First published online August 16, 2007
Stem Cells
Vol. 25 No.
12
December 2007, pp.
2987
-2995
doi:10.1634/stemcells.2007-0397; www.StemCells.com
© 2007 AlphaMed Press
OPEN ACCESS ARTICLE
Lentiviral Rescue of Vascular Endothelial Growth Factor Receptor-2 Expression in Flk1–/– Embryonic Stem Cells Shows Early Priming of Endothelial Precursors
Xiujuan Lia,
Dan Edholma,
Fredrik Lannerb,
Georg Breierc,
Filip Farnebob,
Anna Dimberga,
Lena Claesson-Welsha
aRudbeck Laboratory, Department of Genetics and Pathology, Uppsala University, Uppsala, Sweden;
bDepartment of Cell and Molecular Biology, Karolinska Institute, Stockholm, Sweden;
cInstitute of Pathology, Technische Universität Dresden-Faculty of Medicine "Carl Gustav Carus," Dresden, Germany
Key Words. Vascular endothelial growth factor receptor-2 • Flk1 • Vascular endothelial growth factor • Stem cells • Embryoid bodies Differentiation • Endothelial cells • Angiogenesis
Correspondence: Lena Claesson-Welsh, Ph.D., Rudbeck Laboratory, Department Genetics and Pathology, Uppsala University, Dag Hammarskjöldsv. 20, 751 85 Uppsala, Sweden. Telephone: 46-18-471-4363; Fax: 46-18-55-89-31; e-mail: Lena.Welsh{at}genpat.uu.se
Received on May 22, 2007;
accepted for publication on July 31, 2007.
First published online in STEM CELLS EXPRESS August 16, 2007.
 |
ABSTRACT
|
|---|
The vascular endothelial growth factor (VEGF) family and its receptors are important for vascular development and maintenance of blood vessels, as well as for angiogenesis, the formation of new vessels. Loss of VEGF receptor-2 (VEGFR-2; designated Flk-1 in mouse) results in arrest of vascular and hematopoietic development in vivo. We used lentiviral transduction to reconstitute VEGFR-2 expression in flk1–/– embryonic stem (ES) cells. VEGF-induced vasculogenesis and sprouting angiogenesis were rescued in transduced ES cultures differentiating in vitro as EBs. Although the transgene was expressed in the pluripotent stem cells and lacked linage restriction during differentiation, the extent of endothelial recruitment was similar to that in wild-type EBs. Reconstitution of VEGFR-2 in flk1–/– ES cells allowed only precommitted precursors to differentiate into functional endothelial cells able to organize into vascular structures. Chimeric EB cultures composed of wild-type ES cells mixed with flk1–/– ES cells or reconstituted VEGFR-2-expressing ES cells were created. In the chimeric cultures, flk1–/– endothelial precursors were excluded from wild-type vessel structures, whereas reconstituted VEGFR-2-expressing precursors became integrated together with wild-type endothelial cells to form chimeric vessels. We conclude that maturation of endothelial precursors, as well as organization into vascular structures, requires expression of VEGFR-2.
Disclosure of potential conflicts of interest is found at the end of this article.
 |
INTRODUCTION
|
|---|
The vascular endothelial growth factor (VEGF) family includes five homodimeric, cysteine knot-containing factors (VEGF-A, -B, -C, and -D and placenta growth factor [PlGF]); further complexity is attained by alternative splicing. Thus, VEGF-A occurs in several different splice isoforms, of which the most abundant is VEGF-A165 (numerals indicate the number of amino acid residues in the polypeptide; i.e., 165 in the human and 164 in the mouse). The VEGF-A isoforms differ in their ability to interact with the extracellular matrix and with coreceptors (reviewed in [1]). vegfa gene inactivation leads to arrest of vascular development, resulting in death at embryonic day (E) 9.5. In fact, inactivation of only one vegfa allele leads to death of the embryo at E11.5 [2, 3]. VEGF-A165 interacts with two of the three related VEGF receptor tyrosine kinases, namely VEGF receptor-1 and -2, as well as with the coreceptors neuropilin and heparan sulfate proteoglycans. VEGF receptor-2 (VEGFR-2; also designated KDR and Flk-1 to indicate human and mouse species, respectively) is the earliest-induced specific vascular marker [4].
Mice deficient in VEGFR-2 die in utero between E8.5 and E9.5 because of defective vascular and hematopoietic development [5], similar to the phenotype of the vegfa–/– embryos. VEGFR-2 has been implicated in regulated cell migration during early development, as flk1–/– precursor cells fail to move from the posterior primitive streak to the yolk sac where they will form blood islands, and possibly also to intraembryonic sites [6]. flk1–/– embryonic stem (ES) cells are able to differentiate to express both endothelial and hematopoietic markers in vitro [7, 8]. Therefore, it was suggested that hematopoietic/endothelial progenitors may arise independently of VEGFR-2 and that an important function of VEGFR-2 during development in vivo would be to guide the migration of the mesodermal precursors.
Apart from the important contributions to vasculogenesis, VEGFR-2 is essential for sprouting angiogenesis [9]. Formation of new vessels from pre-existing capillaries during sprouting angiogenesis (which occurs, for example, in vascularization of tumors, in the developing retina, and during vascular development of zebrafish) is a multistep process, including invasion of endothelial cells through protease-digested basement membrane, proliferation, migration, and eventually formation of a new lumen [10–13]. At least in vitro, all these steps may be regulated via VEGF-A165 activation of VEGFR-2. Unraveling of individual signal transduction pathways regulating these responses has begun. Thus, replacement of tyrosine (Y)1173 (Y1175 in the human sequence) in VEGFR-2 with phenylalanine (F) results in loss of a phosphorylation site that mediates binding and activation of phospholipase C
1. Activation of this pathway is of critical importance in VEGF-A165-induced proliferation [14]. In accordance, mutant flk1 Y1173F embryos die at E9.5, displaying a phenotype mimicking that of flk1–/– embryos [15]. In addition, Y949 (Y951 in the human sequence) in the kinase insert regulates binding of the adaptor molecule T cell-specific adaptor and Src activation [16], whereas Y1212 (Y1214) regulates activation of p38MAPK [17].
In this study, we investigated the role of VEGFR-2 in recruitment and differentiation of endothelial precursors from pluripotent mouse ES cells. For this purpose, we produced lentivirus encoding mouse VEGFR-2 under the control of the human ubiquitin C (Ubc) promoter, which was used for transduction of flk1–/– ES cells. Differentiation of ES cells to EBs showed that the fraction of stem cells differentiating along the endothelial lineage was similar in wild-type and VEGFR-2-reconstituted ES cells, irrespective of the broad expression of VEGFR-2. Thus, expression of VEGFR-2 in pluripotent ES cells does not promote formation of endothelial precursors. Moreover, our data show that VEGFR-2 is required not only for migration of endothelial precursors but also for the differentiation process per se. Thus, endothelial precursors lacking expression of VEGFR-2 were recognized and excluded from participation in vessel formation when mixed with wild-type stem cells. Re-expression of VEGFR-2 in precommitted flk1–/– endothelial precursors allowed VEGF-A165-dependent expansion of the endothelial cell pool, formation of a primitive endothelial cell plexus, and angiogenic sprouting.
 |
MATERIALS AND METHODS
|
|---|
Lentivirus Vector Construct and Transduction of ES Cells
Full-length mouse flk1 cDNA (GenBank accession no. NM_010612) was inserted 3' of the Ubc promoter in the FUGIE lentivirus-backbone vector (derived from the FUGW vector, a kind gift from Dr. David Baltimore, Caltech, USA), and the integrity of the insert was verified through sequencing. The vector carries an internal ribosomal entry site (IRES) to promote translation of the downstream reporter gene enhanced green fluorescent protein (EGFP). pFUGIE-Flk1 was mixed with the packaging plasmid pCMV
R8.2 and envelope vector pVSV-G and cotransfected into 293T cells to produce a recombinant lentivirus (LvFlk1) stock. The stock was produced and titered at the Vector Unit Core facility, Lund University, Sweden (http://www.rvec.lu.se). Wild-type and flk1–/– mouse ES cells were transduced at a multiplicity of infection of 5 with LvFlk1 and incubated at 37°C, 5% CO2. After two passages, the EGFP-positive ES cells were sorted by flow cytometry using a FACSVantage SE machine with FACSDiva software (BD Biosciences, San Jose, CA, http://www.bdbiosciences.com). Transgene stability was estimated by flow sorting of ES cells or dissociated EBs and detection of EGFP expression in the viable cell population (propidium iodine-negative) on a FACSort machine using the CellQuest software (BD Biosciences).
Culture of ES Cells
R1 wild-type (WT) and flk1–/– (KO) ES cells, derived from the 129Sv strain, were kind gifts of Drs. Andras Nagy and Janet Rossant (Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, ON, Canada). ES cells were cultured on a mouse embryonic fibroblast feeder layer in ES medium composed of Dulbecco's modified Eagle's medium/GlutaMAX (Invitrogen, Rockville, MD, http://www.invitrogen.com) supplemented with 15% heat-inactivated fetal bovine serum, 25 mM HEPES, 1.2 mM sodium pyruvate, 19 µM monothioglycerol, and 1,000 U/ml recombinant leukemia inhibitory factor (LIF; Chemicon, Harrow, U.K., http://www.chemicon.com). Medium and serum were from Invitrogen. ES cells were cultured at 37°C with 5% CO2 and were passaged every second or third day.
In Vitro Differentiation of ES Cells
At day 0, ES cells were trypsinized and resuspended in ES medium without LIF to induce differentiation. Cells were aggregated in hanging drops (1,200 cells per drop) on the lid of a nonadherent culture dish to form EBs. After 4 days, EBs were seeded either in 10-cm tissue culture dishes (for immunoblotting or fluorescence-activated cell sorting [FACS]) or individually, in an eight-well chamber glass slide (two-dimensional [2D] cultures) or into a matrix of collagen I (three-dimensional [3D] cultures, described below). Tissue culture plastic was from BD Biosciences. Thereafter, EBs were maintained without LIF in the absence and presence of different concentrations of VEGF-A165 (Peprotech, Rocky Hill, NJ, http://www.peprotech.com) for time periods optimized for the different assays. All assays were reproduced multiple times, and representative data are shown.
Purification of CD31-Positive Cells by Magnetic Cell Sorting
EBs were dissociated at 37°C by incubation in 2.5 mg/ml collagenase (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) for 30 minutes, followed by incubation and careful pipetting in dissociation solution (Sigma-Aldrich) to obtain a single-cell suspension. Complete dispersion was obtained by passing cells through a 0.8-mm syringe and a 40-µm strainer. The cleared cell suspension was incubated on ice for 15 minutes with rat anti-CD31 phycoerythrin-conjugated antibody (BD Biosciences) in phosphate-buffered saline (PBS)/2 mM EDTA/0.5% bovine serum albumin (BSA), followed by mixing with goat anti-rat IgG-coated magnetic microbeads (1:5 vol/vol; Miltenyi Biotec, Auburn, CA, http://www.miltenyibiotec.com). CD31-positive cells were eluted from the beads at 4°C using mass spectrometry separation columns (Miltenyi Biotec) according to the manufacturer's instructions. CD31-positive cells and flow-through were collected for subsequent RNA extraction. The results were repeated twice for each of the two time points.
FACS Analysis
EBs were dissociated and processed into a single-cell suspension as described above. Cells were incubated with mouse vascular endothelial (VE)-cadherin antibody (R&D Systems Inc., Minneapolis, http://www.rndsystems.com) and secondary Alexa donkey anti-goat Cy5 (Molecular Probes Inc., Eugene, OR, http://probes.invitrogen.com) or were stained with rat anti-mouse CD31-phycoerythrin antibody (BD Biosciences). 4,6-Diamidino-2-phenylindole-negative viable cells were analyzed on a FACSVantage SE machine using FACSDiva software (BD Biosciences).
Real-Time Polymerase Chain Reaction Analysis
Total RNA was extracted from magnetic cell sorting (MACS)-purified cells using the RNeasy mini kit (Qiagen, Hilden, Germany, http://www.qiagen.com). Contaminating genomic DNA was digested with DNase I (Qiagen), and 1 µg of DNase-treated RNA was used for first-strand cDNA synthesis using oligo(dT) primers. Polymerase chain reaction (PCR) primers were designed using the Primer Express software (Applied Biosystems, Foster City, CA, http://www.appliedbiosystems.com), and BLAST searches were performed for each primer to ensure specificity. β-Actin was used as an endogenous reference, and non-reverse-transcribed RNA was used as a negative control. The cDNA was mixed with primers and SYBR Green PCR master mix (Applied Biosystems), and amplification (45 cycles; 95°C for 15 seconds, 60°C for 1 minute) was performed in triplicate using an ABI Prism 7700 instrument (Applied Biosystems). The calculated threshold cycle (CT) value for each transcript was normalized against the corresponding β-actin CT value. Data were collected from two individual preparations, and expression levels in the flk1–/– and lentivirus-transduced samples are given as mean ± SD fold induction compared with the level in WT-CD31+ cells (set to 1).
Primer sequences (5'-3') were as follows: Flk1 sense: TCTGTGGTTCTGCGTGGAGAC, Flk1 antisense: TTCTGTGTGCTGAGCTTGGG; CD31 sense: TACTGCAGGCATCGGCAAA, CD31 antisense: GCATTTCGCACACCTGGAT; Vecad sense: AGGACAGCAACTTCACCCTCA, Vecad antisense: AACTGCCCATACTTGACCGTG; Tie1 sense: ACTCATGTGGCAGCATCCC, Tie1 antisense: GCCACCTGAATCTCCACGAT; β-actin sense: CACTATTGGCAACGAG-CGG, β-actin antisense: TCCATACCCAAGAAGGAAGGC;
-fetoprotein sense: ACCCCTTCATGTATGCCCC,
-fetoprotein anti-sense: GCATGCCAGAACGACCTTG.
Immunoblotting and Immunoprecipitation
EBs were seeded in 10-cm tissue culture dishes on day 4 (after withdrawal of LIF), and medium was replaced every 3 days. At day 10, after acute stimulation was performed for indicated time periods with 100 ng/ml (2.6 nM) VEGF-A165, cells were lysed in 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 20% glycerol, 1% Triton X-100, 10 mM EDTA, 1 mM EGTA, 500 µM Na3VO4, 1 mM dithiothreitol, and Protease Inhibitor Cocktail (Roche Applied Science, Mannheim, Germany, http://www.roche-applied-science.com). Protein concentrations were measured with the BCA protein assay kit, protein detection kit (Pierce, Rockford, IL, http://www.piercenet.com), and samples were adjusted for equal loading. For immunoprecipitation, lysates were incubated with goat anti-mouse VEGFR-2 (R&D Systems) for 1.5 hours at 4°C, followed by incubation with Fast Flow protein G-Sepharose (Amersham Biosciences, Uppsala, Sweden, http://www.amersham.com) at 4°C for 45 minutes. Proteins were released by boiling in sample buffer (59 mM Tris-HCl [pH 6.8], 1.5% SDS, 4.35% glycerol, 4% β-mercaptoethanol, 0.0025% bromphenol blue). Immunoprecipitates or total cell lysates (100 µg of protein per lane) were subjected to SDS-polyacrylamide gel electrophoresis using 7% or 10% gels. Samples were transferred to Hybond C-Extra nitrocellulose membrane (Amersham Biosciences), which were probed with goat anti-mouse VEGFR-2 antibody (R&D Systems), mouse anti-phosphotyrosine (4G10; Upstate, Lake Placid, NY, http://www.upstate.com), goat anti-β-actin (Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com), or rabbit anti-mouse β-catenin antibody, overnight at 4°C, followed by appropriate secondary antibodies and enhanced chemiluminescence Western blotting detection reagents (Amersham Biosciences).
Immunofluorescent Staining
EBs were fixed and permeabilized in zinc-fixative (100 mM Tris-HCl containing 37 mM zinc chloride, 23 mM zinc acetate, 3.2 mM calcium acetate, and 0.2% Triton X-100) for 4 hours at room temperature, followed by blocking in Tris-buffered saline (TBS)/3% BSA/0.1% Tween 20 (blocking buffer) for 1 hour at room temperature and overnight incubation with primary antibodies diluted in blocking buffer (rat anti-mouse CD31 from BD Biosciences, goat anti-mouse VEGFR-2, and goat anti-mouse VE-cadherin from R&D Systems, and/or rabbit anti-β-galactosidase from MP Biomedicals [Aurora, OH, http://www.mpbio.com]). After several washes in TBS/0.05% Tween 20, samples were incubated with appropriate secondary antibodies diluted in blocking buffer (Alexa donkey anti-rat 594 and Alexa donkey anti-goat 488; Molecular Probes). Hoechst 33342 was used to visualize nuclei. Mounting was done in Fluoromount-G (SouthernBiotech, Birmingham, AL, http://www.southernbiotech.com). Samples were analyzed using a Nikon Eclipse E1000 microscope with a Nikon Eclipse DXM 1200 camera (Tokyo, http://www.nikon.com) or an LSM 510 META confocal microscope (Carl Zeiss, Oberkochen, Germany, http://www.zeiss.com). The following objectives were used: Nikon Plan Apochromat x4/0.2, x20/0.75; Carl Zeiss confocal Plan Apochromat x63/1.4 oil immersion. The following software was used: ACT-1 (Nikon) and Laser Scanning Microscope LSM 510 (Carl Zeiss). Processing of microphotographs was done using Photoshop (Adobe Systems Inc., San Jose, CA, http://www.adobe.com). Quantification of the peripheral VE-cadherin-positive area relative to the entire VE-cadherin-positive area was done by defining the peripheral rim as the circular area between the outer edge of the EB (determined by Hoechst nuclear staining) and 20% of the EB radius toward the center. The stained area was estimated using the Image Analysis 2000 software (Tekno Optik, Skarholmen, Sweden, http://www.teknooptik.se).
EB Sprouting Assay
Collagen gels were prepared by mixing 10x Ham's F-12 medium (Invitrogen) with 0.12% NaHCO3, 50 mmol/l HEPES, 5 mmol/l NaOH, and 1.5 mg/ml collagen I. EBs were distributed on polymerized collagen gels on day 4 and covered with a second layer of collagen gel. Medium containing VEGF-A165 was changed every 3 days, and culture was continued for 11 days (until day 15 of differentiation). EBs in collagen gels were washed twice in PBS and fixed in 4% p-formaldehyde (Sigma-Aldrich) in PBS for 30 minutes at room temperature, followed by blocking and permeabilization using 0.2% Triton X-100 in PBS/3% BSA, for 2 hours. After overnight incubation at 4°C with primary antibodies, rat anti-mouse CD31 antibody (BD Biosciences), goat anti-mouse VEGFR-2 (R&D Systems), or rabbit anti-mouse Nerve/glia2 (NG2; Chemicon), diluted in PBS/3% BSA/0.1% Tween 20, samples were washed several times in PBS/0.1% Tween 20 and thereafter incubated with secondary antibodies (Alexa donkey anti-rat 594, Alexa donkey anti-goat 488, or Alexa donkey anti-rabbit 488; Molecular Probes) and with Hoechst 33342, to visualize nuclei. Samples were analyzed using either a Nikon Eclipse E1000 microscope with a Nikon Eclipse DXM 1200 camera or an LSM 510 META confocal microscope (Carl Zeiss). Quantification of the CD31-positive sprout area (obtained by subtracting the staining of the EB core area) was done using the Image Analysis 2000 software.
 |
RESULTS
|
|---|
Lentiviral Transduction of fkl1–/– ES Cells
WT and KO ES cells were transduced with recombinant lentivirus expressing mouse vegfr2 cDNA under the control of a constitutively active Ubc promoter (Fig. 1A). The transduced ES cell cultures were analyzed by flow sorting for expression of an IRES-regulated EGFP reporter, which showed a transduction efficiency of approximately 30% for both WT and KO ES cell lines (data not shown). EGFP-expressing cells were collected, allowing establishment of ES cultures of more than 90% purity, designated WT LvFlk1 and KO LvFlk1 (Fig. 1B). The ES cell cultures were allowed to differentiate as adherent EBs for 8 days. The cultures were characterized by immunoblotting, which showed expression of VEGFR-2 protein in undifferentiated WT LvFlk1 and KO LvFlk1 ES cells, whereas nontransduced WT and KO ES cells did not express VEGFR-2 (Fig. 1C). The blot visualized the expected two VEGFR-2 bands of approximately 200 and 230 kDa, representing the intracellular and cell surface-expressed forms of VEGFR-2, respectively. Immunoblotting of total lysates from EB cultures at day 8 showed expression of VEGFR-2 in WT EBs, as well as in WT LvFlk1 and KO LvFlk1 EBs (Fig. 1D).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 1. Lentiviral transduction of VEGFR-2 in KO EBs. (A): Schematic outline of the lentivirus construct, including the constitutively active hUbiquitin C promoter directing expression of mouse vegfr2 cDNA and, through an IRES, an EGFP reporter. (B): WT and KO ES cells were transduced with the VEGFR-2-encoding lentivirus, and EGFP-positive ES cells were collected to generate WT LvFlk1 (i.e., WT cells transduced to overexpress VEGFR-2) and KO LvFlk1 (i.e., KO cells transduced to overexpress VEGFR-2) ES cell populations. EGFP-based flow analysis, using nontransduced WT and KO ES cells as controls, showed the purity of the sorted populations WT LvFlk1 (left) and KO LvFlk1 (right). Total protein extracts from undifferentiated ES cells (C) and day 8 EBs (D) were immunoblotted to show expression of mouse VEGFR-2. Immunoblotting for β-actin was used as a loading control. Abbreviations: EGFP, enhanced green fluorescence protein; ES, embryonic stem; GFP, green fluorescent protein; hUbiquitin, human ubiquitin; IRES, internal ribosomal entry site; KO, flk1–/–; VEGFR-2, vascular endothelial growth factor receptor-2; WT, wild-type.
|
|
VEGFR-2 Signal Transduction
To ensure that the transgenic VEGFR-2 was able to respond to ligand stimulation with increased kinase activity, biochemical analyses were performed. Treatment with VEGF-A165 induced VEGFR-2 tyrosine phosphorylation in WT, WT LvFlk1, and KO LvFlk1 (Fig. 2A). The increased expression levels of VEGFR-2 in WT LvFlk1 and KO LvFlk1 allowed detection of basal tyrosine phosphorylation at higher levels than in WT cells. In the KO EBs, receptor expression was not detected. Analysis of the kinetics of receptors clearance showed similar relative disappearance of phosphorylated VEGFR-2 in WT and KO LvFlk1 EBs (Fig. 2B), with an initial strong induction of tyrosine phosphorylation, followed by a decrease by 2 hours of treatment. To determine the size of the endothelial cell pools in the different EB cultures, WT and recombinant EBs were subjected to VE-cadherin-directed flow sorting. As shown in Figure 3, VE-cadherin was expressed in approximately 4% of the cells in the EBs, irrespective of the level of VEGFR-2 expression. These data show that VEGFR-2 expression in undifferentiated ES cells does not dictate differentiation along the endothelial cell lineage.

View larger version (56K):
[in this window]
[in a new window]
|
Figure 2. Signal transduction by the transduced VEGFR-2. (A): VEGFR-2 expression and VEGF-A165-induced tyrosine phosphorylation in WT, WT LvFlk1, KO, and KO LvFlk1 EBs stimulated with 100 ng/ml (2.6 nM) VEGF-A165 for 1 hour on day 10 of differentiation. Lysates were subjected to IP followed by immunoblotting with antibodies against pTyr or VEGFR-2. (B): WT and KO LvFLk1 EBs (day 10) were treated with 100 ng/ml VEGF-A165 for different time periods (0–6 hours). Immunoprecipitation and immunoblotting was performed as in (A). As a loading control, total cell lysates were separately run and blotted for β-catenin, which remained expressed at unchanged levels during this treatment (data not shown). Abbreviations: IP, immunoprecipitation; KO, flk1–/–; pTyr, phosphotyrosine; VEGF, vascular endothelial growth factor; VEGFR-2, vascular endothelial growth factor receptor-2; WT, wild-type.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 3. Endothelial precursor pool size in WT and vascular endothelial growth factor receptor-2-overexpressing EBs. Flow sorting was used to assess the size of the VE-cadherin-positive endothelial cell pool in WT, WT LvFlk1, KO, and KO LvFlk1EBs on day 14 of differentiation. The percentage of VE-cadherin-positive cells, of the total viable cell population, is shown in the upper right corner of each panel. The area above the line dividing each panel contains data points generated specifically by the primary antibody, whereas data points below the line represent unspecific staining (Cy5-conjugated secondary antibody alone). Abbreviations: FSC, forward scatter; KO, flk1–/–; VE, vascular endothelial; WT, wild-type.
|
|
Rescue of Endothelial Cell Organization
EBs in 2D cultures were treated with VEGF-A165 and examined by immunostaining for endothelial cell markers to determine the ability of the different cultures to support vasculogenesis in this model (i.e., differentiation of endothelial cells and organization into a primitive vascular plexus). WT EBs responded to VEGF-A165 by formation of a peripheral ring of vessel structures, as shown using antibodies against VEGFR-2, the endothelial/hematopoietic marker CD31/platelet-endothelial cell adhesion molecule, and VE-cadherin (Fig. 4A). CD31 is expressed on endothelial and hematopoietic cells, whereas VE-cadherin is specifically expressed on endothelial cells; combined, these markers allow detection of endothelial cells with high accuracy. Transduced WT LvFlk1 EBs also responded to VEGF-A165 with formation of an extensive capillary plexus. Here, VEGFR-2 expression was not confined to vascular structures, in agreement with the fact that a ubiquitous promoter was driving expression of the transgenic VEGFR-2. In the KO EBs, clusters of cells were visualized that coexpressed CD31 and VE-cadherin but not VEGFR-2 and that did not respond to VEGF-A165. In contrast, the KO LvFlk1 EBs responded to VEGF-A165 with formation of a vascular plexus. VEGFR-2 expression was seen both in vessel structures and, more diffusely, in nonendothelial cells. When the VEGF-A165 concentration was increased from 0.785 to 2.5 nM, KO LvFlk1 EBs responded more efficiently and displayed similar numbers of branch points as in the WT EBs treated with the same concentration of VEGF-A165, whereas the KO EBs still failed to respond (Fig. 4B). Quantification of the VE-cadherin-positive area in the EB periphery confirmed that the response was similar in WT and KO LvFlk1 EBs treated with 2.5 nM VEGF-A165 (Fig. 4C). Confocal images (Fig. 4D) showed VE-cadherin-positive aggregates composed of many cells in the KO EBs, whereas VE-cadherin-positive cells in the KO LvFlk1 and WT EB cultures were arranged in elongated vessel structures. We conclude that VEGFR-2 expression is required for VEGF-A165-induced organization of endothelial cells into vascular structures.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 4. Rescue of capillary plexus formation in VEGFR-2-overexpressing KO EBs. (A): EBs in two-dimensional cultures were kept in the presence of 0.785 or 2.5 nM VEGF-A165 from day 4 to day 10 of differentiation, followed by immunofluorescent staining to detect VEGFR-2 (blue) or costaining on separate slides to detect CD31 (red) and VE-cad (green). Scale bar = 1 mm. The bottom row of panels shows higher magnifications of the peripheral plexus, as indicated by the white box in the corresponding panel above. Scale bar = 100 µm. White arrowheads indicate branch points. (B): WT, KO, and KO LvFlk1 EBs treated with 2.5 nM VEGF-A165 from day 4 to day 10 and immunostained to detect VE-cad expression. Scale bar = 1 mm. (C): Quantification of the ratio of VE-cad-positive area in the peripheral rim relative to that of the total EB for indicated samples (n = 6 for each ES sample). Details are given in Materials and Methods. Mean values are plotted, with SDs indicated. A significant difference was observed comparing WT and KO LvFlk1 EBs treated with 0.785 nM VEGF-A165 (p < .01), whereas WT and KO LvFlk1 EBs treated with 2.5 nM VEGF-A165 showed no significant difference. (D): Confocal images of VE-cad-positive (green) cells in WT, KO, and KO LvFlk1 EBs. Hoechst 33342 nuclear staining showed several VE-cad-positive cells in aggregates in the KO EBs, whereas VE-cadherin-positive cells formed vessel structures in WT and KO LvFlk1 EBs. Scale bar = 10 µm. Abbreviations: KO, flk1–/–; VE-cad, vascular endothelial cadherin; VEGF, vascular endothelial growth factor; VEGFR-2, vascular endothelial growth factor receptor-2; WT, wild-type.
|
|
The potential of the different ES lines to differentiate and form angiogenic sprouts in 3D collagen gels in response toVEGF-A165 was assessed. As shown in Figure 5A, abundant sprouts were formed from WT EBs and WT LvFlk1 EBs treated with 0.785 nM VEGF-A165. Higher concentrations of VEGF-A165 did not further enhance sprouting from these EBs. KO EBs failed to form sprouts at any VEGF-A165 concentration applied. The KO LvFlk1 EBs formed angiogenic sprouts in the presence of VEGF-A165, in a dose-dependent manner. Even at the higher dose (2.5 nM), however, the sprouting efficiency was lower for the KO LvFlk1 than for the WT EBs (quantification of the CD31-positive sprout area given in Fig. 5B). Coimmunostaining of the angiogenic sprouts to detect CD31 and the pericyte marker NG2 showed that sprouts in the KO LvFlk1 EBs were more extensively covered by pericytes (Fig. 5C). Since pericytes are known to mediate vessel stability [18], the more complete coverage may have contributed to the reduced sprouting efficiency of the KO LvFlk1 EBs.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 5. Rescue of VEGF-A165-induced endothelial sprouting in KO LvFlk1 EBs. (A): EBs were cultured in a three-dimensional (3D) collagen matrix in the presence of 0.785 or 2.5 nM VEGF-A165 from day 4 to day 15 of differentiation, followed by immunofluorescent staining to detect expression of CD31 (red) and VEGFR-2 (green). The weak nonspecific staining for VEGFR-2 in the KO EBs was due to trapping of secondary antibodies within the 3D structure. Scale bar = 1 mm. (B): Quantification of CD31-positive sprout area (n = 6 for each ES sample) in relative units where the sprouting area of WT EBs was set to 1. Plot shows means and SDs. *, p < .05 (Student's t test). (C): WT and KO LvFlk1 EBs in collagen treated with 2.5 nM VEGF-A165 showed CD31 and NG2 coimmunostaining of angiogenic sprouts. Arrowheads in KO LvFlk1 merged panel indicate endothelial tip cells covered by NG2-positive pericytes. Scale bar = 100 µm. Abbreviations: KO, flk1–/–; NG2, Nerve/glia2; VEGF, vascular endothelial growth factor; VEGFR-2, vascular endothelial growth factor receptor-2; WT, wild-type.
|
|
Expression of VEGFR-2 in Nonendothelial Cells
Confocal microscopy on VEGF-A165-treated adherent EBs showed coexpression of VEGFR-2 and CD31 in endothelial cells forming vessel structures in WT cultures (Fig. 6A). In the KO LvFlk1 EBs, VEGFR-2 expression was also detected in CD31-negative cells. This is in agreement with the fact that the promoter driving expression of the VEGFR-2 transgene was ubiquitously active, resulting in an ectopic expression pattern beyond the normal confinement to the endothelial lineage.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 6. Nonendothelial cell expression of VEGFR-2. (A): Confocal microscopy images show day 10 WT and KO LvFlk1 EBs in two-dimensional cultures, subjected to immunofluorescent staining to detect VEGFR-2 (green) and CD31 (red). Hoechst 33342 was used to visualize nuclei. Scale bar = 10 µm. (B): Endothelial cells were isolated from WT and KO LvFlk1 EBs on days 8 and 12, using magnetic bead cell sorting to collect CD31-positive cells as well as flow-through, followed by purification of RNA. Transcript levels were determined using real-time PCR and normalized against β-actin values. Results were plotted as sample means relative to mean of the WT CD31-positive sample. Abbreviations: KO, flk1–/–; VE, vascular endothelial; VEGFR-2, vascular endothelial growth factor receptor-2; WT, wild-type.
|
|
To define the endothelial identity of the CD31-positive and CD31-negative, VEGFR-2-expressing cell populations, EBs were dispersed by collagenase treatment. Cells were purified into CD31-positive (CD31+) and CD31-negative (flow-through) pools using anti-CD31 antibody-coupled microbeads, followed by cDNA synthesis and real-time PCR. The purity of the CD31-positive pool was verified by PCR to detect the endodermal marker
-fetoprotein (AFP). More than 95% of AFP transcripts were lost in the CD31-positive pool compared with the flow-through, indicating high efficiency in the purification step (data not shown). As shown in Figure 6B, VEGFR-2 transcripts were detected in the CD31-positive pools of WT and KO LvFlk1 EBs to similar levels. Irrespective of the time point of EB harvest (day 8 or day 12), a high level of VEGFR-2 transcripts was also detected in the CD31-negative flow-through from KO LvFlk1 EBs. This is in agreement with the detection of VEGFR-2 in CD31-negative cells shown in Figure 6A. The CD31-positive pool of cells contained VEGFR-2, VE-cadherin, and Tie-1 transcripts at slightly lower levels in the KO LvFlk1 EBs than in the WT EBs. Importantly, these transcripts were missing in the CD31-negative cells pool in both WT and KO LvFlk1 EBs (Fig. 6B). There was a slightly higher expression of Tie-1 and VE-cadherin at day 12 compared with day 8 and in the KO LvFlk1 cultures compared with WT. We conclude that expression of VEGFR-2 per se did not allow induction of an endothelial cell phenotype.
Functionality of Endothelial Precursors Derived from KO and KO LvFlk1 Stem Cells
The KO ES cells express β-galactosidase (β-Gal) as a result of knock-in of lacZ cDNA into the flk1 locus [5]. EBs derived from WT ES cells did not express β-Gal reactivity, whereas both KO and KO LvFlk1 expressed β-Gal, which colocalized with immunostaining for CD31 (Fig. 7A). In the KO LvFlk1 cultures, β-Gal reactivity was entirely confined to the CD31-positive vascular plexus, whereas the KO EBs showed β-Gal reactivity in CD31-positive cell aggregates. These data support the notion that priming of stem cells to the endothelial cell lineage occurs independently of VEGFR-2 expression.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 7. Chimeric EB cultures show exclusion of KO endothelial precursors. (A): KO, KO LvFlk1, and WT EBs were treated with 0.785 nM vascular endothelial growth factor-A165 from day 4 of differentiation and subjected to immunofluorescent staining on day 10 to show expression of CD31 (red) and β-gal (green), indicating endogenous flk1 promoter activity in cells derived from the KO genotype. Merged images (top row) show β-gal-, CD31-positive cells present in both KO and KO LvFlk1 EBs but not in WT EBs. Bottom row shows individual CD31 and β-gal staining patterns for each condition. Scale bar = 100 µm. (B): Cocultures of ES cells at a 9:1 ratio were differentiated as EBs, cultured, and stained as described above. Arrowheads indicate colabeled structures where KO derived β-gal-positive cells were localized in proximity to WT/CD31-positive vessel structures. Arrows in the KO LvFlk1:WT panels indicate chimeric vessel structures. Scale bar = 100 µm. (C): Confocal images of vessel structures in KO:WT and KO LvFlk1:WT chimeric structures show exclusion of β-gal-positive KO cells (green) from the WT vessel structures (left) but inclusion of β-gal-positive KO LvFlk1 cells together with WT endothelial cells to form chimeric vessels. Scale bar = 10 µm. Abbreviations: β-gal, β-galactosidase; KO, flk1–/–; WT, wild-type.
|
|
To test the functionality of the endothelial precursors formed in the different cultures, chimeric EBs were created. Figure 7B shows chimeric EBs composed of KO and WT ES cells mixed at a 9:1 ratio. The majority of endothelial cells in the plexus were negative for β-Gal. Next, KO ES cells were mixed with KO LvFlk1 ES cells (KO:KO LvFlk1, 9:1) and treated withVEGF-A165, resulting in the formation of an elaborate β-Gal-positive vascular plexus. Since KO ES cells alone failed to form endothelial cells able to organize into vascular structures (Figs. 4, 7A), we infer that endothelial cells in the vascular plexus were derived from the KO LvFlk1 ES cells. In chimeric EBs composed of KO LvFlk1 and WT ES cells (9:1), approximately 40% of endothelial cells in the plexus were β-Gal-positive and hence derived from the KO LvFlk1 ES cells (Fig. 7B), compared with the 90% expected contribution based on the ratio of KO LvFlk1 cells in the chimeric EBs. Confocal analyses of KO:WT chimeric EBs showed that CD31/β-Gal-positive KO cells failed to integrate into vessel structures composed of WT endothelial cells (Fig. 7C). In contrast, in KO LvFlk1:WT chimeras, there was a complete integration of the VEGFR-2-reconstituted KO LvFlk1 endothelial cells into WT vessels. Combined, these data show that endothelial precursors in the KO EBs are arrested at a stage incompatible with establishment of proper cell-cell contacts and 3D arrangement, whereas reintroduction of VEGFR-2 permitted these processes. Thus, the endothelial cell precursors expressing lentivirus-derived VEGFR-2 show a considerable (although not 100%) degree of rescue at all stages from precursor maturation and organization of cells into 3D vascular structures.
 |
DISCUSSION
|
|---|
This study outlines the features of vascular development in differentiating KO ES cells, reconstituted with ubiquitously expressed murine VEGFR-2 through lentiviral delivery. Introduction of VEGFR-2 allowed efficient rescue of vasculogenesis, as assessed using the EB model. A number of conclusions can be drawn from the use of this model. (a) Expression of the receptor in the majority of the pluripotent stem cell population allowed recruitment and maturation of an endothelial cell pool of a size similar to that in WT EBs. This indicates a strict endothelial lineage is independent of VEGFR-regulation of the size of the endothelial cell pool, which cannot be overcome by general expression of VEGFR-2. (b) Although our data agree with earlier reports [8] that commitment to the endothelial lineage is independent of VEGFR-2, we show that differentiation of flk1–/– precursors is arrested. Thus, the flk1–/– endothelial precursors were excluded from vessel structures formed by WT endothelial cells. In the rescued cultures, reconstituted precursors were integrated together with wild-type endothelial cells to form chimeric vessels.
The fate of nonendothelial cells expressing VEGFR-2 was not directly addressed, but clearly, VEGFR-2-expressing, CD31-negative cells never formed vessel structures (Fig. 6A; data not shown). Moreover, real-time PCR analysis of endothelial marker transcripts from CD31-positive, MACS-purified cells derived from KO LvFlk1 EBs showed relative levels of endothelial cell marker expression similar to those in unfractionated EBs (supplemental online Fig. 1; compare with Fig. 6B). This indicates that endothelial transcripts were confined to the CD31-positive population in the rescued EBs. Immunoblotting for VEGFR-2 in the nonendothelial cell pool (flow-through from MACS purification) showed a slower migration rate of this subfraction of receptors than that of the total receptor pool in WT or transduced EBs (supplemental online Fig. 2C). We also noticed that nonendothelial cell-derived VEGFR-2 was less efficiently captured during the MACS-purification (supplemental online Fig. 2B), possibly because of differences in biosynthetic processing and impaired binding of the antibody to VEGFR-2 in nonendothelial cells. There are indications in the literature that VEGFR-2 expressed in nonendothelial cells has signal transduction properties different from those of endothelial-expressed VEGFR-2 [19]. Such differences may conceivably be due to different molecular properties of the receptor (as a result of different biosynthetic processing), to a different expression pattern of endothelial coreceptors, such as neuropilin (reviewed in [1]) in the nonendothelial cells, or to lineage variations in the expression patterns of downstream signal transduction molecules.
Whether any of the properties of the recombinant ES cell lines described here are particular to the use of the Ubc promoter is not clear. VEGFR-2 is known to be induced during precursor differentiation in vivo and in vitro and to be expressed at high levels during active angiogenesis, such as that in tumors, but at reduced levels in quiescent endothelial cells [20, 21]. Clearly, those features are not mimicked in the current model. However, the fact that WT ES cells expressing VEGFR-2 under the control of the Ubc promoter (WT LvFlk1 ES cells) showed a strong response to VEGF-A165 in the different assays used supports our conclusion that vasculogenesis driven by endogenous VEGFR-2 was not disturbed by the ectopic, Ubc promoter-regulated VEGFR-2 expression. Moreover, we do not expect that promoters for other housekeeping genes, such as β-actin, would have changed the features of vasculogenesis in reconstituted ES cells. The size of the vegfr2 cDNA (coding region of approximately 4 kilobase pairs) does currently not allow the choice of endothelial cell-specific promoters, which also are quite large, to drive expression of a transgene using lentiviral delivery. Ambitious attempts were made to use endothelial cell-specific promoters (i.e., the CD31, Vecadherin/CDH5, and flk1 promoters) to confer endothelial cell expression of VEGFR-2 through conventional cDNA transfection. However, only a very few clones showing low VEGFR-2 expression levels, perhaps as a result of silencing, were obtained. Adenoviral delivery, which may have allowed more flexibility with regard to insert size, gave very poor transduction efficiency and a transient expression pattern.
Targeted inactivation of the vegf-a gene has shown that the level of VEGF-A expression during vasculogenesis is critical, as deletion of only one allele leads to embryonic death [2, 3]. Interestingly, different levels of VEGF may be required for induction of different VEGFR-2-dependent processes. Miquerol et al. reported that tissues vascularized through vasculogenesis, such as spleen and lung, expressed higher levels of VEGF-A than tissues vascularized through angiogenesis, such as brain [22]. Furthermore, expression of arterial genes is induced at higher concentrations of VEGF than those required for induction of venous markers in differentiating ES cultures [23]. Formation of the capillary plexus and angiogenic sprouting both required a higher concentration of VEGF-A165 for the KO LvFlk1 EBs than for the WT EBs (Figs. 4 and 5). The underlying mechanisms could involve higher consumption of VEGF-A165, possibly due to changes in turnover of VEGFR-2 or other aspects of regulation of VEGFR-2 expression dependent on the endogenous flk-1 promoter. The receptor turnover is modulated by the availability and mode of presentation of coreceptors for VEGF-A165/VEGFR-2, such as neuropilin and heparan sulfate proteoglycans [24–28]. These coreceptors are presumed to be critical in creation of growth factor gradients to provide chemoattractant cues guiding, for example, angiogenic sprouts [29]. Neuropilin-1 transcript levels were reduced in the KO LvFlk1 cells (data not shown); whether this reduction may explain the limited angiogenic sprouting efficiency has not been directly tested. Furthermore, we noted an increased pericyte coverage of angiogenic sprouts in the KO LvFlk1 EBs (Fig. 5C), which may have contributed to the restriction of the angiogenic sprouting. Overall, however, the rescue of endothelial cell function in the KO LvFlk1 EBs was satisfactory (quantifications are given in Figs. 4C, 5B) considering the broad expression and lack of vegfr2 promoter-dependent regulation of the transgene.
To various degrees, KO EBs produced cells positive for VE-cadherin, as shown by FACS analysis (Fig. 3; data not shown). This population most likely represents endothelial/hematopoietic precursors, arrested or subverted in their development because of suboptimal VEGF-VEGFR-2 signaling at critical stages during vasculogenesis. Analysis of chimeric EBs composed of ES cells of KO and WT origin showed that the KO precursors were excluded from wild-type vessel structures. Rescued KO LvFlk1 precursors participated in the formation of chimeric vessel structures when they were present in chimeric EBs containing 10% WT ES cells. Although the KO LvFlk1-derived angioblasts efficiently matured and formed vascular structures alone, they were recognized and to some extent suppressed in a WT setting. This may reflect a mechanism operating during development to exert stringent control the size of the endothelial cell pool.
 |
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
This study was supported by grants from the Swedish Research Council (Project K2005-32X-12552-08A), the Swedish Cancer Foundation (Project 3820-B05-10XBC), and the Association for International Cancer Research (to L.C.-W.). We thank Dr. Jan Grawé for expert assistance on the flow cytometry. X.L. and D.E. contributed equally to this work.
 |
REFERENCES
|
|---|
- Olsson AK, Dimberg A, Kreuger J et al. VEGF receptor signalling—In control of vascular function. Nat Rev Mol Cell Biol 2006;7:359–371.[CrossRef][Medline]
- Carmeliet P, Ferreira V, Breier G et al. Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 1996;380:435–439.[CrossRef][Medline]
- Ferrara N, Carver-Moore K, Chen H et al. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 1996;380:439–442.[CrossRef][Medline]
- Kabrun N, Buhring HJ, Choi K et al. Flk-1 expression defines a population of early embryonic hematopoietic precursors. Development 1997;124:2039–2048.[Abstract]
- Shalaby F, Rossant J, Yamaguchi TP et al. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature 1995;376:62–66.[CrossRef][Medline]
- Shalaby F, Ho J, Stanford WL et al. A requirement for Flk1 in primitive and definitive hematopoiesis and vasculogenesis. Cell 1997;89:981–990.[CrossRef][Medline]
- Bautch VL, Redick SD, Scalia A et al. Characterization of the vasculogenic block in the absence of vascular endothelial growth factor-A. Blood 2000;95:1979–1987.[Abstract/Free Full Text]
- Schuh AC, Faloon P, Hu QL et al. In vitro hematopoietic and endothelial potential of flk-1(–/–) embryonic stem cells and embryos. Proc Natl Acad Sci U S A 1999;96:2159–2164.[Abstract/Free Full Text]
- Leung DW, Cachianes G, Kuang WJ et al. Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 1989;246:1306–1309.[Abstract/Free Full Text]
- Childs S, Chen JN, Garrity DM et al. Patterning of angiogenesis in the zebrafish embryo. Development 2002;129:973–982.[Medline]
- Norrby K. In vivo models of angiogenesis. J Cell Mol Med 2006;10:588–612.[CrossRef][Medline]
- Ferrara N, Kerbel RS. Angiogenesis as a therapeutic target. Nature 2005;438:967–974.[CrossRef][Medline]
- Weinstein BM. Vessels and nerves: Marching to the same tune. Cell 2005;120:299–302.[CrossRef][Medline]
- Takahashi T, Yamaguchi S, Chida K et al. A single autophosphorylation site on KDR/Flk-1 is essential for VEGF-A-dependent activation of PLC-gamma and DNA synthesis in vascular endothelial cells. EMBO J 2001;20:2768–2778.[CrossRef][Medline]
- Sakurai Y, Ohgimoto K, Kataoka Y et al. Essential role of Flk-1 (VEGF receptor 2) tyrosine residue 1173 in vasculogenesis in mice. Proc Natl Acad Sci U S A 2005;102:1076–1081.[Abstract/Free Full Text]
- Matsumoto T, Bohman S, Dixelius J et al. VEGF receptor-2 Y951 signaling and a role for the adapter molecule TSAd in tumor angiogenesis. EMBO J 2005;24:2342–2353.[CrossRef][Medline]
- Lamalice L, Houle F, Huot J. Phosphorylation of Tyr1214 within VEGFR-2 triggers the recruitment of Nck and activation of Fyn leading to SAPK2/p38 activation and endothelial cell migration in response to VEGF. J Biol Chem 2006;281:34009–34020.[Abstract/Free Full Text]
- Gerhardt H, Betsholtz C. Endothelial-pericyte interactions in angiogenesis. Cell Tissue Res 2003;314:15–23.[CrossRef][Medline]
- Takahashi T, Shibuya M. The 230 kDa mature form of KDR/Flk-1 (VEGF receptor-2) activates the PLC-gamma pathway and partially induces mitotic signals in NIH3T3 fibroblasts. Oncogene 1997;14:2079–2089.[CrossRef][Medline]
- Hatva E, Kaipainen A, Mentula P et al. Expression of endothelial cell-specific receptor tyrosine kinases and growth factors in human brain tumors. Am J Pathol 1995;146:368–378.[Abstract]
- Kaipainen A, Korhonen J, Pajusola K et al. The related FLT4, FLT1, and KDR receptor tyrosine kinases show distinct expression patterns in human fetal endothelial. cells J Exp Med 1993;178:2077–2088.
- Miquerol L, Gertsenstein M, Harpal K et al. Multiple developmental roles of VEGF suggested by a LacZ-tagged allele. Dev Biol 1999;212:307–322.[CrossRef][Medline]
- Lanner F, Sohl M, Farnebo F. Functional arterial and venous fate is determined by graded VEGF signaling and notch status during embryonic stem cell differentiation. Arterioscler Thromb Vasc Biol 2007;27:487–493.[Abstract/Free Full Text]
- Soker S, Takashima S, Miao HQ et al. Neuropilin-1 is expressed by endothelial and tumor cells as an isoform-specific receptor for vascular endothelial growth factor. Cell 1998;92:735–745.[CrossRef][Medline]
- Jakobsson L, Kreuger J, Holmborn K et al. Heparan sulfate in trans potentiates VEGFR-mediated angiogenesis. Dev Cell 2006;10:625–634.[CrossRef][Medline]
- Miao HQ, Lee P, Lin H et al. Neuropilin-1 expression by tumor cells promotes tumor angiogenesis and progression. FASEB J 2000;14:2532–2539.[Abstract/Free Full Text]
- Cebe-Suarez S, Zehnder-Fjallman A, Ballmer-Hofer K. The role of VEGF receptors in angiogenesis; complex partnerships. Cell Mol Life Sci 2006;63:601–615.[CrossRef][Medline]
- Yamada Y, Takakura N, Yasue H et al. Exogenous clustered neuropilin 1 enhances vasculogenesis and angiogenesis. Blood 2001;97:1671–1678.[Abstract/Free Full Text]
- Gerhardt H, Golding M, Fruttiger M et al. VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia. J Cell Biol 2003;161:1163–1177.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Cebe-Suarez, F. S. Grunewald, R. Jaussi, X. Li, L. Claesson-Welsh, D. Spillmann, A. A. Mercer, A. E. Prota, and K. Ballmer-Hofer
Orf virus VEGF-E NZ2 promotes paracellular NRP-1/VEGFR-2 coreceptor assembly via the peptide RPPR
FASEB J,
August 1, 2008;
22(8):
3078 - 3086.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kawamura, X. Li, S. J. Harper, D. O. Bates, and L. Claesson-Welsh
Vascular Endothelial Growth Factor (VEGF)-A165b Is a Weak In vitro Agonist for VEGF Receptor-2 Due to Lack of Coreceptor Binding and Deficient Regulation of Kinase Activity
Cancer Res.,
June 15, 2008;
68(12):
4683 - 4692.
[Abstract]
[Full Text]
[PDF]
|
 |
|