (MIG and MIG endoglin; Fig. 2E). The cDNA used in these experiments corresponds to murine L-endoglin, a full-length splice variant that is predominantly expressed in mouse tissues [30]. Sustained high levels of endoglin protein were evident by Western analysis of lysates from MIG endoglin cells expanded in culture for 8 days post-transduction, whereas endogenous levels dropped below detectable levels in differentiating MIG cells (Fig. 2F). Furthermore, Q-RT-PCR analysis of MIG endoglin GFP+ cells assessed 48 hours post-transduction revealed an average 70-fold increase of endoglin RNA levels compared with MIG-transduced cells (Fig. 2G). Fourteen days post-transduction, at a point where MIG cells have lost endoglin surface expression in culture, FACS analysis revealed that MIG endoglin GFP+ cells had a mean fluorescent activity of endoglin expression twofold higher than that observed for control transduced cells (data not shown). Taken together, these data established the feasibility of our approach to alter endoglin expression in transduced hematopoietic cells.

Endoglin Influences TGF-β Sensitivity of Myeloid Progenitors
The functional role for endoglin in adult murine hematopoietic cells is uncharacterized. However, roles for endoglin as a regulator of proliferation in endothelial cells have been reported [8, 10]. To evaluate whether endoglin suppression or overexpression influenced proliferation in primary hematopoietic progenitor cells, we used in vitro proliferation and clonogenic assays. 5-FU-enriched cells were transduced with the vectors described above and GFP + cells were sorted and plated at 1 x 105 cells per milliliter in serum-free liquid culture using the same LV or RV cytokines used during transduction (described in Materials and Methods). Expansion was measured every 3 days, followed by replating to the original cell density. Twelve days of expansion culture revealed no significant differences between the proliferative capacity of scrambled and endoglin KD cells or between MIG- and MIG endoglin-transduced cells (Fig. 3A, 3B). Similarly, when GFP+ cells were plated into methylcellulose supporting myeloid colony growth, the clonogenic capacities of endoglin KD cells and endoglin-overexpressing cells were unchanged compared with those of their respective controls (Fig. 3C, 3D). To investigate whether modulated endoglin expression was able to affect the suppressive effects of TGF-β, as has been observed in other cell types [31, 32], we evaluated the effect of TGF-β on the clonogenic capacity of myeloid progenitors [33, 34]. In these experiments, the addition of TGF-β to the cultures revealed significantly increased growth suppression of endoglin KD cells compared with that of scrambled KD cells (Fig. 3E; p = .027 at 1 ng/ml TGF-β; p = .038 at 10 ng/ml). Conversely, endoglin-overexpressing cells demonstrated reduced TGF-β growth suppression compared with MIG-transduced cells (Fig. 3F; p = .026 at 1 ng/ml; p = .041 at 10 ng/ml). Collectively, these results reveal that altering endoglin expression has no effect on the proliferation of early hematopoietic progenitors, but it establishes a role for endoglin in modulating the in vitro inhibitory effects of TGF-β on such cells.


Figure 3
View larger version (30K):
[in this window]
[in a new window]

 
Figure 3. Endoglin expression modulates TGF-β inhibition of myeloid progenitors. (A): GFP+ cells were sorted after transduction with endoglin KD or scrambled KD vectors and were plated in serum-free medium with LV cytokines (described in Materials and Methods). Cells were counted and replated every 3 days. Data are pooled from three independent experiments, expressed as fold increase over input number ± SEM. (B): GFP+ MIG or MIG endoglin cells were assayed for proliferative capacity using serum-free medium and RV cytokines (described in Materials and Methods) as in (A). Data are pooled from three independent experiments ± SEM. (C, D): GFP+ cells were sorted and plated in methylcellulose, supporting the growth of myeloid colonies. (E, F): Colony growth of cells in the presence of TGF-β, expressed as percentage of growth in the absence of TGF-β. *, p < .05, Student's paired t test; n = 3–4 independent transductions and platings ± SEM. Abbreviation: TGF, transforming growth factor.

 
Endoglin Expression Is Not Critical for HSC Engraftment and Reconstitution
Given that endoglin is a marker for long-term reconstituting stem cells and that its expression is selectively high in primitive cells (Fig. 1A), we used in vivo transplantation assays to investigate the effects of modulated endoglin levels on the function of early stem and progenitor cells. Transduced donor cells can be monitored in these assays using GFP expression together with the Ly5.1 surface marker, which differs from that found on support or endogenous cells (either Ly5.2 + or doubly positive for both Ly5.1/5.2). In the first series of experiments, Ly5.1+ cells were infected with either MIG control, MIG endoglin, scrambled control, or endoglin KD vectors, and 1 x 105 unsorted cells were transplanted directly into lethally irradiated Ly5.1+/5.2+ recipients. Fresh, unfractionated Ly5.1+/5.2+ BM support cells (2 x 105) were coinjected together with the test cells to ensure survival of transplanted hosts. After transplantation, the GFP within the donor population was monitored in the peripheral blood for 16 weeks, to assess any advantage or disadvantage compared with untransduced cells in long-term reconstitution. Cells with decreased endoglin expression behaved similarly to the scrambled transduced cells, showing no significant expansion or decrease over time (Fig. 4A). Likewise, MIG endoglin-transduced cells performed similarly to MIG transduced cells, also showing no significant advantage or disadvantage compared with the untransduced cells (Fig. 4B). To maximize the donor contribution, and hence the GFP contribution to the overall stem cell compartment, additional transplantations were performed into sublethally irradiated Ly5.2+ c-kitW41/W41 recipients without the inclusion of support cells. The results of monitoring GFP in the peripheral blood of these recipients were consistent with our results from the prior transplantations in that neither endoglin suppression (Fig. 4C) nor endoglin overexpression (Fig. 4D) altered the reconstitution potential of manipulated test cells. Given the lack of phenotype, it was important to confirm that our approaches were sustained in vivo; hence, we evaluated endoglin expression at the cell surface of GFP+ cells in recipient peripheral blood using an endoglin-specific antibody and FACS. Indeed, we could verify that endoglin KD cells were efficiently reduced in their surface endoglin expression compared with scrambled KD cells (Fig. 4E), whereas MIG endoglin-transduced cells demonstrated increased endoglin intensity at the surface (Fig. 4F). We also examined the BM of recipients 12–13 weeks post-transplant for GFP contribution to a primitive stem cell compartment, defined as lineage, c-kit+, Sca-1+, CD150+ (LSKCD150+) [3]. There was no significant difference (p = .31) in GFP contribution by endoglin-suppressed cells compared with scrambled cells (Fig. 4G). Likewise, the GFP contribution to the LSKCD150+ compartment was very similar between recipients receiving MIG- or MIG endoglin-transduced cells (Fig. 4H; p = .91). Thus, we conclude that alteration of endoglin expression has no effect on the engraftment and reconstitution potential of HSC in a transplantation setting.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
Figure 4. Endoglin does not regulate the engraftment and reconstituting potential of hematopoietic stem cells. (A): Expression of GFP in the peripheral blood of recipients of scrambled KD or endoglin KD cells in the presence of support cells. The data are pooled from two independent transplantations, seven or eight recipients per group, and are expressed as percentage of GFP in the donor population, normalized to the initial transduction efficiency. (B): Expression of GFP in the peripheral blood of recipients of MIG and MIG endoglin cells, expressed as in (A). The data are pooled from three independent transplantations, 8–10 recipients per group. (C): GFP in the peripheral blood of recipients of scrambled or endoglin KD cells without support cells. The data are pooled from two separate transplantations, six recipients per group. (D): GFP in the peripheral blood of recipients of MIG or MIG endoglin cells without support cells. The data are pooled from two separate transplantations, six recipients per group. (E, F): Surface expression of endoglin on transduced GFP+ cells in peripheral blood from recipients of scrambled KD or endoglin KD 24 weeks post-transplant (n = 4–5 recipients per group; p = .033) (E) and recipients of MIG and MIG endoglin 34 weeks post-transplant (n = 5 recipients per group; p = .042) (F). (G): GFP+ contribution to the primitive LSKCD150+ population in recipients of scrambled KD and endoglin KD cells (n = 6; p = .31) and in (H) recipients of MIG- and MIG endoglin-transduced cells (n = 3; p = .91). In all cases, error bars represent ± SEM. Abbreviations: GFP, green fluorescent protein; PB, peripheral blood; TE, transduction efficiency.

 
Alteration of Endoglin Levels Leaves Platelet and White Blood Cell Lineage Proportions Intact
Platelets represent a lineage with a very rapid turnover rate (approximately 6 days [35]), in contrast to circulating lymphoid cells, which can be very long-lived [36]. The persistence of GFP + platelets 12–16 weeks after transplantation thus provides a relevant indicator of ongoing GFP+ progenitor/stem cell activity. To investigate the contribution of our transduced cell populations to this lineage, platelets were isolated from mouse plasma and were stained for the signaling lymphocyte-activating molecule receptor CD150 [37]. We determined that the GFP contribution to CD150+ platelets was very similar between scrambled and endoglin KD recipients and also between MIG and MIG endoglin recipients 12–13 weeks post-transplant (Fig. 5A). This analysis indicates the lack of a critical role for endoglin in the formation of platelets and is consistent with the normal contributions at the primitive progenitor/stem cell level (Fig. 4).


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
Figure 5. Endoglin does not influence platelet formation or white blood cell lineage choice. (A): Representative fluorescence-activated cell sorting plots of the GFP contribution to CD150+ platelets are shown. (B): Proportions of B220+, CD3+, and Mac-1+ cells within the GFP+ compartment of the peripheral blood in mice transplanted with scrambled or endoglin KD cells. (C): Lineage analysis as in (B) performed on recipients of MIG and MIG endoglin cells. n = 13–16 total recipients per group ± SEM. Abbreviation: GFP, green fluorescent protein.

 
Previous studies using in vitro hematopoietic differentiation of endoglin-deficient murine ES cells revealed normal differentiation capacity toward the lymphoid lineage but impaired differentiation toward myeloid and erythroid lineages [19]. In addition to its expression on long-term reconstituting stem cells, endoglin is also detected on peripheral white blood cells of C57Bl/6 mice. Analysis of the 2%–5% of cells staining high for endoglin expression in normal mouse peripheral blood (depleted of red cells) revealed that approximately 53% of these cells are B220+, 14% are CD3+, and 30% are Mac-1+ (data not shown). The above-described transplantation experiments allowed us to address the effects of suppression or overexpression of endoglin on lineage choice toward these populations. Analysis of B220+ B cells, CD3+ T cells, and Mac-1+ macrophages revealed normal proportions of each of these lineages within the GFP+ peripheral blood population in recipients of endoglin KD cells 12–16 weeks post-transplant (Fig. 5B). Similarly, normal proportions were found in the GFP+ population in recipients of endoglin-overexpressing cells (Fig. 5C). Together, these results suggest that endoglin does not influence white blood cell lineage choice in the adult transplantation setting.

Endoglin Negatively Regulates Blast-Forming Unit-Erythroid Formation and Erythroid Differentiation
To investigate whether the previously inferred effects on erythroid differentiation could be recapitulated in the adult murine setting using our approach, we evaluated erythroid development using both in vitro clonogenic assays and FACS profiling of immature erythrocytes. To obtain cells for clonogenic assays, sublethally irradiated (800 cGy) mice were transplanted with transduced cells without support cells to maximize donor reconstitution. BM was harvested 5–6 weeks post-transplantation and was sorted as GFP +, lin, c-kit+, Sca-1+, CD150+. This population is enriched for Mk and blast-forming unit-erythroid (BFU-e) progenitors and is relatively free of granulocyte and macrophage progenitors (D. Bryder, manuscript submitted for publication). Mk colonies counted after 7–8 days were similar in frequency between MIG and MIG endoglin and between scrambled KD and endoglin KD cultures (Fig. 6A, 6B). However, endoglin KD cells yielded a frequency of BFU-e colonies that was more than twofold greater than that of scrambled KD cells (Fig. 6A; p = .004). In cultures where endoglin was overexpressed, the frequency of BFU-e was comparable to that of MIG-transduced cells (Fig. 6B). These results suggest that the presence of endoglin on the surface of early erythroid progenitors is necessary to regulate the proliferative potential of these cells.


Figure 6
View larger version (59K):
[in this window]
[in a new window]

 
Figure 6. Endoglin regulates erythroid development at various stages. (A): Sorted GFP+ lin c-kit+, Sca-1+ CD150+ cells from scrambled KD and endoglin KD recipients were seeded into methylcellulose cultures and Mk and BFU-e colonies were scored macroscopically after 7–8 days. (B): Colony growth as in (A) using GFP+ lin c-kit+, Sca-1+ CD150+ cells from recipients of MIG- and MIG endoglin-transduced cells. (C): Representative plots of erythroid development measured by fluorescence-activated cell sorting demonstrating the proportion of CD71+Ter119+ cells within the GFP+ population of endoglin KD recipients (right) relative to that seen in scrambled KD recipients (left). (D): Pooled data from six recipients per group are shown. (E): Representative plots from recipients of MIG (left) or MIG endoglin (right) revealing a significantly deceased proportion of CD71+Ter119+ basophilic erythroblasts. (F): Pooled data from six recipients per group are shown. *, p < .05. In all cases, error bars represent ± SEM. Abbreviations: BFU-e, blast-forming unit-erythroid; GFP, green fluorescent protein; Mk, megakaryocyte.

 
To investigate later stage erythroid maturation, we examined transduced BM cells from recipients using markers for CD71 and Ter119 [38]. Gating on the GFP+ population, we assessed the relative proportions of cells corresponding to the proerythroblast (CD71hi, Ter119lo) and basophilic proerythroblast (CD71hi, Ter119hi) populations. Recipients of endoglin KD cells demonstrated no significant decrease in the proportions of CD71hi, Ter119hi population compared with scrambled KD-transduced cells (Fig. 6C, 6D; p = .14). Intriguingly, analysis of the GFP compartment in recipients of MIG endoglin cells revealed a more dramatic decrease at the basophilic erythroblast stage compared with MIG cells (Fig. 6E, 6F; p = .003). This effect was not accompanied by an increase at the CD71hi, Ter119lo proerythroblast stage and was not associated with altered red blood cell counts in the recipients (red blood cell [RBC] counts: MIG, 7.28 ± 0.37 x 1012 cells per liter, vs. MIG endoglin, 7.54 ± 0.33 x 1012 cells per liter; p = .52; n = 6 per group). Thus, our data suggest that whereas endoglin negatively regulates early erythroid proliferation at the BFU-e stage, the persistence of endoglin at the basophilic erythroblast stage negatively impacts erythroid differentiation.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Using a two-pronged approach to define the role of endoglin in adult HSC, we report data that are consistent with endoglin's described role in modulating TGF-β responses and with its predicted importance in erythroid differentiation together with novel data indicating a noncritical role for endoglin in HSC function. The overexpression of genes using viral vectors has been widely used with these types of assays for the purpose of evaluating gene function at the stem cell level [22, 3941]. Our use here of virally expressed shRNA is novel. Our knockdown strategy resulted in a population in which GFPhi cells are virtually negative for endoglin expression, whereas GFPlo cells express low intensity surface endoglin expression. The heterogeneity of GFP and endoglin expression in our transduced cells was likely due to copy number and integration site variances between clones. Our transduced population also appeared to be functionally uniform, as endoglinlo cells read out in methylcellulose with the same type, number, and size of colony-forming units-granulocyte macrophage colonies as endoglinnegative cells, suggesting that suppression was not specific to a subpopulation (J.L. Moody, unpublished observations). Furthermore, protein suppression was sustained long-term throughout in vivo transplantation, thereby demonstrating that an shRNA strategy can efficiently suppress gene expression in studies of murine HSC.

Endoglin is one of a number of genes expressed by endothelial cells that have been recently described as defining markers for HSC [1, 42, 43]. The expression of these molecules in endothelial and hematopoietic cells is intriguing given their intertwined origin [44]; however, the lack of functionally defined roles for these molecules in HSC has precluded an understanding of the degree of novel versus congruent function between these cell types. In endothelial cells, endoglin is pivotal in maintaining a balance between activation and quiescence, shifting signals that promote TGF-β mediated stimulatory effects through the TGF-βRII/Alk1 complex with inhibitory signals transduced by TGF-βRII/Alk5 complex [810]. Likewise, proliferation and quiescence must be carefully balanced in HSC. However, Q-RT-PCR on purified LSKCD34 cells did not reveal detectable levels of Alk1 [25], suggesting that an analogous function for endoglin involving Alk1 in HSC was unlikely. Accordingly, our results indicated that modulating endoglin expression had no impact on the proliferative response of HSC, assessed in vivo by their reconstituting ability. This suggests that normal endoglin expression levels are not critical for HSC function since HSC with very low levels of endoglin function normally in terms of engraftment and proliferation in vivo. Furthermore, endoglin did not positively or negatively affect progenitor proliferation in vitro, assessed in proliferation assays and by their clonogenic capacity in methylcellulose. However, the addition of exogenous TGF-β to the cultures revealed that endoglin did afford a degree of protection from the in vitro inhibitory effects of this cytokine, similar to what has been described previously in endothelial cells and a monocytic cell line [31, 32]. Notably, whereas purified HSC did not express detectable levels of Alk1, colonies isolated from methylcellulose did express low levels of mRNA for this alternate type I receptor (J.L. Moody, unpublished observations), suggesting that alternate TGF-β receptor complexes may factor in the proliferative responses of differentiated progeny of HSC.

In another vein of possible common functions, endoglin expression in endothelial cells is regulated in part by hypoxia [45] and has been implicated in the protection from hypoxia-induced apoptosis [46]. Interestingly, HSC localize to the endosteal bone surface in the marrow, an area that is thought to be hypoxic [47]. It was therefore a possibility that endoglin's role may include protecting the HSC from factors in the niche. However, the sustained engraftment levels of HSC seen in our experiments suggest that endoglin suppression did not confer a disadvantage for cells in their native environment, nor did overexpression of endoglin afford any advantage to these cells. The apparent normal homing and engraftment of endoglin altered HSC post-transplantation is also suggestive that endoglin's reported ability to alter the cytoskeleton and migration capacity of adherent cells does not appreciably extend to HSC [48, 49].

It is curious that altering expression of a marker that is relatively definitive for long-term repopulating stem cells did not alter any of the measured functions of transplanted HSC. Endoglin is thought to modulate signaling initiated by TGF-βs, bone morphogenetic proteins, and activins through interactions with their respective receptor pairs. Of these, the TGF-β pathway is the most thoroughly characterized, especially with respect to its negative regulation of murine HSC function in vitro (reviewed in [5, 6]). However, in vivo, its role is apparently less critical to HSC function. Deletion of the TGF-β type I receptor Alk5, designed to render cells insensitive to TGF-β, did not detectably alter stem cell reconstitution kinetics or differentiation capacity [50]. There remains a question of whether these findings [50] and our results indicate a lack of importance for TGF-β and endoglin signaling in in vivo stem cell regulation or whether compensatory mechanisms resulting from the considerable redundancy within the TGF-β superfamily are at work.

Several lines of evidence have suggested a potential role for endoglin in hematopoiesis and in particular erythropoiesis. A study of endoglin function using conventional eng–/– mice demonstrated anemia in some embryos [18], a defect akin to those seen in embryos deficient for various other TGF-β superfamily receptors and Smads [5153]. However, the vascular abnormalities described can cause this phenotype independent of intrinsic hematopoietic defects [51], and the progenitor potential from eng–/– yolk sacs was not evaluated. Furthermore, two independently generated eng–/– models documented similar vascular phenotypes yet observed yolk sac erythrocytes, suggesting that primitive hematopoiesis was intact in the absence of endoglin [16, 17]. Another study using hematopoietic differentiation of eng–/– ES cells suggested that complete deficiency of endoglin allowed progression to the Flk1+ stage, representative of definitive hematopoiesis, but compromised differentiation 5–8-fold toward the myeloid lineage and 16-fold toward the erythroid lineage [19]. The latter observation was of interest as endoglin expression had been described previously on various human erythroid populations [11]. Furthermore, endoglin is found on primitive murine erythroid progenitors and is downregulated as cells progress from basophilic erythroblasts to polychromatophilic erythroblasts (D. Bryder, unpublished observations). Our results suggest that endoglin does not play a critical role in the differentiation of adult stem cells toward the myeloid lineage. However, our results using a single shRNA construct do suggest that endoglin may play a role in negatively regulating the proliferation of primitive BFU-e progenitors. The observed expansion resulting from suppressing endoglin expression was not mirrored in vivo by detectable increases in the proportion of GFP+ cells in the later stages of erythroid maturation assessed by FACS (data not shown). As such, the expansion may be a reflection of increased cytokine sensitivity or survival of the BFU-e progenitors in vitro. Furthermore, our data reveal that differentiation through the basophilic erythroblast stage is negatively impacted by overexpression of endoglin, suggesting a critical role for its downregulation in progression throughout this stage of maturation. The lack of altered RBC counts in recipients of these cells is likely due to compensation by either untransduced and/or the 5%–10% of endogenous cells present with the experimental strategies used here. Furthermore, our system does not allow us to track transduced cells past this stage, as vector-driven GFP becomes undetectable in later erythroid progeny (J. Moody and D. Bryder, unpublished observations).

Endoglin was previously shown to be coexpressed with Flk1 at an early stage of hematopoietic commitment in vitro, and interestingly, deletion of endoglin did not compromise the progression of ES cell differentiation to the Flk1+ stage [19]. Instead, eng–/– cells in that study were significantly impaired in their myelo-erythroid differentiation capacity. Our in vivo results reveal a robustness of adult HSC function to altered endoglin expression as measured by reconstitution in a transplantation setting. Furthermore, myeloid differentiation in the adult setting is sound in the presence of altered endoglin levels, whereas adult erythroid differentiation appears to be dependent on orchestrated endoglin expression and downregulation at distinct stages.


    DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
We express our appreciation to Kees-Jan Pronk for technical assistance, to Anna Fossum and Zhi Ma for expert cell sorting, to Eva Gynnstam for animal husbandry, and to Jonas Larsson for early ideas and valuable discussions. This work was supported by grants from Åke Wibergs Stiftelse (to J.L.M.), the Swedish Cancer Society, the European Commission (INHERINET and CONSERT), the Swedish Gene Therapy Program, the Swedish Medical Research Council, the Swedish Children Cancer Foundation, a Clinical Research Award from Lund University Hospital, the Joint Program on Stem Cell Research supported by the Juvenile Diabetes Research Foundation, and the Swedish Medical Research Council. The Lund Stem Cell Center is supported by a Center of Excellence grant in life sciences from the Swedish Foundation for Strategic Research (all to S.K.). J.L.M. was supported by a fellowship from the Canadian Institute for Health Research and the Swedish Children's Cancer Foundation.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 

  1. Chen CZ, Li M, de Graaf D et al. Identification of endoglin as a functional marker that defines long-term repopulating hematopoietic stem cells. Proc Natl Acad Sci U S A 2002;99:15468–15473.[Abstract/Free Full Text]

  2. Ivanova NB, Dimos JT, Schaniel C et al. A stem cell molecular signature. Science 2002;298:601–604.[Abstract/Free Full Text]

  3. Kiel MJ, Yilmaz OH, Iwashita T et al. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 2005;121:1109–1121.[CrossRef][Medline]

  4. Chen CZ, Li L, Li M et al. The endoglin(positive) sca-1(positive) rhodamine(low) phenotype defines a near-homogeneous population of long-term repopulating hematopoietic stem cells. Immunity 2003;19:525–533.[CrossRef][Medline]

  5. Larsson J, Karlsson S. The role of Smad signaling in hematopoiesis. Oncogene 2005;24:5676–5692.[CrossRef][Medline]

  6. Ruscetti FW, Akel S, Bartelmez SH. Autocrine transforming growth factor-beta regulation of hematopoiesis: Many outcomes that depend on the context. Oncogene 2005;24:5751–5763.[CrossRef][Medline]

  7. Fonsatti E, Del Vecchio L, Altomonte M et al. Endoglin: An accessory component of the TGF-beta-binding receptor-complex with diagnostic, prognostic, and bioimmunotherapeutic potential in human malignancies. J Cell Physiol 2001;188:1–7.[CrossRef][Medline]

  8. Lebrin F, Goumans MJ, Jonker L et al. Endoglin promotes endothelial cell proliferation and TGF-beta/ALK1 signal transduction. EMBO J 2004;23:4018–4028.[CrossRef][Medline]

  9. Blanco FJ, Santibanez JF, Guerrero-Esteo M et al. Interaction and functional interplay between endoglin and ALK-1, two components of the endothelial transforming growth factor-beta receptor complex. J Cell Physiol 2005;204:574–584.[CrossRef][Medline]

  10. Pece-Barbara N, Vera S, Kathirkamathamby K et al. Endoglin null endothelial cells proliferate faster and are more responsive to transforming growth factor beta1 with higher affinity receptors and an activated Alk1 pathway. J Biol Chem 2005;280:27800–27808.[Abstract/Free Full Text]

  11. Rokhlin OW, Cohen MB, Kubagawa H et al. Differential expression of endoglin on fetal and adult hematopoietic cells in human bone marrow. J Immunol 1995;154:4456–4465.[Abstract]

  12. Buhring HJ, Muller CA, Letarte M et al. Endoglin is expressed on a subpopulation of immature erythroid cells of normal human bone marrow. Leukemia 1991;5:841–847.[Medline]

  13. Pierelli L, Scambia G, Bonanno G et al. CD34+/CD105+ cells are enriched in primitive circulating progenitors residing in the G0 phase of the cell cycle and contain all bone marrow and cord blood CD34+/CD38low/- precursors. Br J Haematol 2000;108:610–620.[CrossRef][Medline]

  14. Lastres P, Bellon T, Cabanas C et al. Regulated expression on human macrophages of endoglin, an Arg-Gly-Asp-containing surface antigen. Eur J Immunol 1992;22:393–397.[Medline]

  15. Schmidt-Weber CB, Letarte M, Kunzmann S et al. TGF-beta signaling of human T cells is modulated by the ancillary TGF-beta receptor endoglin. Int Immunol 2005;17:921–930.[Abstract/Free Full Text]

  16. Li DY, Sorensen LK, Brooke BS et al. Defective angiogenesis in mice lacking endoglin. Science 1999;284:1534–1537.[Abstract/Free Full Text]

  17. Bourdeau A, Dumont DJ, Letarte M. A murine model of hereditary hemorrhagic telangiectasia. J Clin Invest 1999;104:1343–1351.[Medline]

  18. Arthur HM, Ure J, Smith AJ et al. Endoglin, an ancillary TGFbeta receptor, is required for extraembryonic angiogenesis and plays a key role in heart development. Dev Biol 2000;217:42–53.[CrossRef][Medline]

  19. Cho SK, Bourdeau A, Letarte M et al. Expression and function of CD105 during the onset of hematopoiesis from Flk1(+) precursors. Blood 2001;98:3635–3642.[Abstract/Free Full Text]

  20. Wiznerowicz M, Trono D. Conditional suppression of cellular genes: Lentivirus vector-mediated drug-inducible RNA interference. J Virol 2003;77:8957–8961.[Abstract/Free Full Text]

  21. Hawley RG, Lieu FH, Fong AZ et al. Versatile retroviral vectors for potential use in gene therapy. Gene Ther 1994;1:136–138.[Medline]

  22. Antonchuk J, Sauvageau G, Humphries RK. HOXB4 overexpression mediates very rapid stem cell regeneration and competitive hematopoietic repopulation. Exp Hematol 2001;29:1125–1134.[CrossRef][Medline]

  23. Flygare J, Kiefer T, Miyake K et al. Deficiency of ribosomal protein S19 in CD34+ cells generated by siRNA blocks erythroid development and mimics defects seen in Diamond-Blackfan anemia. Blood 2005;105:4627–4634.[Abstract/Free Full Text]

  24. Miyake N, Brun AC, Magnusson M et al. HOXB4-induced self-renewal of hematopoietic stem cells is significantly enhanced by p21 deficiency. STEM CELLS 2006;24:653–661.[Abstract/Free Full Text]

  25. Utsugisawa T, Moody JL, Aspling M et al. A road map toward defining the role of Smad signaling in hematopoietic stem cells. STEM CELLS 2006;24:1128–1136.[Abstract/Free Full Text]

  26. Osawa M, Hanada K, Hamada H et al. Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell. Science 1996;273:242–245.[Abstract]

  27. Yang L, Bryder D, Adolfsson J et al. Identification of Lin(-)Sca1(+)kit(+)CD34(+)Flt3- short-term hematopoietic stem cells capable of rapidly reconstituting and rescuing myeloablated transplant recipients. Blood 2005;105:2717–2723.[Abstract/Free Full Text]

  28. Bradford GB, Williams B, Rossi R et al. Quiescence, cycling, and turnover in the primitive hematopoietic stem cell compartment. Exp Hematol 1997;25:445–453.[Medline]

  29. Wright DE, Cheshier SH, Wagers AJ et al. Cyclophosphamide/granulocyte colony-stimulating factor causes selective mobilization of bone marrow hematopoietic stem cells into the blood after M phase of the cell cycle. Blood 2001;97:2278–2285.[Abstract/Free Full Text]

  30. Perez-Gomez E, Eleno N, Lopez-Novoa JM et al. Characterization of murine S-endoglin isoform and its effects on tumor development. Oncogene 2005;24:4450–4461.[CrossRef][Medline]

  31. Lastres P, Letamendia A, Zhang H et al. Endoglin modulates cellular responses to TGF-beta 1. J Cell Biol 1996;133:1109–1121.[Abstract/Free Full Text]

  32. Li C, Hampson IN, Hampson L et al. CD105 antagonizes the inhibitory signaling of transforming growth factor beta1 on human vascular endothelial cells. FASEB J 2000;14:55–64.[Abstract/Free Full Text]

  33. Ploemacher RE, van Soest PL, Boudewijn A. Autocrine transforming growth factor beta 1 blocks colony formation and progenitor cell generation by hemopoietic stem cells stimulated with steel factor. STEM CELLS 1993;11:336–347.[Abstract]

  34. Keller JR, Mantel C, Sing GK et al. Transforming growth factor beta 1 selectively regulates early murine hematopoietic progenitors and inhibits the growth of IL-3-dependent myeloid leukemia cell lines. J Exp Med 1988;168:737–750.[Abstract/Free Full Text]

  35. Manning KL, McDonald TP. C3H mice have larger spleens, lower platelet counts, and shorter platelet lifespans than C57BL mice: An animal model for the study of hypersplenism. Exp Hematol 1997;25:1019–1024.[Medline]

  36. Forster I, Rajewsky K. The bulk of the peripheral B-cell pool in mice is stable and not rapidly renewed from the bone marrow. Proc Natl Acad Sci U S A 1990;87:4781–4784.[Abstract/Free Full Text]

  37. Nanda N, Andre P, Bao M et al. Platelet aggregation induces platelet aggregate stability via SLAM family receptor signaling. Blood 2005;106:3028–3034.[Abstract/Free Full Text]

  38. Zhang J, Socolovsky M, Gross AW et al. Role of Ras signaling in erythroid differentiation of mouse fetal liver cells: Functional analysis by a flow cytometry-based novel culture system. Blood 2003;102:3938–3946.[Abstract/Free Full Text]

  39. Blank U, Karlsson G, Moody JL et al. Smad7 promotes self-renewal of hematopoietic stem cells. Blood 2006;108:4246–4254.[Abstract/Free Full Text]

  40. Stier S, Cheng T, Dombkowski D et al. Notch1 activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid lineage outcome. Blood 2002;99:2369–2378.[Abstract/Free Full Text]

  41. Reya T, Duncan AW, Ailles L et al. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 2003;423:409–414.[CrossRef][Medline]

  42. Balazs AB, Fabian AJ, Esmon CT et al. Endothelial protein C receptor (CD201) explicitly identifies hematopoietic stem cells in murine bone marrow. Blood 2006;107:2317–2321.[Abstract/Free Full Text]

  43. Matsubara A, Iwama A, Yamazaki S et al. Endomucin, a CD34-like sialomucin, marks hematopoietic stem cells throughout development. J Exp Med 2005;202:1483–1492.[Abstract/Free Full Text]

  44. Jaffredo T, Nottingham W, Liddiard K et al. From hemangioblast to hematopoietic stem cell: An endothelial connection? Exp Hematol 2005;33:1029–1040.[CrossRef][Medline]

  45. Sanchez-Elsner T, Botella LM, Velasco B et al. Endoglin expression is regulated by transcriptional cooperation between the hypoxia and transforming growth factor-beta pathways. J Biol Chem 2002;277:43799–43808.[Abstract/Free Full Text]

  46. Li C, Issa R, Kumar P et al. CD105 prevents apoptosis in hypoxic endothelial cells. J Cell Sci 2003;116:2677–2685.[Abstract/Free Full Text]

  47. Lord BI. The architecture of bone marrow cell populations. In: Murphy MJ, ed. Concise Reviews in Clinical and Experimental Haematology.Dayton, OH: AlphaMed Press,1992;225–234.

  48. Sanz-Rodriguez F, Guerrero-Esteo M, Botella LM et al. Endoglin regulates cytoskeletal organization through binding to ZRP-1, a member of the Lim family of proteins. J Biol Chem 2004;279:32858–32868.[Abstract/Free Full Text]

  49. Conley BA, Koleva R, Smith JD et al. Endoglin controls cell migration and composition of focal adhesions: Function of the cytosolic domain. J Biol Chem 2004;279:27440–27449.[Abstract/Free Full Text]

  50. Larsson J, Blank U, Helgadottir H et al. TGF-beta signaling-deficient hematopoietic stem cells have normal self-renewal and regenerative ability in vivo despite increased proliferative capacity in vitro. Blood 2003;102:3129–3135.[Abstract/Free Full Text]

  51. Larsson J, Goumans MJ, Sjostrand LJ et al. Abnormal angiogenesis but intact hematopoietic potential in TGF-beta type I receptor-deficient mice. EMBO J 2001;20:1663–1673.[CrossRef][Medline]

  52. Chang H, Huylebroeck D, Verschueren K et al. Smad5 knockout mice die at mid-gestation due to multiple embryonic and extraembryonic defects. Development 1999;126:1631–1642.[Abstract]

  53. Oshima M, Oshima H, Taketo MM. TGF-beta receptor type II deficiency results in defects of yolk sac hematopoiesis and vasculogenesis. Dev Biol 1996;179:297–302.[CrossRef][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2006-0602v1
25/11/2809    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moody, J. L.
Right arrow Articles by Karlsson, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moody, J. L.
Right arrow Articles by Karlsson, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS