First published online September 13, 2007
Stem Cells
Vol. 25 No.
12
December 2007, pp.
3244
-3251
doi:10.1634/stemcells.2007-0300; www.StemCells.com
© 2007 AlphaMed Press
TRANSLATIONAL AND CLINICAL RESEARCH |
Chondrogenic Potential of Human Adult Mesenchymal Stem Cells Is Independent of Age or Osteoarthritis Etiology
Alwin Scharstuhla,b,
Bernhard Schewec,
Karin Benza,
Christoph Gaissmaierc,
Hans-Jörg Bühringd,
Reinout Stoopa
aNMI Natural and Medical Sciences Institute at the University of Tübingen, Reutlingen, Germany;
bTETEC AG, Reutlingen, Germany;
cHospital for Workers Compensation Tübingen, Tübingen, Germany;
dUniversity Clinic of Tübingen, Department of Internal Medicine, Medical Research Center, Tübingen, Germany
Key Words. Mesenchymal stem cells • Differentiation • Isolation • Chondrogenic differentiation • Age-related • Etiology
Correspondence: Reinout Stoop, Ph.D., TNO Quality of Life, Biosciences, P.O. Box 2215, 2301 CE Leiden, The Netherlands. Telephone: +31 715181486; Fax: +31 715181901; e-mail: reinout.stoop{at}tno.nl
Received on April 24, 2007;
accepted for publication on August 25, 2007.
First published online in STEM CELLS EXPRESS September 13, 2007.
 |
ABSTRACT
|
|---|
Osteoarthritis (OA) is a multifactorial disease strongly correlated with history of joint trauma, joint dysplasia, and advanced age. Mesenchymal stem cells (MSCs) are promising cells for biological cartilage regeneration. Conflicting data have been published concerning the availability of MSCs from the iliac crest, depending on age and overall physical fitness. Here, we analyzed whether the availability and chondrogenic differentiation capacity of MSCs isolated from the femoral shaft as an alternative source is age- or OA etiology-dependent. MSCs were isolated from the bone marrow (BM) of 98 patients, categorized into three OA-etiology groups (age-related, joint trauma, joint dysplasia) at the time of total hip replacement. All BM samples were characterized for cell yield, proliferation capacity, and phenotype. Chondrogenic differentiation was studied using micromass culture and analyzed by histology, immunohistochemistry, and quantitative reverse transcriptase-polymerase chain reaction. Significant volumes of viable BM (up to 25 ml) could be harvested from the femoral shaft without observing donor-site morbidity, typically containing >107 mononuclear cells per milliliter. No correlation of age or OA etiology with the number of mononuclear cells in BM, MSC yield, or cell size was found. Proliferative capacity and cellular spectrum of the harvested cells were independent of age and cause of OA. From all tested donors, MSCs could be differentiated into the chondrogenic lineage. We conclude that, irrespective of age and OA etiology, sufficient numbers of MSCs can be isolated and that these cells possess an adequate chondrogenic differentiation potential. Therefore, a therapeutic application of MSCs for cartilage regeneration of OA lesions seems feasible.
Disclosure of potential conflicts of interest is found at the end of this article.
 |
INTRODUCTION
|
|---|
Osteoarthritis (OA) is the most common rheumatological disorder and affects over 70% of people over 65 years of age [1]. The etiology for OA is unknown, but multiple factors such as obesity, age, history of joint trauma, and joint dysplasia are thought to be involved. To date, there is no established cure for this disease and, because of aging of the population, the prevalence of OA is expected to increase. Typically, the majority of patients being considered for joint resurfacing is of advanced age and suffers from OA. Today, such patients are excluded from receiving chondrocyte transplantation for a number of reasons, among which a lack of healthy chondrocytes is a major constraint. Therefore, adult mesenchymal stem cells (MSCs) might represent an alternative source for cells with chondrogenic potential [2].
However, there is evidence to suggest that MSC numbers, proliferation rates, population-doubling potential, and predisposition to differentiate along various cell lineages may be altered in OA [3, 4]. Furthermore, although the availability of MSCs and their differentiation potential are well described for individuals <65 years old [2, 5, 6], contradictory results are described about the availability of MSCs in bone marrow (BM) from iliac crest or sternum of people over 65 years of age, the largest patient group that would be of interest with regard to biological repair of cartilage. Several publications have described an age-dependent reduction in the number of progenitor cells isolated from BM of humans [4, 7, 8], whereas others could not find such a relation between MSC number and age [3, 9, 10]. Concerning the differentiation capability of MSCs, both age-dependent [3, 8] and age-independent [3, 10–13] results were published.
This study aims to investigate not only whether availability and differentiation capacity of BM-derived MSCs are age-dependent but also whether they are affected by OA etiology (age-related, history of joint trauma, and joint dysplasia). Our results indicate that, regardless of the cause of OA, sufficient MSCs can be isolated, expanded, and differentiated in the chondrogenic lineage. Moreover, no correlation of age with the mononuclear cell number in BM or MSC yield after expansion was found. This suggests that MSCs could be an attractive cell source for the biological reconstruction of OA lesions in patients in the OA-relevant age group.
 |
MATERIALS AND METHODS
|
|---|
Donors
We studied MSC availability in BM harvested from the femur shaft of 98 patients undergoing a total hip replacement. All procedures were approved by the local ethics committee. These patients could be divided into four categories based on OA etiology: primary, age-related osteoarthritis (59 patients); post-traumatic (21 patients, fracture of the femoral neck or acetabulum); joint dysplasia (12 patients); or other etiologies (6 patients, mostly rheumatoid arthritis or osteonecrosis). Further details about the patient population are shown in Table 1, which also shows the characteristics of the cells used for phenotyping using fluorescence-activated cell sorting (FACS) analysis or for the investigation of the chondrogenic differentiation capacity of the cells.
Bone Marrow Harvesting/Mesenchymal Stem Cell Culturing
BM was collected from the opened femur shaft using a syringe and mixed with 5,000 U of heparin (Sigma-Aldrich, Taufkirchen, Germany, http://www.sigmaaldrich.com). Due to the large bone marrow volume within the femur shaft, approximately 25 ml of BM could be collected from each patient. The mononuclear cell fraction was isolated via density gradient centrifugation and seeded at a density of 2 x 105 per cm2 in expansion medium as described elsewhere [6] (60% low-glucose Dulbecco's modified Eagle's medium [DMEM; Invitrogen, Karlsruhe, Germany, http://www.invitrogen.com], 40% MCDB-201, insulin-transferrin-sodium selenite medium [ITS] supplement, 0.05 µM dexamethasone, 0.1 mM ascorbic acid 2-phosphate [all from Sigma-Aldrich], 100 U/ml penicillin, 100 µg/ml streptomycin, 2% fetal calf serum vol/vol [all from PAA Laboratories, Pasching, Austria, http://www.paa.at], 10 ng/ml epidermal growth factor, and 10 ng/ml platelet-derived growth factor-BB [both Strathmann Biotech, Hamburg, Germany, http://www.biotec-gmbh.de]). Cells were allowed to adhere for 48 hours at 37°C and 5% CO2, after which nonadherent cells were removed. Medium was changed twice per week. The number of MSCs in the mononuclear cell fraction was estimated by counting the number of adherent cell clones in a 10-cm2 dish 4 days after seeding 2 x 106 mononuclear cells per dish. Clones were defined as cell clusters that consisted of 15 cells or more. The cells reached
90% confluency after 9–11 days, after which the cells were detached using 0.25% trypsin/EDTA and used in experiments.
Phenotyping
The MSC phenotype was investigated using flow cytometry of cells isolated from 13 donors in the age-related group, 6 donors in the joint dysplasia group, and 6 donors in the post-traumatic group. For immunofluorescence analysis, cells were incubated on ice for 15 minutes with 10 µl of phycoerythrin (PE)-conjugated monoclonal antibodies directed against the indicated CD molecules. After staining, cells were washed twice with FACS buffer and used for flow cytometry analysis. Antibody conjugates against CD3, CD14, CD16, CD20, CD34, CD45, and CD235a (not expressed on MSCs) and CD10, CD73, CD90, CD109, CD140b, CD164, and C166 (positive in MSCs) were from BD Pharmingen (San Diego, http://www.bdbiosciences.com/index_us.shtml) [14]. CD105-PE was purchased from eBioscience Inc. (San Diego, http://www.ebioscience.com). In an additional set of measurements, surface expression of CD45 (negative in MSCs) and of CD73, CD164, and CD166 (positive in MSCs) was quantified using cryopreserved cells according to a previously described protocol [15]. Cells were analyzed either on a FACSCalibur or FACSCanto II flow cytometer (both from BD Biosciences, Heidelberg, Germany, http://www.bdbiosciences.com).
Chondrogenic Differentiation
Chondrogenic differentiation potential of the MSCs was investigated by micromass culture [12]. Briefly, a droplet containing 4 x 105 primary cells in 20 µl of chondrogenic induction medium (DMEM high glucose, 4.5 g/l [Invitrogen]), 100 U/ml penicillin, 100 µg/ml streptomycin, 4 mM L-glutamine, 1 mM sodium-pyruvate, 0.17 mM ascorbic acid 2-phosphate, 0.1 µM dexamethasone, 1x ITS supplement, 0.35 mM L-proline (all from Sigma-Aldrich), and 10 ng/ml transforming growth factor-β3 (Strathmann Biotech) was carefully placed in the middle of a well of a 48-well plate. Cells were allowed to adhere for 2 hours, followed by addition of 500 µl of chondrogenic induction medium. Micromasses were cultured for 21 days, after which the differentiation status of the cells was determined using mRNA analysis and histology.
RNA Isolation/DNase Digestion/Reverse Transcriptase Reaction
mRNA was isolated with peqGOLD TriFast (Peqlab Biotechnologie, Erlangen, Germany, http://www.peqlab.de) according to the manufacturer's recommendations. After treatment with RQ1-DNase (Promega, Mannheim, Germany, http://www.promega.com), random hexameric primers, dNTP mix (Amersham Biosciences, Freiburg, Germany, http://www.amersham.com), and recombinant RNasin (10 units; Promega) were added to the samples and incubated for 5 minutes at 65°C, followed by cooling for 10 minutes at 0°C. Next, 10x reverse transcriptase (RT) buffer and 25 units of M-MuLV RT were added (New England Biolabs, Frankfurt am Main, Germany, http://www.neb.com), after which the samples were incubated for 10 minutes at 25°C. The RT reaction was performed at 42°C for 50 minutes and stopped by incubation at 70°C for 15 minutes. The cDNA was quantified with PicoGreen (Invitrogen) and stored at –80°C until further use.
Quantitative RT-Polymerase Chain Reaction
The qPCR Master Mix Plus for SYBR Green I kit from Eurogentec (Cologne, Germany, http://www.eurogentec.be) was used. To approximately 1 ng of cDNA, 100 mM primers and the 2x reaction buffer were added to a total volume of 25 µl. Primers were developed using the primer express software (Applied Biosystems, Darmstadt, Germany, http://www.appliedbiosystems.com), except for primers for type II
1 collagen [16]. The forward (F) and reverse (R) primer sequences read from 5'
3' were: aggrecan TGCATTCCACGAAGCTAACCTT (F) and GACGCCTCGCCTTCTTGAA (R), amplicon (amp) = 84 base pairs (bp); type I
2 collagen GCTGGCAGCCAGTTTGAATATAAT (F) and CAGGCGCATGAAGGCAAGT (R), amp = 78 bp; type II
1 collagen GTCGTCGCAGAGGACAGTCC (F) and AGAGGTATAATGATAAGGATGTGTGGAAG (R), amp = 83 bp; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) AGAAAAACCTGCCAAATATGATGAC (F) and TGGGTGTCGCTGTTGAAGTC (R), amp = 126 bp. Polymerase chain reactions (PCRs) were performed in an ABI Prism SDS 7,000 system (Applied Biosystems). The PCR reaction was 2 minutes 50°C, 10 minutes 95°C, followed by 38 cycles of 95°C for 15 seconds and 60°C for 1 minute. After the last cycle, a dissociation curve was generated. Threshold levels (Ct values) were determined using Sequence Detection System software (Applied Biosystems). PCR was performed in duplicate, and for each experimental group the Ct value of GAPDH was subtracted from the Ct value of the genes of interest (
Ct). The average
Ct value of the duplicates was taken. Cells grown in monolayer without induction medium were taken as an external control (
Ct).
Histology
Micromasses were fixed for 30 minutes with 10% formalin, washed with phosphate-buffered saline (PBS), and embedded in Tissue-Tec (Plano, Wetzlar, Germany, http://www.plano-em.de). Seven-micrometer cryosections were prepared and stained with H&E and Safranin-O/Fast Green to detect proteoglycans and immunostained for type I and II collagen. Briefly, cryosections were air-dried and treated with 1% hyaluronidase (15 minutes, 37°C) and 0.1% pronase (30 minutes, 37°C). Endogenous peroxidase was blocked with 1% H2O2 (30 minutes, room temperature), and non-specific binding was blocked with 1% bovine serum albumin plus 10% normal horse serum for 30 minutes at room temperature. Antibodies directed against type I or type II collagen (both MP Biomedicals, Eschwege, Germany, http://www.mpbio.com) were incubated at dilutions of 1:200 and 1:500, respectively (overnight, 4°C). A biotin-streptavidin detection system (Vectastain Elite kit; Vector Laboratories, Burlingame, CA, http://www.vectorlabs.com) was used according to the manufacturer's recommendations.
To detect hypertrophic chondrocytes, micromass sections were stained for alkaline phosphatase (ALP). Sections were washed in ALP buffer (0.1 M Tris-HCl, 0.1 M NaCl, 5 mM MgCl2, pH 9.0) and then incubated with 3.5 µl of 5-bromo-4-chloro-3-indolylphosphate (50 mg/ml; Sigma-Aldrich) and 4.5 µl of nitroblue tetrazolium (50 mg/ml; Sigma-Aldrich) per milliliter of ALP buffer. The reaction was stopped by washing with PBS.
Statistical Analysis
Statistical differences between the different groups were analyzed using SigmaStat (SPSS, Chicago, http://www.spss.com) via one-way analysis of variance (ANOVA) or Kruskal-Wallis ANOVA on ranks, depending on the results of the normality test. A correlation of age with the tested parameters was also tested by SigmaStat. In all tests, p values <.05 were considered statistically significant.
 |
RESULTS
|
|---|
Isolation and Culturing of MSCs
We were able to isolate mononuclear cells from all 98 BM samples. Although cell yield varied considerably between patients (5–50 million mononuclear cells per milliliter BM), there was no significant difference between the different OA groups (Fig. 1A; Table 1). Furthermore, there was no correlation of age and cell yield in either the whole patient population or in the different OA groups (Fig. 1B). Seeding the mononuclear fraction resulted in all cases in adherent cells with a fibroblast-like appearance that grew in the form of clones (data not shown). The cells reached confluency after 9.5 ± 2.1, 9.1 ± 1.3, and 10.1 ± 2.3 days for the age-related, joint dysplasia, and trauma group, respectively, and this was not statistically different (Table 1). Similar results were obtained for cell size (17.6, 17.8, and 17.9 µm for the respective groups) and cell yields (Table 1). Furthermore, cell yields per cm2 at time of confluency were not significantly different between the groups (Fig. 1C). Additionally, there was no correlation of age with the tested parameters, taking the whole patient population together or in the three groups separately (Fig. 1D). We also studied the proliferation capacity of the isolated MSCs since a high proliferative capacity is characteristic for stem cells. After the primary MSCs reached confluency, they could easily be passaged an additional five times, which proved to be independent of age or cause of OA (not shown). This expansion corresponds to approximately 25 population doublings per initial MSC and would result in sufficient cells for tissue engineering purposes.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 1. Analysis of the mononuclear cell number in bone marrow (BM) and MSC yield at the time of passaging from patients with different osteoarthritis (OA) etiology: age-related (open circles, 59 patients), joint dysplasia (gray squares, 12 patients), and post-traumatic (filled triangles, 21 patients). (A): Box-whisker plot of the distribution of mononuclear cell content in patient-derived BM in each of the three OA groups. (B): Correlation plot of mononuclear cell content with age in three OA groups. (C): Box-whisker plot showing MSC yield in the different OA groups after one passage. (D): Correlation plot of MSC yield with age in 3 OA groups. The data in the box-whisker plot are presented as the median (solid line), 25th and 75th percentiles (vertical boxes), and 5th and 90th percentiles (error bars). The stars show minimum and maximum. The mean is represented by the small box.
|
|
Phenotyping Plastic-Adherent MSCs
Flow cytometry was performed with a set of specific antibodies on primary MSCs from representative donors in the different groups. Primary culture cells were always negative for the hematopoietic markers CD3, CD14, CD16, CD20, CD34, CD45, and CD235a. A representative example is shown in Figure 2. In addition, cells from all donors homogeneously expressed markers known to be expressed on MSCs: CD10, CD73, CD90, CD105, CD109, CD140b, CD164, and CD166 (Fig. 2). The mean fluorescent intensity for each marker in the different OA groups is shown in Table 2. No significant phenotypic differences between MSCs obtained from donors in the different groups were observed. Furthermore, we could not detect a correlation between MSC phenotype and the age of the donor.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2. Cell surface expression of selected markers on cultured MSCs. Shown are the results from MSCs isolated from a 72-year-old male; 1 x 106 cells were stained with the indicated phycoerythrin-conjugated monoclonal antibodies and incubated for 30 minutes at 4°C. After washing, the cells were analyzed on a FACSCalibur flow cytometer using CellQuest software. The dotted lines show the fluorescence intensity of the IgG negative control antibody, whereas the intensity of the indicated antibodies is shown in red. Markers that are negative (CD3, -14, -16, -20, -34, -45, -235), as well as positive markers (CD10, -73, -90, -105, -109, -140b, -164, -166), were investigated.
|
|
Chondrogenic Differentiation in Micromass Culture
We investigated whether increasing age or OA etiology affected the ability of MSCs to differentiate in the desired chondrogenic lineage. In micromasses of all tested donors, chondrogenic differentiation of MSCs was observed after 21 days in culture. As a representative example, sections of a micromass produced by MSCs from an 82-year-old male donor in the age-related group are shown in Figure 3. The differentiated cells displayed spherical morphology (Fig. 3A), typical of chondrocytes, and were surrounded by abundant extracellular matrix, rich in glycosaminoglycans (Fig. 3B) and type II collagen (Fig. 3C). In contrast, type I collagen, a marker of chondrocyte dedifferentiation, was barely expressed (Fig. 3D). In several micromass cultures, single ALP-positive cells could be identified (Fig. 3E, 3F), suggesting that the chondrocytes sometimes progressed into a hypertrophic-like phenotype. However, hypertrophy did not correlate with age or OA etiology. Pellets did not contain osteogenic or adipogenic material, based on von Kossa and oil red stainings (data not shown).

View larger version (122K):
[in this window]
[in a new window]
|
Figure 3. Histological analysis of micromass cultures of a representative donor. (A–E): Sections of a micromass formed by MSCs obtained from an 82-year-old male donor. (F): Section of human cartilage. (A): H&E staining; (B): Safranin-O/Fast Green staining. (C): Type II collagen immunohistochemistry. (D): Type I collagen immunohistochemistry. (E, F): Alkaline phosphatase staining to stain hypertrophic chondrocytes. Inset = enlargement of small boxed area. Scale bar = 10 µm. Abbreviations: cart, cartilage; h.c., hypertrophic cartilage.
|
|
Chondrogenic differentiation status was confirmed via analysis of mRNA levels for type I and type II collagen and aggrecan. Figure 4 shows quantitative PCR analyses of micromass cultures of 17 donors. The level of mRNA for type I collagen in micromasses was always similar or downregulated compared with undifferentiated MSCs (Fig. 4A). In contrast, the mRNA levels for the cartilage markers type II collagen and aggrecan were always strongly upregulated in micromass cultures compared with controls, 1,000- and 100-fold, respectively (Fig. 4B, 4C). No correlation between mRNA profiles and donor age of OA etiology could be detected.
 |
DISCUSSION
|
|---|
MSCs obtained from femoral BM are a promising cell source for the biological repair of articular cartilage defects in osteoarthritic patients. Therefore, we investigated the availability and chondrogenic potential of MSCs within the osteoarthritic patient population, taking into account the multifactorial nature of OA. The central finding of these experiments is that sufficient MSCs capable of chondrogenic differentiation are available within the elderly osteoarthritic population to enable a potential cartilage repair approach.
Although it is well documented that MSCs can easily be isolated from BM and expanded in vitro, reports about the number of MSCs or chondrogenic progenitor cells in relation to donor age are conflicting. A number of publications report a decrease of MSCs with increased age [4, 7, 17], whereas others have not found such a relation [3, 9, 10, 18–20]. We found that the yield of mononuclear cells from the BM obtained from the femur shaft varied greatly between individuals but could not correlate this variation with age or OA etiology. Furthermore, no relation between cell viability (population doubling time, expansion time, etc.) and age or OA etiology could be found. This suggests that the number of MSCs in BM and their growth characteristics remain relatively stable in those patients. Our results show that less than 107 BM-derived mononuclear cells may result in
109 MSCs after only several passages. This is in line with data from younger donors [21, 22] and, more importantly, represents a quantity that would allow biological cartilage reconstruction, even for more than one joint.
Currently, BM samples for clinical applications are mainly harvested from the iliac crest. However, great care has to be taken when obtaining MSCs from this site, since it has been shown [23] that a consistent technique for the aspiration of BM using small samples (<2 ml) is crucial to obtain high yields of mononuclear progenitor cells that are not overly contaminated with peripheral blood. Here, the harvesting from the femur shaft might provide a valid alternative. Although the harvest from an open femur shaft, as was used in this study, is not feasible, one can envision a very similar approach as is currently used during harvesting from the iliac crest to access the femoral BM reservoir. In this procedure, the greater trochanter would function as a relatively easy accessible donor site, which, after a small stab incision of the skin, can be penetrated through the cortical bone using a BM aspiration needle. Under x-ray control, the tip of the needle can be positioned under controlled conditions, allowing the harvest of larger volumes of BM from multiple sites within the femur through a single access point.
Although it has been shown that adult human MSCs can differentiate into the chondrogenic lineage [2], little is known about whether this differentiation capacity is age-dependent. In rabbits, chondrogenesis of periosteal-derived MSCs was shown to decline with age [24]. In line with this observation in rodents, spontaneous cartilage repair, thought to be the result of infiltrating stem cells from the subchondral BM, is observed more often in young patients than in old [25, 26]. On the other hand, De Bari et al., using MSCs isolated from periosteum, could not find an influence of age on the chondrogenic differentiation capacity of these cells [12, 27] but did show that spontaneous chondrogenesis in vitro was only found in patients under the age of 30, indicating that the chondrogenic potential of periosteal-derived stem cells is reduced during aging. Murphy et al. also could not detect an age-dependency of MSC differentiation in either OA patients or normal donors [3]. However, they did find that MSCs from OA patients had a lower proliferation rate and showed a reduced chondrogenic differentiation capacity. Based on these results, they suggested that these changes in cell function could play a role in the development of OA. Consequently, we expected reduced chondrogenic differentiation in the primary OA group in comparison with the post-traumatic and dysplasia groups, where altered joint mechanics might play a bigger role in the development of OA. Interestingly, we could direct MSCs from all 36 tested donors into the chondrogenic lineage and were unable to distinguish between chondrogenesis in MSCs from young and elder donors or between the different OA groups. All differentiated cells showed the typical round chondrocyte-like cell morphology, upregulated mRNA for the cartilage-specific genes type II collagen and aggrecan, and produced type II collagen and proteoglycan-rich extracellular matrix. One reason for the discrepancy between our and Murphy's study could be that Murphy et al. used glycosaminoglycan synthesis as a measure for chondrogenic differentiation. Since the synthesis of aggrecan by chondrocytes decreases with age, as does the rate at which it is incorporated into aggregates [28, 29], it could be that MSCs from older patients retain their chondrogenic differentiation capacity but lose part of their synthetic capacity.
However, we did find that chondrogenically induced MSCs had the tendency to differentiate in hypertrophic chondrocytes expressing alkaline phosphatase after the initial differentiation into type II collagen, expressing mature and functional chondrocytes. This finding has also been reported by others using BM-derived MSCs and embryo-derived mesodermal precursor cells, based on the expression of ALP and type X collagen [19, 30, 31], and may indicate a tendency toward mineralization. For successful future therapeutic application of these MSCs, it will be necessary to inhibit this process of terminal differentiation. It should be investigated whether, in the in vivo situation, the local environment provides the information to guide appropriate differentiation of transplanted (un)differentiated cells [32]. Alternatively, the application of morphogenic factors or otherwise bioactive factors may be necessary to arrest the transplanted cells in the prehypertrophic stage [33–36].
In summary, we showed that MSCs capable of chondrogenic differentiation can be isolated and expanded in sufficient amounts from femoral BM of OA patients independent of the individual age or the underlying cause of OA. Therefore, we conclude that cartilage tissue engineering using BM-derived MSCs to treat OA lesions seems feasible.
 |
DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
|
|---|
C. Gaissmaier owns stock in TETEC AG. R. Stoop has performed contract work for TETEC AG.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Sabrina Treml and Khatool Omari for technical assistance, Dr. Wilhelm K. Aicher and Dr. Jürgen Mollenhauer for critical discussion of experiments and help in preparation of the manuscript, Sonja Velins for correction of the manuscript, and Dr. Hugo Hämmerle for continuous support and useful discussions. This study has been supported in part by BioProfile Grants 0312995 and 0313755 from the Ministry of Education and Research, Germany. A.S. is currently affiliated with the Department of Pharmacology & Toxicology, Radboud University, Nijmegen Medical Centre, Nijmegen, The Netherlands. R.S. is currently affiliated with TNO Quality of Life, Biosciences, Leiden, The Netherlands.
 |
REFERENCES
|
|---|
- Felson DT. The epidemiology of osteoarthritis: Prevalence and risk factors. In: Kuettner KE, Goldberg VM, eds. Osteoarthritic Disorders.Rosemont, IL: American Academy of Orthopaedic Surgeons,1995;13–24.
- Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.[Abstract/Free Full Text]
- Murphy JM, Dixon K, Beck S et al. Reduced chondrogenic and adipogenic activity of mesenchymal stem cells from patients with advanced osteoarthritis. Arthritis Rheum 2002;46:704–713.[CrossRef][Medline]
- Muschler GF, Nitto H, Boehm CA et al. Age- and gender-related changes in the cellularity of human bone marrow and the prevalence of osteoblastic progenitors. J Orthop Res 2001;19:117–125.[CrossRef][Medline]
- Jones EA, Kinsey SE, English A et al. Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells. Arthritis Rheum 2002;46:3349–3360.[CrossRef][Medline]
- Reyes M, Lund T, Lenvik T et al. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 2001;98:2615–2625.[Abstract/Free Full Text]
- D'Ippolito G, Schiller PC, Ricordi C et al. Age-related osteogenic potential of mesenchymal stromal stem cells from human vertebral bone marrow. J Bone Miner Res 1999;14:1115–1122.[CrossRef][Medline]
- Quarto R, Thomas D, Liang CT. Bone progenitor cell deficits and the age-associated decline in bone repair capacity. Calcif Tissue Int 1995;56:123–129.[CrossRef][Medline]
- Phinney DG, Kopen G, Righter W et al. Donor variation in the growth properties and osteogenic potential of human marrow stromal cells. J Cell Biochem 1999;75:424–436.[CrossRef][Medline]
- Oreffo RO, Bennett A, Carr AJ et al. Patients with primary osteoarthritis show no change with ageing in the number of osteogenic precursors. Scand J Rheumatol 1998;27:415–424.[CrossRef][Medline]
- Leskela HV, Risteli J, Niskanen S et al. Osteoblast recruitment from stem cells does not decrease by age at late adulthood. Biochem Biophys Res Commun 2003;311:1008–1013.[CrossRef][Medline]
- De Bari C, Dell'Accio F, Luyten FP. Human periosteum-derived cells maintain phenotypic stability and chondrogenic potential throughout expansion regardless of donor age. Arthritis Rheum 2001;44:85–95.[CrossRef][Medline]
- Bergman RJ, Gazit D, Kahn AJ et al. Age-related changes in osteogenic stem cells in mice. J Bone Miner Res 1996;11:568–577.[Medline]
- Tyndall A, Walker UA, Cope A et al. Immunomodulatory properties of mesenchymal stem cells: A review based on an interdisciplinary meeting held at the Kennedy Institute of Rheumatology Division, London, UK, 31 October 2005. Arthritis Res Ther 2007;9:301.[CrossRef][Medline]
- Diaz-Romero J, Gaillard JP, Grogan SP et al. Immunophenotypic analysis of human articular chondrocytes: Changes in surface markers associated with cell expansion in monolayer culture. J Cell Physiol 2005;202:731–742.[CrossRef][Medline]
- Gebhard PM, Gehrsitz A, Bau B et al. Quantification of expression levels of cellular differentiation markers does not support a general shift in the cellular phenotype of osteoarthritic chondrocytes. J Orthop Res 2003;21:96–101.[CrossRef][Medline]
- Nishida S, Endo N, Yamagiwa H et al. Number of osteoprogenitor cells in human bone marrow markedly decreases after skeletal maturation. J Bone Miner Metab 1999;17:171–177.[CrossRef][Medline]
- Suva D, Garavaglia G, Menetrey J et al. Non-hematopoietic human bone marrow contains long-lasting, pluripotential mesenchymal stem cells. J Cell Physiol 2004;198:110–118.[CrossRef][Medline]
- Yoo JU, Barthel TS, Nishimura K et al. The chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J Bone Joint Surg Am 1998;80:1745–1757.[Abstract/Free Full Text]
- Oreffo RO, Bord S, Triffitt JT. Skeletal progenitor cells and ageing human populations. Clin Sci (Lond) 1998;94:549–555.[Medline]
- Bruder SP, Jaiswal N, Haynesworth SE. Growth kinetics, self-renewal, and the osteogenic potential of purified human mesenchymal stem cells during extensive subcultivation and following cryopreservation. J Cell Biochem 1997;64:278–294.[CrossRef][Medline]
- Meuleman N, Tondreau T, Delforge A et al. Human marrow mesenchymal stem cell culture: Serum-free medium allows better expansion than classical alpha-MEM medium. Eur J Haematol 2006;76:309–316.[CrossRef][Medline]
- Muschler GF, Boehm C, Easley K. Aspiration to obtain osteoblast progenitor cells from human bone marrow: The influence of aspiration volume. J Bone Joint Surg Am 1997;79:1699–1709.[Abstract/Free Full Text]
- O'Driscoll SW, Saris DB, Ito Y et al. The chondrogenic potential of periosteum decreases with age. J Orthop Res 2001;19:95–103.[CrossRef][Medline]
- Knutsen G, Engebretsen L, Ludvigsen TC et al. Autologous chondrocyte implantation compared with microfracture in the knee. A randomized trial. J Bone Joint Surg Am 2004;86-A:455–464.[Abstract/Free Full Text]
- Sledge SL. Microfracture techniques in the treatment of osteochondral injuries. Clin Sports Med 2001;20:365–377.[CrossRef][Medline]
- De Bari C, Dell'Accio F, Tylzanowski P et al. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheum 2001;44:1928–1942.[CrossRef][Medline]
- Bayliss MT, Howat S, Davidson C et al. The organization of aggrecan in human articular cartilage. Evidence for age-related changes in the rate of aggregation of newly synthesized molecules. J Biol Chem 2000;275:6321–6327.[Abstract/Free Full Text]
- Verbruggen G, Cornelissen M, Almqvist KF et al. Influence of aging on the synthesis and morphology of the aggrecans synthesized by differentiated human articular chondrocytes. Osteoarthritis Cartilage 2000;8:170–179.[CrossRef][Medline]
- Winter A, Breit S, Parsch D et al. Cartilage-like gene expression in differentiated human stem cell spheroids: A comparison of bone marrow-derived and adipose tissue-derived stromal cells. Arthritis Rheum 2003;48:418–429.[CrossRef][Medline]
- Poliard A, Blumen B, Freyria AM et al. Chondrogenesis from stem cell recruitment to hypertrophy by a tripotential mesoblastic cell line. Osteoarthritis Cartilage 2001;9 (suppl A):S85–S90.[CrossRef][Medline]
- Wakitani S, Imoto K, Yamamoto T et al. Human autologous culture expanded bone marrow mesenchymal cell transplantation for repair of cartilage defects in osteoarthritic knees. Osteoarthritis Cartilage 2002;10:199–206.[CrossRef][Medline]
- Grande DA, Mason J, Light E et al. Stem cells as platforms for delivery of genes to enhance cartilage repair. J Bone Joint Surg Am 2003;85-A (suppl 2):111–116.[Abstract/Free Full Text]
- Steinert A, Weber M, Dimmler A et al. Chondrogenic differentiation of mesenchymal progenitor cells encapsulated in ultrahigh-viscosity alginate. J Orthop Res 2003;21:1090–1097.[CrossRef][Medline]
- Tsuchiya H, Kitoh H, Sugiura F et al. Chondrogenesis enhanced by overexpression of sox9 gene in mouse bone marrow-derived mesenchymal stem cells. Biochem Biophys Res Commun 2003;301:338–343.[CrossRef][Medline]
- Ikeda T, Kamekura S, Mabuchi A et al. The combination of SOX5, SOX6, and SOX9 (the SOX trio) provides signals sufficient for induction of permanent cartilage. Arthritis Rheum 2004;50:3561–3573.[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
N. Gago, V. Perez-Lopez, J. P. Sanz-Jaka, P. Cormenzana, I. Eizaguirre, A. Bernad, and A. Izeta
Age-Dependent Depletion of Human Skin-Derived Progenitor Cells
Stem Cells,
May 1, 2009;
27(5):
1164 - 1172.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. L. Battula, S. Treml, P. M. Bareiss, F. Gieseke, H. Roelofs, P. de Zwart, I. Muller, B. Schewe, T. Skutella, W. E. Fibbe, et al.
Isolation of functionally distinct mesenchymal stem cell subsets using antibodies against CD56, CD271, and mesenchymal stem cell antigen-1
Haematologica,
February 1, 2009;
94(2):
173 - 184.
[Abstract]
[Full Text]
[PDF]
|
 |
|