Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online August 23, 2007
Stem Cells Vol. 25 No. 12 December 2007, pp. 3121 -3132
doi:10.1634/stemcells.2007-0483; www.StemCells.com
© 2007 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2007-0483v1
25/12/3121    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pruitt, S. C.
Right arrow Articles by Freeland, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pruitt, S. C.
Right arrow Articles by Freeland, A.

TISSUE-SPECIFIC STEM CELLS

Reduced Mcm2 Expression Results in Severe Stem/Progenitor Cell Deficiency and Cancer

Steven C. Pruitt, Kimberly J. Bailey, Amy Freeland

Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, New York, USA

Key Words. Somatic stem cells • Cellular proliferation • Cre-loxP system • Neural stem cell • Muscle stem cells Intestinal crypt stem cell • DNA replication licensing factor • Mcm2

Correspondence: Steven C. Pruitt, Ph.D., Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, New York 14263, USA. Telephone: 716-845-3589; Fax: 716-845-5908; e-mail: steven.pruitt{at}roswellpark.org

Received on June 19, 2007; accepted for publication on August 16, 2007.

First published online in STEM CELLS EXPRESS  August 23, 2007.

    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Mcm2 is a component of the DNA replication licensing complex that marks DNA replication origins during G1 of the cell cycle for use in the subsequent S-phase. It is expressed in stem/progenitor cells in a variety of regenerative tissues in mammals. Here, we have used the Mcm2 gene to develop a transgenic mouse in which somatic stem/progenitor cells can be genetically modified in the adult. In these mice, a tamoxifen-inducible form of Cre recombinase is integrated 3' to the Mcm2 coding sequence and expressed via an internal ribosome entry site (IRES). Heterozygous Mcm2IRES-CreERT2/wild-type (wt) mice are phenotypically indistinguishable from wild-type at least through 1 year of age. In bigenic Mcm2IRES-CreERT2/wt; Z/EG reporter mice, tamoxifen-dependent enhanced green fluorescence protein expression is inducible in a wide variety of somatic stem cells and their progeny. However, in Mcm2IRES-CreERT2/IRES-CreERT2 homozygous embryos or mouse embryonic fibroblasts, Mcm2 is reduced to approximately one-third of wild-type levels. Despite the fact that these mice develop normally and are asymptomatic as young adults, life span is greatly reduced, with most surviving to only ~10–12 weeks of age. They demonstrate severe deficiencies in the proliferative cell compartments of a variety of tissues, including the subventricular zone of the brain, muscle, and intestinal crypts. However, the immediate cause of death in most of these animals is cancer, where the majority develop lymphomas. These studies directly demonstrate that deficiencies in the function of the core DNA replication machinery that are compatible with development and survival nonetheless result in a chronic phenotype leading to stem cell deficiency in multiple tissues and cancer.

Disclosure of potential conflicts of interest is found at the end of this article.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
In organisms that use a somatic stem cell strategy for tissue maintenance, genomic instability is thought to contribute to both cancer and aging. Mutations accumulating in the stem cell compartment are ultimately responsible for either deregulated cell growth, in the case of cancer, or stem cell dysfunction or deficiency, in the case of aging. Prior studies in which DNA damage repair or response genes are disrupted support this hypothesis [15].

The source of the genetic damage that triggers the DNA damage response and repair pathways has been less well-defined and could include environmental or cell-autonomous mechanisms. One important potential source includes those proteins controlling accurate DNA replication. However, it has been difficult to test the contribution of the DNA replication machinery to genomic instability, since most such mutations will be lethal to the cell. Recently, one case in which it was possible to define the phenotype resulting from hypomorphic function of the DNA replication origin licensing factor Mcm4 has been reported [6]. Mcm4 hypomorphs exhibit breast cancer; however, no other cancer types were found, and males were not reported to exhibit either cancer susceptibility or premature segmental aging phenotypes. These studies provide a strong case that Mcm4 function is critical in maintaining genomic integrity in mammary tissue. However, the lack of an apparent phenotype in other tissues leaves the larger question of the role of replication-related errors in contributing to aging or cancer in other tissue types unresolved.

In the present study, a transgenic mouse in which a gene encoding a tamoxifen-inducible form of Cre recombinase (CreERT2) [7] was inserted into the 3'-untranslated region of the gene encoding the DNA replication licensing factor Mcm2 [8] and in which CreERT2 is expressed via an internal ribosome entry site was generated. This line was constructed to allow tamoxifen-dependent genetic recombination in stem/progenitor cells. Using crosses with the Cre-dependent enhanced green fluorescence protein (EGFP) reporter line Z/EG [9], we demonstrated tamoxifen-inducible recombinase activity in the stem/progenitor cells of a variety of tissues. However, we also found that insertion of the internal ribosome entry site (IRES)-CreERT2 cassette into the Mcm2 transcript results in a reduction in Mcm2 expression. This effect has allowed characterization of the phenotypic consequences of Mcm2 deficiency.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Transgenic Mouse Construction
The starting point for the pMcm2{Delta}pA-IRES-CreERT2 targeting construct was pMcm2-RI-SK+, which contains a 9-kilobase (kb) fragment of Mcm2 genomic sequence including the last (16th) exon 3' to the stop codon [8]. An XbaI fragment from the plasmid pHTPIres2CreERT2-GTB, containing an IRES2 sequence, the CreERT2 gene [7], a polyadenylation site, the Pgk promoter, and a neomycin resistance gene, was inserted into an XbaI site of pMcm2-RI-SK+ located within exon 16 of Mcm2 to result in pMcm2-IRES-CreERT2. To delete the cryptic polyadenylation site, pMcm2-IRES-CreERT2 was opened at the BstEII site shown in Figure 1B by partial digestion; the overhang was filled in; linear DNA was isolated; the DNA was redigested with FseI, which cleaves 3' to the Pgk promoter; and a 10,505-base pair (bp) BstEII-FseI fragment was isolated. This DNA fragment was ligated to a 3,494-bp DNA fragment derived from pHTP-IRES-2CreERT2-GTB, which was prepared by BamHI partial digestion, which cleaves 17 bp 3' to the XbaI site; fill-in of the resulting overhang; isolation of linear DNA; redigestion with FseI; and isolation. The result of the ligation was the plasmid pMcm2{Delta}pA-IRES-CreERT2, in which the cryptic pA site shown in Figure 1B was deleted but the IRES, CreERT2, pA, and Pgk promoter elements were restored. W4 embryonic stem (ES) cells were transfected by electroporation with NsiI-NsiI fragments of pMcm2-IRES-CreERT2 or pMcm2{Delta}pA-IRES-CreERT2, cultured in the presence of Geneticin (G-418) (200 µg/ml; Invitrogen, Carlsbad, CA, http://www.invitrogen.com) on neo-resistant feeders (mouse embryonic fibroblasts). G-418-resistant clones were picked and amplified. Genomic DNA was isolated and analyzed for the correct homologous recombination event by polymerase chain reaction (PCR) and Southern blot analysis. Northern blot analysis on RNAs derived from correctly integrated lines was performed using 20 µg of total RNA per lane on denaturing (formaldehyde) gels. Following transfer to nylon membranes, RNAs were probed using DNA fragments from the Mcm2 cDNA or the CreERT2 gene.


Figure 1
View larger version (55K):
[in this window]
[in a new window]

 
Figure 1. Construction of Mcm2IRES-CreERT2 transgenic mice. The targeting vector for construction of Mcm2IRES-CreERT2 transgenic mice was prepared by modification of a vector, Mcm2-IRES-EGFP ([A], middle), which was used previously [8] to integrate EGFP into the wild-type Mcm2 locus ([A], top). Initially, the gene encoding a tamoxifen-inducible form of Cre recombinase, CreERT2, was substituted for EGFP in the Mcm2-IRES-EGFP targeting vector. An additional deletion of a cryptic polyadenylation site that was found to be activated following integration of CreERT2 was then made in the final Mcm2IRES-CreERT2 targeting vector ([A], bottom). The location of the cryptic polyadenylation site (underlined italics, 2,920–2,925) that was deleted is shown on the Mcm2 sequence in (B) along with the normal polyadenylation site (underlined italics, 3,271–3,276), the BstEII restriction endonuclease site used to delete the cryptic polyadenylation site in conjunction with a BamHI site (not shown) located in the IRES 5' flanking sequence 17 base pairs (bp) 3' to the XbaI site into which the IRES-CreERT2 sequences were inserted, and the 3' portion of the coding region for Mcm2 (italics). (C): Expected structure of the correctly integrated Mcm2IRES-CreERT2 sequence in the context of the endogenous Mcm2 gene, where shaded portions are present in the targeting construct. EcoRI restriction endonuclease cleavage sites that were used to confirm correct 3' integration are shown. (D): Southern blot demonstrating the presence of the predicted ~2.1-kbp band, resulting from cleavage at the EcoRI site within the targeting vector and cleavage at the EcoRI site 3' to the NsiI site, which lies outside of the targeting vector in the adjacent Mcm2 genomic sequence, in EcoRI-digested DNA from a correctly targeted embryonic stem (ES) cell clone following hybridization with a probe specific to the neo gene (lane 2). Lane 1 of (D) shows 2.0- and 2.3-kbp markers. (E, F): Northern blot analyses of RNA derived from wt ES cells (lane 1), an ES cell clone that was correctly targeted with the Mcm2-IRES-CreERT2 construct in which the cryptic polyadenylation site was deleted (lane 2), and an ES cell clone in which the cryptic polyadenylation site is present (lane 3). The blot in (E) was annealed to a probe derived from Mcm2 cDNA, where arrows indicate the ~3.2-kbp wt Mcm2 transcript (bottom) and the ~7-kbp Mcm2IRES-CreERT2 transcript (top). The blot in (F) was annealed to a probe derived from CreERT2, where the arrow indicates the approximately 7-kbp Mcm2IRES-CreERT2 transcript. Abbreviations: EGFP, enhanced green fluorescence protein; Ex, exon; IRES, internal ribosome entry site; wt, wild-type.

 
Blastocyst injection was performed by the Roswell Park Cancer Institute (RPCI) transgenic mouse core. The resulting chimeric males were mated with wild-type 129/Sv females, and DNAs derived from the tails of progeny were screened for the presence of the Mcm2{Delta}pA-IRES-CreERT2 allele by Southern blotting (using EcoRI digestion a neo-specific probe fragment) and PCR analysis (using neo-forward, TGATATTGCTGAAGAGCTTGGCGG, and mcm2-r, AAGCAGCCAGAGATGACCTGTGAA, which amplify a 1,318-bp product for the knocked-in Mcm2 allele) to establish founder lines. Lines were maintained as heterozygotes on 129/Sv or in some cases crossed with Tg(ACTB-Bgeo/GFP)21Lbe (Z/EG) mice carried on a C57BL/6J background. In cases where tamoxifen was administered, 4-hydroxytamoxifen (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) was dissolved at 10.0 mg/ml in sunflower seed oil, and 100 µl (1 µg) was injected subcutaneously daily for 3 days unless otherwise indicated.

Reticulocyte Micronuclei Assay
Micronuclei were scored in peripheral blood by microscopy-based analysis using supravital acridine orange staining essentially as described [10].

Western Blot Analysis
Mouse embryonic fibroblasts (MEFs) were prepared from embryonic day (E) 14.5 siblings with Mcm2wild-type (wt)/wt, Mcm2wt/IRES-CreERT2, and Mcm2IRES-CreERT2/IRES-CreERT2 genotypes. Protein extracts were prepared from a 75-cm flask of passage 3 cells. Fifty micrograms of extract per sample was used in 6% polyacrylamide gel electrophoresis, and proteins were electroblotted to nitrocellulose membranes and blocked in 3% bovine serum albumin and 0.1% Tween 20 in phosphate-buffered saline. Membranes were incubated with a 1:3,000 dilution of primary antibodies (mouse anti-Mcm2, Transduction Laboratories [Lexington, KY, http://www.bdbiosciences.com/pharmingen]; mouse anti-Mcm7, Santa Cruz Biotechnology Inc. [Santa Cruz, CA, http://www.scbt.com]; mouse anti-β-actin, Sigma-Aldrich) at 12°C overnight, and binding was detected using a goat anti-mouse horseradish peroxidase-conjugated antibody and enhanced chemiluminescence (GE Healthcare, Little Chalfont, Buckinghamshire, U.K., http://www.gehealthcare.com).

Nucleoside Analog Labeling, Immunohistology, and H2AX Focus Assay
5-Chloro-2'-deoxyuridine (CldU) and 5-iodo-2'-deoxyuridine (IdU) labeling and immunohistological steps for detection of Mcm2 (using mouse or goat anti-Mcm2 antibodies [Transduction Laboratories and Santa Cruz Biotechnology, respectively]) were performed as described previously [8, 11]. H2AX foci were assayed using passage 2 cells derived from the tibialis anterior muscles as described previously [12]. Cells were methanol-fixed; permeabilized with 0.1% Triton X-100 in phosphate buffered saline (PBS); stained for Ser139-phosphorylated histone H2AX using mouse anti-phospho-Ser139 H2AX antibody (Upstate, Charlottesville, VA, http://www.upstate.com) at a dilution of 1:1,000, which was then detected with Alexa Fluor-conjugated secondary antibodies (Santa Cruz Biotechnology); and counterstained with 4,6-diamidino-2-phenylindole (DAPI). The numbers of foci per nucleus were determined from digital images.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Transgenic Mouse Construction
A transgenic mouse line in which expression of the tamoxifen-inducible Cre recombinase gene CreERT2 [7] is directed by the Mcm2 gene was constructed using a knock-in approach. The starting point for this construct was pMcm2-IRES-EGFP, in which an IRES-EGFP cassette is inserted into the 3'-untranslated region of the Mcm2 gene. Following targeted recombination into the endogenous Mcm2 gene, this construct has previously been shown to express EGFP in stem/progenitor cells of a variety of tissues [8]. Nonetheless, in the present study, correctly targeted W4 ES cells lines carrying a parallel construct in which the CreERT2 gene was substituted for EGFP failed to express Cre recombinase transcripts as assayed by either Northern blot analysis or reverse transcription PCR assays. Sequencing of 3'rapid amplification of cDNA ends products suggested that the reason for the lack of CreERT2 recombinase expression was the presence of a cryptic polyadenylation site located at position 2,920–2,925 in the 3'-untranslated sequence of the Mcm2 message (Fig. 1B; data not shown). Although use of this polyadenylation site is not detected in Mcm2-IRES-EGFP ES cells or mice [8], it becomes the predominant polyadenylation site when the CreERT2 gene is substituted for EGFP (data not shown). This is despite the fact that the substitution occurs at a position approximately 1 kbp 3' to the polyadenylation site and the intervening sequences are identical. To prevent the use of this site, the sequence between the BstEII site at 2,802 and a BamHI site, located 17 bp 3' to the XbaI site in Figure 1, was deleted in the Mcm2-{Delta}pA-IRES-CreERT2 construct. This modification resulted in expression of CreERT2 transcripts in correctly targeted W4 ES cells (Fig. 1F). Transgenic mice carrying the Mcm2-{Delta}pA-IRES-CreERT2 transgene were generated by blastocyst injection and are referred to below as Mcm2IRES-CreERT2 mice.

Bigenic Mcm2IRES-CreERT2/wt x Z/EG Reporter Mice Allow Tamoxifen-Inducible EGFP Expression in Stem/Progenitor Cells of Multiple Tissues
To determine whether CreERT2 expression from the Mcm2 promoter would allow genetic manipulation within the stem/progenitor cells of adult tissues, heterozygous Mcm2IRES-CreERT2/wt mice were crossed with mouse lines that carry Cre-dependent EGFP (Z/EG mice [9]) or in some cases lacZ (not shown) reporters. Prior studies have shown that, when Z/EG mice were crossed with mice expressing CreERT2 from a constitutive promoter, tamoxifen-dependent Cre-mediated EGFP expression occurs in a variety of different embryonic and adult somatic tissues where the frequency of recombination typically ranged from 5% to 10% [12]. In the present study, expression of EGFP in various tissues was monitored in bigenic Mcm2IRES-CreERT2/wt x Z/EG mice that had been treated with tamoxifen followed by a 15-day chase in the absence of tamoxifen (Fig. 2). EGFP expression was observed in most tissues in these mice in a pattern that is consistent with expression in a subset of stem/progenitor cells and their differentiated progeny. The proportion of cells expressing EGFP in different tissues varied, consistent with the distribution of stem/progenitor cells within the different tissues. It can be estimated that ~2%–10% of the stem/progenitor cells within most tissues underwent Cre-mediated recombination depending on the concentration of tamoxifen and route of administration. For example, in Figure 2G, 2I, and 2J, approximately 1/5 of the small intestine crypts exhibit EGFP expression. Each crypt contains between 6 and 8 intestinal stem cells [13]. Furthermore, the length of time between tamoxifen-induced recombination and the point at which the mice were assayed was sufficient that all of the EGFP-expressing cells present in the small intestine must be derived from an EGFP-expressing stem cell. Hence, it can be estimated that approximately 2%–3% of the stem cells have undergone Cre-mediated recombination. Consistent with this estimate, approximately 3% of clonogenically isolated neurospheres (prepared as described in [11]), derived from bigenic Mcm2IRES-CreERT2/wt x Z/EG mice treated with tamoxifen as above, expressed EGFP (e.g., Fig. 2D). No EGFP expression was observed in any tissue of control animals carrying both Mcm2IRES-CreERT2 and the Cre-dependent reporter in the absence of tamoxifen (e.g., Fig. 2H, small intestine). These data demonstrate that the Mcm2IRES-CreERT2 transgene provides a useful means of conditionally modifying the genomes of a subset of adult somatic stem cells in a wide variety of tissues.


Figure 2
View larger version (89K):
[in this window]
[in a new window]

 
Figure 2. Tamoxifen-dependent enhanced green fluorescence protein (EGFP) expression in Mcm2-IRES-CreERT2 x Z/EG reporter mice. Six-week-old mice heterozygous for both Mcm2-IRES-CreERT2 and a Cre-dependent EGFP reporter (Z/EG) [9] were treated with five injections of 4-hydroxy-tamoxifen over a period of 10 days (except [H], which is from a mouse with the same genotype but not receiving tamoxifen). Fifteen days following the final tamoxifen treatment, mice were assessed for EGFP expression by fluorescence stereomicroscopy (A–C, G–K), compound microscopy (E, F), or inverted microscopy (D). (A): Tongue. (B): Hair follicles from the tail. (C): Ventricle (outlined with white dots). (D): Neurosphere derived from the brain of a tamoxifen-treated mouse following 10 days of growth in vitro. (E, F): Bone marrow at lower and higher magnifications respectively. (G, H): External views of small intestines from tamoxifen-treated and untreated mice, respectively. (I, J): Small intestine villi photographed from the side or from the top. (K): Colonic crypts photographed from the top.

 
Mcm2IRES-CreERT2/IRES-CreERT2 Mice Are Viable and Develop Normally but Die Prematurely from Cancers
In prior studies, integration of IRES-EGFP into the 3'-untranslated region of the Mcm2 gene was shown not to significantly affect Mcm2 expression levels [8]. Mice carrying the Mcm2-IRES-EGFP transgene could be bred to homozygosity and with no phenotypic effect and normal longevity. In contrast, homozygous Mcm2IRES-CreERT2/IRES-CreERT2 mice exhibit a very different phenotype. These mice are born at the expected frequency and develop normally through early adulthood. However, beginning at approximately 9 weeks of age, animals become moribund, and most do not survive beyond 12 weeks; the longest-surviving animal to date was 21 weeks old (Fig. 3A).


Figure 3
View larger version (52K):
[in this window]
[in a new window]

 
Figure 3. The Mcm2-IRES-CreERT2 allele results in hypomorphic Mcm2 expression and results in high rates of cancer in homozygous mice. (A): Survival of wt (n = 14), wt/Cre (n = 14), and Cre/Cre (n = 14) transgenic mice as a function of age in weeks. (B): Frequency of micronuclei in reticulocytes of wt (n = 3) and Cre/Cre (n = 3) mice. (C): Western blot analysis of protein extracts from wt-, wt/Cre-, and Cre/Cre-derived MEF cells for Mcm2, Mcm7, and β-actin as indicated. (D): Densitometric quantification of Mcm2 and Mcm7 expression normalized against β-actin levels. Abbreviations: Cre/Cre, Mcm2IRES-CreERT2/IRES-CreERT2; wt/Cre, Mcm2IRES-CreERT2/wt; wt, wild-type.

 
The constellation of symptoms that accompany morbidity include a hunched appearance, rapid shallow respiration, generalized muscle weakness, limited movement, loss of adipose tissue, frailty, and (in some cases) modest hair loss or slight graying. Most animals die approximately 2–3 weeks after the appearance of respiratory symptoms. Necropsy of symptomatic homozygous animals carried on the 129/Sv genetic background revealed that most had extensive thymomas that filled the thoracic cavity (likely the cause of death). Many of the animals also exhibited an enlarged spleen, and several also exhibited polyps in both the small intestine and colon. No abnormalities in mammary glands of female mice were found.

Homozygous Mcm2IRES-CreERT2/IRES-CreERT2 Mice Exhibit Reduced Levels of Mcm2 and Modest Levels of Genomic Instability
Northern blot analysis suggested that the level of the Mcm2IRES-CreERT2 transcript (~7 kb) was reduced relative to that of Mcm2 (~3.3 kb). However, the large difference in transcript size prevented a quantitative comparison. To define Mcm2 expression levels, Western blot analysis was performed on Mcm2wt/wt, Mcm2wt/IRES-CreERT2, and Mcm2IRES-CreERT2/IRES-CreERT2 embryos (not shown) and passage 3 MEFs (derived from E14.5 embryos; Fig. 3C, 3D). These studies showed that Mcm2 protein levels were reduced in McmIRES-CreERT2 heterozygotes and homozygotes to 62% or 35% of wild-type levels. Despite the reduced level of Mcm2 expression, no difference in the size of Mcm2wt/IRES-CreERT2 or Mcm2IRES-CreERT2/IRES-CreERT2 embryos was observed relative to wild-type embryos. In addition, the passage time for MEFs derived from Mcm2wt/IRES-CreERT2 or Mcm2IRES-CreERT2/IRES-CreERT2 embryos was similar to that of MEFs derived from wild-type embryos through passage 5. Finally, expression of the related protein Mcm7, which is a component of the heterohexamer prereplication complex [1416], was assayed, showing a modest reduction to 79% or 73% of wild-type levels in MEFs from heterozygotes and homozygotes, respectively.

To determine whether the reduced expression of Mcm2 was affecting chromosomal stability, a reticulocyte micronucleus assay was used [10]. Comparison of wild-type and Mcm2IRES-CreERT2/IRES-CreERT2 mice demonstrated an approximately 2.5-fold increase in the number of micronuclei present in peripheral blood erythrocytes (Fig. 3B).

Stem/Proliferative Cells Are Deficient in Multiple Tissues of Homozygous Mcm2IRES-CreERT2/IRES-CreERT2 Mice
Despite the observation that most Mcm2IRES-CreERT2/IRES-CreERT2 mice exhibit tumors and that this is generally the cause of death, the mice showed a spectrum of additional phenotypes characteristic of age-related dysfunction. One potential explanation for these additional phenotypes is that reduced Mcm2 expression has a general effect on proliferating cells within multiple tissues. To determine the effect of Mcm2 deficiency on somatic stem cells and proliferative progenitors, three tissues, the subventricular zone (SVZ) of the brain, skeletal muscle, and small intestine, were examined.

To assess cell proliferation within the SVZ, wild-type and Mcm2IRES-CreERT2/IRES-CreERT2 mice were administered IdU for a period of 3 days and CldU 2 hours prior to examination. Histological sections were prepared and stained for IdU, CldU, and Mcm2. In prior studies, we [8, 11] and others [1722] have shown that this combination of double-nucleoside analog labeling in conjunction with staining for Mcm2 expression provides an effective means of estimating the rate of cycling of the proliferative progenitors and distinguishing slowly dividing stem cells from more rapidly dividing proliferative progenitors. Most proliferative progenitors cycle at a rate of approximately once every 12.7 hours [23] and, in wild-type mice, are labeled with IdU over the 3-day labeling period. Those proliferative progenitors that are in S-phase during the 2-hour period prior to sacrifice will be labeled with CldU, providing a measure of the rate of cycling of these cells. Cells that have not cycled over a 3-day period but continue to express Mcm2 are putative stem cells, as evidenced by (a) the ability of such cells to re-enter the cell cycle in long-term labeling experiments [11], (b) the lack of an effect of AraC treatment on this population of cells and the ability of these cells to repopulate the SVZ following AraC removal [11], (c) expression of Musashi [11] and Sox2 [19] in the Mcm2+/IdU– cells in situ, and (d) the observation that neurosphere-forming cells reside in the EGFP-positive fraction of cells derived from Mcm2IRES-EGFP mice [8].

Immunohistological images are shown for wt and Mcm2IRES-CreERT2/IRES-CreERT2 SVZs in Figure 4A–4F. The density of nuclei within the SVZs of Mcm2IRES-CreERT2/IRES-CreERT2 mice was substantially reduced relative to wild-type. Furthermore, the number of cells incorporating either CldU or IdU was reduced to approximately one-third the number in wild-type mice (Fig. 4G) such that the proportion of IdU+ cells that also express CldU was similar or slightly higher in Mcm2IRES-CreERT2/IRES-CreERT2 mice relative to wild-type (Fig. 4H). This observation suggests that despite the reduced intensity of Mcm2 staining over the nuclei from Mcm2IRES-CreERT2/IRES-CreERT2 mice (Fig. 4C [wild-type] compared with Fig. 4F [mutant]), the rate of division of the proliferative progenitors in the mutant mice was at least as high as in wild-type mice. In parallel with the reduction in nucleoside analog incorporation, the number of Mcm2+/IdU– cells was also reduced such that there were approximately one-third as many Mcm2+/IdU– cells in Mcm2IRES-CreERT2/IRES-CreERT2 mice as in wild-type mice (Fig. 4I). Finally, the frequency of neurosphere formation in vitro was determined using a clonogenic assay [11]. Consistent with immunohistological studies, the number of neurospheres resulting from Mcm2IRES-CreERT2/IRES-CreERT2 mice was approximately one-third of that from wild-type mice (Fig. 4J). Despite this reduction, no effect on the size of the neurospheres was evident between wild-type and Mcm2IRES-CreERT2/IRES-CreERT2 mice (not shown). Together, these studies demonstrate that neurogenesis within the SVZ of Mcm2IRES-CreERT2/IRES-CreERT2 is significantly reduced, and similar to the case for aged mice [11], this reduction is a consequence of a reduced number of neural stem cells rather than a reduced rate of cycling of the proliferative progenitors.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
Figure 4. Effect of hypomorphic Mcm2 expression on subventricular zone (SVZ) neurogenesis. (A–F): Immunofluorescent-stained paraffin sections from the same region of the SVZ of wt (A–C) or Mcm2IRES-CreERT2/IRES-CreERT2 (D–F) mice. (A, D): IdU (red) and 4,6-diamidino-2-phenylindole (blue); (B, E): IdU (red) and CldU (green); (C, F): Mcm2 (green) and IdU (red). (G): Quantification of the number of CldU+ and IdU+ cells present over an interval of 0.5 mm along the SVZ as indicated. (H): Percentage of IdU-labeled cells that are also labeled with CldU for wt (black columns) or Mcm2IRES-CreERT2/IRES-CreERT2 (gray columns) mice. (I): number of Mcm2+ cells and number of Mcm2+ cells that failed to stain for IdU (Mcm2+/IdU–) over an interval of 0.5 mm along the SVZ for wt (black columns) and Mcm2IRES-CreERT2/IRES-CreERT2 (gray columns) mice. (J): Number of neurospheres forming in a clonogenic assay from the brains of wt (black columns, n = 3) or Mcm2IRES-CreERT2/IRES-CreERT2 (gray columns, n = 3) mice. Abbreviations: cre, Mcm2IRES-CreERT2/IRES-CreERT2; wt, wild-type.

 
To examine the effect of Mcm2 deficiency on proliferative cells within the skeletal muscle, myoblasts were recovered from the tibialis anterior muscles of 8-week-old wild-type and Mcm2IRES-CreERT2/IRES-CreERT2 mice and plated to microtiter wells. Following 6 days in culture, the number of cells per well was determined and is plotted in Figure 5A. Approximately 1/10 as many cells were present in cultures derived from Mcm2IRES-CreERT2/IRES-CreERT2 mice relative to wild-type animals. To determine whether the difference resulted from a difference in cell cycle time, cells were reseeded at a constant number, and the number of cells per well was followed over a period of 6 days for eight cultures each of cells derived from mutant and wild-type animals. No difference in doubling time was observed, suggesting that the difference in plating efficiency in primary cultures resulted from the presence fewer myogenic cells in the muscles of Mcm2IRES-CreERT2/IRES-CreERT2 mice in vivo (Fig. 5B). Despite the similar growth rates, examination of H2AX foci, which accumulate at sites of double-strand breaks during DNA repair [24], demonstrates that there is a higher frequency of foci in cells derived from Mcm2IRES-CreERT2/IRES-CreERT2 mice than in cells derived from Mcm2wt/wt mice (Fig. 5C–5E).


Figure 5
View larger version (20K):
[in this window]
[in a new window]

 
Figure 5. Effect of hypomorphic Mcm2 expression on the number and growth rate of muscle satellite cells and the frequency of {gamma}-H2AX foci. (A): Number of colonies forming in a clonogenic assay of cells derived from the anterior tibialis muscle of wt (black column) or Mcm2IRES-CreERT2/IRES-CreERT2 (gray column) mice. (B): Doubling rate of cells following secondary passage from colonies derived from anterior tibialis muscle of wt (diamonds, solid line) or Mcm2IRES-CreERT2/IRES-CreERT2 (squares, dashed line) mice. (C, D): Images of passage 2 muscle satellite cells stained for the presence of {gamma}-H2AX foci (red) and 4,6-diamidino-2-phenylindole (blue); (C): wt; (D): Mcm2IRES-CreERT2/IRES-CreERT2. (E): Quantification of the frequency of {gamma}-H2AX foci from four cultures derived from two different mice of each genotype (wt, black column; Mcm2IRES-CreERT2/IRES-CreERT2, gray column), where between 100 and 250 nuclei were assayed per sample. Abbreviation: wt, wild-type.

 
Finally, the effect of Mcm2 deficiency on small intestinal crypts was examined. For these experiments, Mcm2wt/wt and Mcm2IRES-CreERT2/IRES-CreERT2 mice were administered IdU for a period of 2 days and injected with CldU 2 hours prior to sacrifice. Histological sections were prepared and assayed for IdU, CldU, and Mcm2 as before. The overall morphology of crypts and villi within the small intestine of Mcm2IRES-CreERT2/IRES-CreERT2 mice appeared disorganized relative to wild-type mice (compare Fig. 6A and 6B with Fig. 6D and 6E, particularly in the region near to the tops of the crypts). Nonetheless, the number of IdU- and CldU-labeled cells was similar between each of these genotypes, suggesting that the rate of cycling and overall rate of generation of cells was not affected in Mcm2IRES-CreERT2/IRES-CreERT2 mice. Furthermore, there was very little difference in the distribution of CldU-labeled cells within the crypts as a function of position from the base of the crypt (Fig. 6C, 6F). Mcm2 expression levels were reduced, and the region of the crypts over which Mcm2 was detectable was limited to more basal cell positions relative to wild-type or heterozygous mice (Fig. 6C, 6F). Nonetheless, the large majority of cell division occurred within even this reduced Mcm2 expression domain in wild-type and Mcm2IRES-CreERT2/IRES-CreERT2 mice.


Figure 6
View larger version (79K):
[in this window]
[in a new window]

 
Figure 6. Effect of hypomorphic Mcm2 expression on intestinal crypt morphology and proliferation. (A–F): Derived from an experiment in which wild-type or Mcm2IRES-CreERT2/IRES-CreERT2 mice were administered IdU in their drinking water for a period of 2 days and CldU by injection 2 hours prior to sacrifice. Immunofluorescence images of the same regions of wild-type (A, B) and Mcm2IRES-CreERT2/IRES-CreERT2 (D, E) mice stained for CldU (green) and IdU (red) (A, D) or Mcm2 (red) (B, E). 4,6-Diamidino-2-phenylindole (DAPI) is shown in blue for each set. (C, F): Quantifications of the proportion of CldU, IdU, and Mcm2+ at different nuclear positions from the base of the crypts where 18 crypts were assessed for each point. (G–P): Derived from an experiment in which Mcm2IRES-CreERT2/wt x Z/EG and Mcm2IRES-CreERT2/IRES-CreERT2 x Z/EG mice were first administered tamoxifen at approximately 6 weeks of age, following a resting period of 1 month in the absence of any treatment; mice were then administered IdU in their drinking water for a period of 2 days and CldU by injection 2 hours prior to sacrifice. Small intestine whole mounts were examined by stereofluorescence microscopy for enhanced green fluorescence protein (EGFP) expression (G–J), where (G) is from an Mcm2IRES-CreERT2/wt x Z/EG mouse and (H–J) are from an Mcm2IRES-CreERT2/IRES-CreERT2 x Z/EG mouse. (K–P): Immunofluorescence images of crypts, where (K) is from an Mcm2IRES-CreERT2/wt x Z/EG mouse and (L–P) are from an Mcm2IRES-CreERT2/IRES-CreERT2 x Z/EG mouse. (L–O): From the same region; (P): from a different region. Stains were as follows: (K): EGFP (green) and DAPI (blue); (L): EGFP (green); (M): EGFP (green) and DAPI (blue); (N): CldU (green) and DAPI (blue); (O): IdU (red) and DAPI (blue); and (P): EGFP (green) and IdU (red). Arrows marked by an asterisk (K–P) indicate EGFP-positive cells within the crypt, and arrows without an asterisk (L–O) indicate EGFP-negative cells within the crypt that had incorporated CldU and IdU as shown in (N, O). (P): Composite of three serial sections showing EGFP expression (green) in cells near the top of the villi and in a single quiescent EGFP-positive cell at the base of the crypt despite the presence of IdU-labeled cells (red) throughout the crypt, demonstrating that stem cell quiescence is maintained in at least some crypts within Mcm2IRES-CreERT2/IRES-CreERT2 mice, similar to the situation in wild-type mice (K). Abbreviations: CldU, 5-chloro-2'-deoxyuridine; IdU, 5-iodo-2'-deoxyuridine.

 
To further examine the consequences of Mcm2 deficiency in the small intestinal crypts, Mcm2wt/IRES-CreERT2 and Mcm2IRES-CreERT2/IRES-CreERT2 mice carrying a Cre-dependent EGFP reporter were generated using the Z/EG reporter line. Mice were treated with tamoxifen at 6 weeks of age and rested for 1 month prior to assaying for EGFP expression. This resting period is sufficient to allow cells in which recombination had occurred in proliferative progenitors to be lost from the tissue, ensuring that any EGFP-expressing cells are the progeny of an EGFP-expressing stem cell. Since Cre-dependent recombination is incomplete in these mice, in most crypts, EGFP expression occurs in only a single stem cell and its progeny. Comparison of EGFP-expressing crypts in mice that were heterozygous or homozygous for the Mcm2-IRES-CreERT2 allele by stereofluorescence microscopy revealed a difference in the proportion of marked cells within those crypts exhibiting EGFP expression. In heterozygous mice, only a subset of cells within a crypt expressed EGFP, and the progeny of these cells formed continuous EGFP-expressing runs that were as much as half of the length of the villus (Figs. 2G, 2I, 2J, 6G). In contrast, in Mcm2IRES-CreERT2/IRES-CreERT2 mice, when EGFP-expressing cells were present within the crypt, they generally constituted the majority of the cells (Fig. 6H, 6I, 6L, 6M). In cases where EGFP-expressing cells had migrated to the adjacent villi, runs of positive cells were typically shorter than in Mcm2IRES-CreERT2/wt mice but made up a larger fraction of the labeled villus (Fig. 6J). These observations are consistent with either a longer period of quiescence between stem cell divisions or the presence of fewer stem cells per crypt in Mcm2IRES-CreERT2/IRES-CreERT2 relative to Mcm2wt/IRES-CreERT2 mice.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Inducible Genetic Rearrangement in Adult Stem/Progenitor Cells
A major purpose of the present work was to develop a transgenic line of mice in which tamoxifen-inducible Cre recombinase is expressed from the endogenous Mcm2 gene. Based on previous studies [8, 11], this strain of mice is anticipated to allow tamoxifen-dependent genetic manipulation within stem/proliferative progenitor cells present within multiple tissues of the adult mouse. By crossing mice expressing CreERT2 from the Mcm2 promoter with the Z/EG reporter line [9] of mice, we have shown that no recombination was detectable in a variety of different tissues in the absence of tamoxifen treatment. Following tamoxifen treatment, EGFP expression was detectable in a large number of different tissues, including endodermal, mesodermal, and neuroectodermal derivatives. In each case, only a subset, ranging between ~2% and 10%, of the stem/progenitor cells, were marked. Nonetheless, for many studies where the effects of a particular genetic manipulation on stem/progenitor cells is under study, recombination within only a subset of cells is sufficient, and often useful, particularly in conjunction with a Cre-dependent reporter to allow identification of those cells in which recombination has occurred. To date, no phenotypic effects of the Mcm2IRES-CreERT2 transgene have been observed when it is present in approximately 1-year-old heterozygous mice that also carry a wild-type Mcm2 allele. However, based on the finding that the Mcm2IRES-CreERT2 allele is hypomorphic for Mcm2 expression, we cannot eliminate the possibility that subtle phenotypes occur within some tissues of young mice or that more severe phenotypes will become apparent as the animals age.

Mcm2 Deficiency Results in a Different Spectrum of Cancer than Hypomorphic Mcm4
The Mcm2IRES-CreERT2 allele expresses approximately 35% of the level of Mcm2 of the wild-type allele. Although this reduction has no detectable phenotype in heterozygous Mcm2wt/IRES-CreERT2 mice, a severe phenotype was observed in Mcm2IRES-CreERT2/IRES-CreERT2 mice. All homozygous animals carrying the Mcm2IRES-CreERT2 allele (more than 50) generated to date developed normally and were phenotypically indistinguishable from their liter mates through ~2 months of age. However, all of these animals, both male and female, died as young adults, mostly within 3 months of age, where the oldest surviving animals lived to only 21 weeks. The immediate cause of death in most cases was T- and B-cell lymphoma. However, polyps within the small intestine and colon were also observed; in several instances, death or morbidity occurred in the absence of an overt tumor, and the cause of death could not be determined.

The present results for Mcm2 deficiency contrast with those of a prior study of the phenotype resulting from a hypomorphic mutation in the structurally related gene, Mcm4 [6]. The mutation, Chaos3, was identified in an N-ethyl-N-nitrosourea mutagenesis screen for mice showing chromosome instability in a reticulocyte micronuclei assay. The mutation leading to the phenotype was genetically mapped to the Mcm4 locus. Sequencing Mcm4 cDNA derived from mice homozygous for Chaos3 identified a point mutation resulting in an amino acid change from phenylalanine to isoleucine at residue 345 (F345I). Phenylalanine at this position is conserved throughout eukaryotes and is important for interaction with other Mcms. Based on dose dependence of the Chaos allele in conjunction with an Mcm4-null allele, it was concluded that the Mcm4Chaos allele is a functional hypomorphic mutation in Mcm4. Similar to the Mcm2 expression hypomorph described here, the Mcm4Chaos3 allele led to elevated rates of cancer in homozygous Mcm4Chaos3/Chaos3 animals. However, these cancers were exclusively mammary adenocarcinomas, occurring in more than 80% of the females, with a mean latency of 12 months. In contrast, Mcm4Chaos3/Chaos3 males showed no increased incidence of cancer.

Mcm2IRES-CreERT2/IRES-CreERT2 mice show predominately T- and B-cell lymphomas. These tumor types have been associated with a variety of genes involved in the DNA damage response and repair pathways in the mouse [1, 2, 25, 26], consistent with a general effect of Mcm2 deficiency on genomic stability. Unlike the Mcm4Chaos3/Chaos3 mice, Mcm2-deficient mice do not shown a particular susceptibility to mammary tumors, suggesting that cancer in this tissue is not tightly linked to a defect in replication origin licensing per se. However, the early lethality due to T- and B-cell lymphomas may prevent detection of an effect of Mcm2 deficiency in mammary tissue.

There are several potential explanations for the phenotypic differences between Mcm2- and Mcm4-deficient mice. First, the genetic backgrounds on which the mutations have been studied are different, C3HeB/FeJ congenics in the case of Mcm4Chaos3/Chaos3 and 129/Sv in the case of Mcm2IRES-CreERT2/IRES-CreERT2. Second, it is known that Mcm2 is abundantly expressed in breast epithelial tissue [27, 28] and may not be limiting in this tissue even when reduced to one-third of its normal levels in Mcm2IRES-CreERT2/IRES-CreERT2 mice. Finally, the specific functions of Mcm2 and Mcm4 within the replication origin licensing complex differ. Mcm4 is a component of the Mcm4/6/7 core helicase complex, whereas Mcm2 and a dimer of Mcm3 and Mcm5 are less tightly associated [2933]. However an additional Mcm-binding protein (Mcm-BP) has been shown to substitute for Mcm2 in the larger complex and may be in competition with Mcm2 [34]. Unlike Mcm2, helicase activity of the Mcm4/6/7 core is not inhibited by Mcm-BP binding [34]. Hence, it is possible that decreasing the concentration of Mcm2 leads to an shift in the Mcm2:Mcm-BP ratio that has phenotypic consequences that are different from those resulting from a decrease in function of the Mcm4/6/7 core helicase. We note, however, that Mcm7 protein levels are decreased in MEFs derived from both Mcm2IRES-CreERT2/IRES-CreERT2 and Mcm4Chaos3/Chaos3 mice.

Insufficient Mcm2 Expression Results in Stem Cell Deficiency Consistent with a Segmental Aging Phenotype
In addition to the cancer phenotype, reduced levels of Mcm2 expression lead to severe stem cell deficiency in at least three different tissues: the SVZ of the brain, skeletal muscle, and the small intestinal crypt. In the SVZ and the small intestine, the rate at which most proliferating cells cycle in vivo, measured as the ratio of cells that were in S-phase at the time of sacrifice (CldU+) to those that had divided over a 3-day or 2-day period (IdU+), respectively, was not affected in Mcm2IRES-CreERT2/IRES-CreERT2 mice. Based on this result, we conclude that the rate of cell cycling within the proliferative progenitor compartment is largely unaffected. Similarly, the doubling time of muscle satellite cells in vitro was the same between cells derived from wild-type and Mcm2IRES-CreERT2/IRES-CreERT2 mice.

Even though the rate at which proliferative progenitors cycle is similar, there is an approximately three-fold reduction in the level of neurogenesis within the SVZ of Mcm2IRES-CreERT2/IRES-CreERT2 mice. This reduction is reflected in the number of actively cycling (CldU+) cells, the overall output of cells during a 3-day labeling period (IdU+) cells, the total number of replication-competent (Mcm2+) cells and a reduced nuclear density following DAPI staining. There is a corresponding reduction in the number of replication-competent but slowly cycling (Mcm2+/IdU–) cells and in the generation of neurospheres in vitro, suggesting that the decrease in neurogenesis results from a reduced number of neural stem cells within the SVZs of Mcm2IRES-CreERT2/IRES-CreERT2 mice. The extent of the reduction in young Mcm2IRES-CreERT2/IRES-CreERT2 mice (a factor of ~3 at 2 months of age) is more severe than was observed previously in aged wild-type mice (a factor of ~2 at 2 years of age [11]).

Similar to the situation for the SVZ, the number of colony-forming cells derived from the tibialis anterior muscle of Mcm2IRES-CreERT2/IRES-CreERT2 mice was greatly reduced relative to wild-type mice, despite similar growth rates once the cells were established in culture. These observations suggest that there was a reduction in the number of satellite cells in the muscles of Mcm2IRES-CreERT2/IRES-CreERT2 mice in vivo that may mimic an accelerated aging phenotype. Reduced numbers of satellite cells have been reported in aged muscle in a number of studies [3538].

Assessing the effect of hypomorphic Mcm2 expression on intestinal crypt stem cells is more problematic than for the SVZ or skeletal muscle. Culture conditions permitting clonogenic assays of intestinal crypt stem cells have not been established. However, prior studies based on nucleoside analog label retention [13] have suggested that each intestinal crypt contains approximately six to eight stem cells that cycle at a rate of approximately once every 24 hours. Hence, at any given time, the proliferative progenitors within a crypt are expected to derive from as many as three to four stem cells. Here, the ability to induce genetic rearrangements within the stem/proliferative progenitors present in adult tissues of Mcm2wt/IRES-CreERT2 mice and Mcm2IRES-CreERT2/IRES-CreERT2 mice was used to examine the effects of Mcm2 deficiency on intestinal crypt stem cells. In tamoxifen-treated Mcm2wt/IRES-CreERT2 mice x Z/EG reporter mice, the rate of recombination is relatively low and, following a sufficient resting period, EGFP-expressing cells present within a crypt are expected to derive from a single stem cell. In these mice, EGFP+ cells generally make up only a fraction of the total cells within the crypt. In contrast, in the crypts containing EGFP-marked cells of tamoxifen-treated Mcm2IRES-CreERT2/IRES-CreERT2 x Z/EG mice, in most cases, the majority of the proliferative region of crypt is EGFP+, consistent with derivation of most of the actively dividing cells from a single stem cell. This result implies that either the period of quiescence of stem cells in the small intestinal crypts of Mcm2IRES-CreERT2/IRES-CreERT2 mice is longer than in wild-type or that the number of stem cells per crypt is reduced.

The observation that Mcm2 deficiency results in elevated levels of Ser139-phosphorylated histone H2AX ({gamma}-H2AX) foci in cultured muscle satellite cells, even though cell growth rate is unaffected, provides a potential insight into the mechanism by which reduced Mcm2 expression leads to cancer and stem cell deficiency phenotypes. {gamma}-H2AX is known to accumulate at sites of double-strand DNA breaks or collapsed replication forks, and the presence of {gamma}-H2AX foci provides an index of the frequency of such events (reviewed in [39]). The observation that even wild-type cells generally exhibit multiple {gamma}-H2AX foci [40] (Fig. 5) suggests that such events are frequent and that multiple events occur with each cell division. The increase in {gamma}-H2AX foci in cells derived from Mcm2IRES-CreERT2/IRES-CreERT2 mice may reflect prior observations that reduced levels of replication licensing factors result in a reduction in the number of origins that are used and a corresponding increase in the distance that must be traversed by the DNA polymerase [41]. Furthermore, it is known that repair of double-strand breaks and collapsed replication forks can lead to genetic deletion events [1, 2]. Since repair of multiple double-strand breaks or collapsed replication forks is likely to occur simultaneously, the increase in such events as reflected by {gamma}-H2AX foci, from ~5 in wild-type cells to ~7.5 in Mcm2-deficient cells, may not result in a delay in cell cycling. This interpretation would be consistent with the lack of an effect of Mcm2 deficiency on embryogenesis or on the rate of cycling in the different somatic stem cell/proliferative progenitors studied here. Nonetheless, the increased numbers of such events would be expected to result in a higher accumulated level of genetic damage. Such damage could be responsible for the elevated rate of cancer and stem cell death/dysfunction observed in Mcm2IRES-CreERT2/IRES-CreERT2 mice.

Prior studies have shown that many genes regulating DNA damage repair and DNA damage response pathways affect the incidence of cancer and/or the rate of aging [15]. In particular, those defects in the repair of DNA lesions that lead to an overactive DNA damage response can compromise stem/progenitor cells, resulting in stem cell deficiency or dysfunction and a segmental aging phenotype. The importance of induction of the DNA damage response pathway to the phenotype resulting from mutations in DNA repair enzymes is illustrated by Brac1. Whereas a homozygous Brac1 hypomorphic mutation is embryonic lethal, this phenotype is partially rescued in the context of p53+/– or Chk2+/– mutations (although these mice still exhibit a premature aging phenotype) [42]. Similarly, hyperactive p53 function, alone, suppresses the incidence of cancer but also leads to an aging syndrome [43]. In contrast, compromising the ability to activate the DNA damage response (e.g., in the absence of p53 function) increases the rate of cancer [44]. The phenotypes observed here in Mcm2-deficient mice suggest that elevated levels of replication errors result in both increased cancer incidence and an increased rate of segmental aging in the context of intact DNA damage repair and response pathways. One issue that remains unaddressed is whether the Mcm2 deficiency affects stem cell populations directly, through genetic damage to critical genes, or indirectly, through the induction of a DNA damage response. Complementation studies to determine whether the stem cell deficiency phenotype, but not the elevated cancer incidence, is rescued in Mcm2-deficient mice in which the DNA damage response is also compromised may address this issue. Nonetheless, accumulated genetic damage from even modest changes in the function of the core DNA replication machinery could result in large phenotypic differences over the course of a life span.


    DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
S.C. Pruitt owns stock in and is the CEO of The Buffalo Molecular Target Laboratories.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
We thank P. Chambon for providing the CreERT2 gene and L. Mielnicki and A. Maslov for construction of plasmids used in preparation of the Mcm2 targeting construct. This work was supported in part by NIH (R01-AG020946) and Roswell Park Alliance Foundation grants (to S.C.P.). The RPCI Transgenic Core and Department of Laboratory Animal Resources assisted in blastocyst injections and maintenance of mice and were supported in part by a Comprehensive Cancer Center Support Grant (P30CA016056).


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 

  1. Lombard DB, Chua KF, Mostoslavsky R et al. DNA repair, genome stability, and aging. Cell 2005;120:497–512.[CrossRef][Medline]

  2. Park Y, Gerson SL. DNA repair defects in stem cell function and aging. Annu Rev Med 2005;56:495–508.[CrossRef][Medline]

  3. Campisi J. Senescent cells, tumour suppression, and organismal aging: Good citizens, bad neighbours. Cell 2005;120:513–522.[CrossRef][Medline]

  4. Hasty P, Vijg J. Accelerating aging by mouse reverse genetics: A rational approach to understanding longevity. Aging Cell 2004;3:55–65.[CrossRef][Medline]

  5. Baker DJ, Chen J, van Deursen JM. The mitotic checkpoint in cancer and aging: What have mice taught us? Curr Opin Cell Biol 2005;17:583–589.[CrossRef][Medline]

  6. Shima N, Alcaraz A, Liachko I et al. A viable allele of Mcm4 causes chromosome instability and mammary adenocarcinomas in mice. Nat Genet 2007;39:93–98.[CrossRef][Medline]

  7. Feil R, Brocard J, Mascrez B et al. Ligand-activated site-specific recombination in mice. Proc Natl Acad Sci U S A 1996;93:10887–10890.[Abstract/Free Full Text]

  8. Maslov AY, Bailey KJ, Mielnicki LM et al. Stem/progenitor cell-specific enhanced green fluorescent protein expression driven by the endogenous mcm2 promoter. STEM CELLS 2007;25:132–138.[Abstract/Free Full Text]

  9. Novak A, Guo C, Yang W et al. Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision. Genesis 2000;28:147–155.[CrossRef][Medline]

  10. Hayashi M, Morita T, Kodama Y et al. The micronucleus assay with mouse peripheral blood reticulocytes using acridine orange-coated slides. Mutat Res 1990;245:245–249.[CrossRef][Medline]

  11. Maslov AY, Barone TA, Plunkett RJ et al. Neural stem cell detection, characterization and age related changes in the sub-ventricular zone of mice. J Neurosci 2004;24:1726–1733.[Abstract/Free Full Text]

  12. Guo C, Yang W, Lobe CG. A Cre recombinase transgene with mosaic, widespread tamoxifen-inducible action. Genesis 2002;32:8–18.[CrossRef][Medline]

  13. Potten CS, Owen G, Booth D. Intestinal stem cells protect their genome by selective segregation of template DNA strands. J Cell Sci 2002;115:2381–2388.[Abstract/Free Full Text]

  14. Tye BK. MCM proteins in DNA replication. Annu Rev Biochem 1999;68:649–686.[CrossRef][Medline]

  15. Forsburg SL. Eukaryotic MCM proteins: Beyond replication initiation. Microbiol Mol Biol Rev 2004;68:109–131.[Abstract/Free Full Text]

  16. Lei M. The MCM complex: Its role in DNA replication and implications for cancer therapy. Curr Cancer Drug Targets 2005;5:365–380.[CrossRef][Medline]

  17. Dougherty JD, Garcia AD, Nakano I et al. PBK/TOPK, a proliferating neural progenitor-specific mitogen-activated protein kinase kinase. J Neurosci 2005;25:10773–10785.[Abstract/Free Full Text]

  18. Thom M, Martinian L, Sisodiya SM et al. Mcm2 labelling of balloon cells in focal cortical dysplasia. Neuropathol Appl Neurobiol 2005;31:580–588.[CrossRef][Medline]

  19. Brazel CY, Limke TL, Osborne JK et al. Sox2 expression defines a heterogeneous population of neurosphere-forming cells in the adult murine brain. Aging Cell 2005;4:197–207.[CrossRef][Medline]

  20. Mohan A, Kandalam M, Ramkumar HL et al. Stem cell markers: ABCG2 and MCM2 expression in retinoblastoma. Br J Ophthalmol 2006;90:889–893.[Abstract/Free Full Text]

  21. Zhang C, McNeil E, Dressler L et al. Long-lasting impairment in hippocampal neurogenesis associated with amyloid deposition in a knock-in mouse model of familial Alzheimer's disease. Exp Neurol 2007;204:77–87.[CrossRef][Medline]

  22. Fahrner A, Kann G, Flubacher A et al. Granule cell dispersion is not accompanied by enhanced neurogenesis in temporal lobe epilepsy patients. Exp Neurol 2007;203:320–332.[CrossRef][Medline]

  23. Morshead CM, van der Kooy D. Postmitotic death is the fate of constitutively proliferating cells in the subependymal layer of the adult mouse brain. J Neurosci 1992;12:249–256.[Abstract]

  24. Rogakou EP, Pilch DR, Orr AH et al. DNA. double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem 1998;273:5858–5868.[Abstract/Free Full Text]

  25. Donehower LA, Harvey M, Vogel HA Jr et al. Effects of genetic background on tumorigenesis in p53-deficient mice. Mol Carcinog 1995;14:16–22.[Medline]

  26. Jacks T, Remington L, Williams BO et al. Tumor spectrum analysis in p53-mutant mice. Curr Biol 1994;4:1–7.[Medline]

  27. Stoeber K, Tlsty TD, Happerfield L et al. DNA replication licensing and human cell proliferation. J Cell Sci 2001;114:2027–2041.[Abstract/Free Full Text]

  28. Shetty A, Loddo M, Fanshawe T et al. DNA replication licensing and cell cycle kinetics of normal and neoplastic breast. Br J Cancer 2005;93:1295–1300.[CrossRef][Medline]

  29. Ishimi Y. A DNA helicase activity is associated with an MCM4, -6, and -7 protein complex. J Biol Chem 1997;272:24508–24513.[Abstract/Free Full Text]

  30. Ishimi Y, Ichinose S, Omori A et al. Binding of human minichromosome maintenance proteins with histone H3. J Biol Chem 1996;271:24115–24122.[Abstract/Free Full Text]

  31. Lee J, Hurwitz J. Isolation and characterization of various complexes of the minichromosome maintenance proteins of Schizosaccharomyces pombe. J Biol Chem 2000;275:18871–18878.[Abstract/Free Full Text]

  32. Prokhorova TA, Blow JJ. Sequential MCM/P1 subcomplex assembly is required to form a heterohexamer with replication licensing activity. J Biol Chem 2000;275:2491–2498.[Abstract/Free Full Text]

  33. Sherman DA, Pasion SG, Forsburg SL. Multiple domains of fission yeast Cdc19p (MCM2) are required for its association with the core MCM complex. Mol Biol Cell 1998;9:1833–1845.[Abstract/Free Full Text]

  34. Sakwe AM, Nguyen T, Athanasopoulos V et al. Identification and characterization of a novel component of the human minichromosome maintenance complex. Mol Cell Biol 2007;27:3044–3055.[Abstract/Free Full Text]

  35. Brack AS, Bildsoe H, Hughes SM. Evidence that satellite cell decrement contributes to preferential decline in nuclear number from large fibres during murine age-related muscle atrophy. J Cell Sci 2005;118:4813–4821.[Abstract/Free Full Text]

  36. Gibson MC, Schultz E. Age-related differences in absolute numbers of skeletal muscle satellite cells. Muscle Nerve 1983;6:574–580.[CrossRef][Medline]

  37. Shefer G, van de Mark DP, Richardson JB et al. Satellite-cell pool size does matter: Defining the myogenic potency of aging skeletal muscle. Dev Biol 2006;294:50–66.[CrossRef][Medline]

  38. Collins CA, Zammit PS, Ruiz AP et al. A population of myogenic stem cells that survives skeletal muscle aging. STEM CELLS 2007;25:885–894.[Abstract/Free Full Text]

  39. Pilch DR, Sedelnikova OA, Redon C et al. Characteristics of gamma-H2AX foci at DNA double-strand breaks sites. Biochem Cell Biol 2003;81:123–129.[CrossRef][Medline]

  40. McManus KJ, Hendzel MJ. ATM-dependent DNA damage-independent mitotic phosphorylation of H2AX in normally growing mammalian cells. Mol Biol Cell 2005;16:5013–5025.[Abstract/Free Full Text]

  41. Masai H, You Z, Arai K. Control of DNA replication: Regulation and activation of eukaryotic replicative helicase, MCM. IUBMB Life 2005;57:323–335.[Medline]

  42. Cao L, Kim S, Xiao C et al. ATM-Chk2-p53 activation prevents tumorigenesis at an expense of organ homeostasis upon Brca1 deficiency. EMBO J 2006;25:2167–2177.[CrossRef][Medline]

  43. Tyner SD, Venkatachalam S, Choi J et al. p53 mutant mice that display early ageing-associated phenotypes. Nature 2002;415:45–53.[CrossRef][Medline]

  44. Donehower LA, Harvey M, Slagle BL et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 1992;356:215–221.[CrossRef][Medline]




This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Ibarra, E. Schwob, and J. Mendez
Excess MCM proteins protect human cells from replicative stress by licensing backup origins of replication
PNAS, July 1, 2008; 105(26): 8956 - 8961.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
2007-0483v1
25/12/3121    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pruitt, S. C.
Right arrow Articles by Freeland, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pruitt, S. C.
Right arrow Articles by Freeland, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS