First published online November 22, 2006
Stem Cells
Vol. 25 No.
3
March 2007, pp.
761
-770
doi:10.1634/stemcells.2006-0582; www.StemCells.com
© 2007 AlphaMed Press
STEM CELL GENETICS AND GENOMICS |
Structure and Implied Functions of Truncated B-Cell Receptor mRNAs in Early Embryo and Adult Mesenchymal Stem Cells: C
Replaces Cµ in µ Heavy Chain-Deficient Mice
Smadar Laptera,
Idit Livnata,
Alexander Faermanb,
Dov Ziporia
aDepartment of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel;
bQBI Enterprises Ltd., Nes Ziona, Israel
Key Words. Mesenchyme • B-cell receptor • MSC • Embryo • Gene expression
Correspondence: Dov Zipori, Ph.D., Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, 76100, Israel. Telephone: 972-8-9342484; Fax: 972-8-9344125; e-mail: dov.zipori{at}weizmann.ac.il
Received on September 19, 2006;
accepted for publication on November 13, 2006.
First published online in STEM CELLS EXPRESS November 22, 2006.
 |
ABSTRACT
|
|---|
Stem cells exhibit a promiscuous gene expression pattern. We show herein that the early embryo and adult MSCs express B-cell receptor component mRNAs. To examine possible bearings of these genes on the expressing cells, we studied immunoglobulin µ chain-deficient mice. Pregnant µ chain-deficient females were found to produce a higher percentage of defective morulae compared with control females. Structure analysis indicated that the µ mRNA species found in embryos and in mesenchyme consist of the constant region of the µ heavy chain that encodes a recombinant 50-kDa protein. In situ hybridization localized the constant µ gene expression to loose mesenchymal tissues within the day-12.5 embryo proper and the yolk sac. In early embryo and in adult mesenchyme from µ-deficient mice,
replaced µ chain, implying a possible requirement of these alternative molecules for embryo development and mesenchymal functions. Indeed, overexpression of the mesenchymal-truncated µ heavy chain in 293T cells resulted in specific subcellular localization and in G1 growth arrest. The lack of such occurrence following overexpression of a complete, rearranged form of µ chain suggests that the mesenchymal version of this mRNA may possess unique functions.
 |
INTRODUCTION
|
|---|
Lymphocytes of the B lineage are the only cells that synthesize immunoglobulin (Ig) molecules, the effectors of the humoral immune response. Igs comprise of four polypeptide chains, two identical heavy chains (HCs) and two identical light chains (LCs), each containing an antigen-binding variable (V) domain, plus a more conserved constant (C) domain encoded by one to four exons. The products of V(D)J recombination of both immunoglobulin heavy and light chain loci associate covalently to form the ligand recognition domain [1–7]. The isotype of the HC molecules determine the subclass of that antibody: IgM (µ), IgD (
), IgG (
), IgE (
), and IgA (
). Ig molecules appear in both secreted and membrane-bound forms. The latter are noncovalently bound to the transmembrane Ig
(CD79a) and Igβ (CD79b) proteins to form the B-cell receptor (BCR) (reviewed by [8]).
In addition to the above orderly synthesis and assembly of Ig molecules, truncated forms of these molecules occur in B cells. The Dµ protein forms in some pre-B cells during normal mouse B-cell development. This protein consists of a short D region composed entirely of a coding sequence without introns or splice sites upstream to a complete C region [9]. The Dµ expressed in pre-B cells blocks further B-cell development [10–13] and is thus functional. A second µHC truncation is found in a human B-cell neoplasia, µHC disease. This truncated µHC (Tµ) lacks the variable domain and has its translation initiation site at the fifth amino acid of the first constant region domain [14, 15]. The truncated BCR is expressed on the cell surface in the absence of LC [16, 17]. Although this receptor is lacking an antigen binding domain, overexpression assays showed that this variant is constitutively active [18]. Whereas Dµ protein leads to deletion of the cell that expresses it, Tµ expression allows developmental progression and bone marrow emigration. Whether the mRNA encoding these truncated proteins and the proteins themselves serve a function in normal physiology is unknown. In addition to the above, a truncated form consisting of the C region (Cµ) has been described in T- and pre-B-lymphoid and myeloid cells [19].
We have reported the expression of truncated forms of T-cell receptor (TCR) mRNAs in mesenchymal cell lines and in primary mouse embryo fibroblasts (MEFs) [20]. The cell lines exhibit MSC functions in promoting hemopoiesis and being capable of differentiation into adipocytes and osteoblast [21–26]. This MSC nature is shared by MEFs [27–29]. The unexpected presence of TCR in MSC-like cells raised the question as to whether nonlymphoid cells express also Ig gene products. We show herein that a unique form of truncated µHC is found in the embryo prior to the development of functional B-lineage lymphocytes and is present, along with other components of the pre-B cell receptor, in cultured mesenchymal cells. Because the expression of IgM constitutes a major step in B-cell development, it could be expected that Ig µ chain-deficient mice would have defective B-cell generation pattern. However, in these mice, µHC is replaced by
HC, and the mice exhibit near normal immune status, albeit having a modified antibody repertoire [30, 31]. Our present study shows that in µ-deficient mice,
HC is substituting for µHC in the oocyte, morula, and mesenchyme of the early embryo, as well as in the adult mesenchyme. This unexpected finding implies a role for Ig gene products in the regulation of early embryogenesis and in MSC functions.
 |
MATERIALS AND METHODS
|
|---|
Isolation and Transfer of Embryonic Cells
Balb/c and IgM-deficient mice (on Balb/c background) [30] were maintained under pathogen-free conditions, crossed, and homozygous IgM–/– as well as IgM+/+ (WT) mice were selected. Superovulation was induced in virgin 5-week old mice by intraperitoneal injection of 5 units of pregnant mare serum gonadotropin (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) and 5 units of human chorionic gonadotropin (Sigma-Aldrich) 48 hours later. The following day, females were killed, and unfertilized oocytes were collected from the oviduct by flushing M2 medium containing hyaluronidase (300 mg/ml). To isolate morulae, superovulation was induced as above in 4- to 6-week old virgin Balb/c, ICR, and IgM–/– mice. Each superovulated mouse was then placed in a cage overnight with a sexually mature male of the same strain. Successful mating was determined by the presence of a copulation plug on the following day (designated as day 0.5 of gestation). Females were killed on day 2.5, and morulae were collected by flushing M2 medium through the uteri. Embryos cultured in vitro were placed into 30-µl drops of M2 medium with 4 mg/ml bovine serum albumin and covered with light paraffin oil. Embryos were sorted into their respective developmental stages, and defective embryos were microscopically identified. For embryo transfer, recipient female mice were prepared by mating with vasectomized males (ICR) 2.5 days before the embryo transfer. The procedure of embryo transfer was performed by implanting morulae into pseudopregnant recipient females. Fifteen morulae were transferred to each uterine horn (total of 30 per female). The mice were killed 10 days after the embryo transfer. MEF were derived from 12.5-day-old embryos.
MSC Production
BM cells were obtained from 7- to 8-week old female C57BL/6 mice. MSCs were grown in murine Mesencult basal media supplemented with 20% murine mesenchymal supplement (StemCell Technologies, Vancouver, BC, Canada, http://www.stemcell.com) containing 60 µg/ml penicillin and 100 µg/ml streptomycin and incubated at 37°C in a humidified incubator with 10% CO2 in air. Half of the medium was replaced every 3 days to remove the nonadherent cells. Once the adherent cells had reached confluence, the cells were trypsinized, centrifuged, and resuspended in their medium and incubated with antibodies specific to CD45.2 R-phycoerythrin (SouthernBiotech, Birmingham, AL, http://www.southernbiotech.com) and CD11b/ Mac1 fluorescein isothiocyanate (SouthernBiotech) for 1 hour. The cells were sorted using the FACSVantage SE cell sorter (BD Biosciences, San Diego, http://www.bdbiosciences.com). The double-negative cell population was collected and seeded in MSC medium.
Cell Lines and Transfection Procedure
Murine bone marrow-derived stromal cell lines MBA-2.1 and MBA-2.4 endothelial-like, MBA-13 fibroendithelial, MBA-15 osteogenic and 14F1.1 preadipocytes [21–24, 32], and the 293T human embryonic kidney cell line were used. These were cultured in Dulbecco's modified Eagle's medium supplemented with 100 µM glutamine and 10% fetal calf serum and containing 60 µg/ml penicillin, 100 µg/ml streptomycin, and 50 mg/L kanamycin and incubated at 37°C in a humidified incubator with 10% CO2 in air. Transient DNA transfections were done as follows: 1.5 x 105 293T cells were plated in each well of a six-well plate (Corning Life Sciences, Acton, MA, http://www.corning.com/lifesciences) a day before transfection. Plasmid DNA (1.5 µg) was transfected to 293T cells by the calcium-phosphate/DNA precipitation method.
Flow Cytometry and Immunohistochemistry
293T cells (1 x 106/100-mm-diameter dish) were transfected and fixed in 100% methanol for 30 minutes, collected by low-speed centrifugation and resuspended in phosphate-buffered saline (PBS) and incubated for 40 minutes with primary antibody anti-IgM (A90-101A, 1:700; Bethyl Laboratories, Montgomery, TX, http://www.bethyl.com/) for 45 minutes, followed by 40-minute incubation with biotin-conjugated donkey anti-goat antibody (AP180B, 1:1,500; Chemicon, Temecula, CA, http://www.chemicon.com) and, finally, by 40-minute staining with Oregon Green 488-conjugated streptavidin (Molecular Probes, Eugene, OR, http://probes.invitrogen.com). Cells were resuspended in PBS containing 50 µg/ml RNAse A (Sigma-Aldrich) and 50 µg/ml propidium iodide (Sigma-Aldrich), incubated in the dark at 37°C for 30 minutes, and 10,000 to 20,000 cells were analyzed for DNA content by FACScan (BD Biosciences). Histograms were prepared using CellQuest software (BD Biosciences). For immunohistochemistry, embryos were fixed in 4% (vol/vol) phosphate-buffered formalin, dehydrated, and embedded in paraffin; sections were prepared, boiled for 10 minutes in 10 mM citrate buffer, pH 6.0, and cooled down for at least 2 hours. Sections were then blocked and permeabilized for 30 minutes at room temperature using a blocking solution (10% normal horse serum and 0.1% Triton X-100, in PBS) and incubated overnight at room temperature with biotinylated goat anti-mouse IgM antibody (115-065-075, 1:2,000; Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com) and then with peroxidase-labeled avidin-biotin complex (ABC complex, K-0377; DAKO, Glostrup, Denmark, http://www.dako.com). Sections were then washed and developed in diamino-benzidine reagent (Sigma-Aldrich), rinsed in water, counterstained with hematoxylin, mounted with mounting reagent Enthellan (Merck & Co., Whitehouse Station, NY, http://www.merck.com), and analyzed using a light microscope (Nikon Eclipse E800; Nikon, Tokyo, http://www.nikon.com/).
Immunofluorescence
293T cells (1.5 x 105) were seeded on glass coverslips (13 mm in diameter). Twenty-four hours after transfection, cells were fixed, permeabilized, and incubated with goat anti-IgM (A90-101A, 1:700; Bethyl) for 45 minutes, washed in PBS, incubated 40 minutes with biotin-conjugated donkey anti-goat antibody (AP180B, 1:1,500; Chemicon) and then stained 40 minutes with Oregon Green 488-conjugated streptavidin (Molecular Probes), and washed in PBS. Cells were viewed and photographed using Nikon E 1000 and the Openlab 4.0.1 software (Improvision, Lexington, MA, https://www.improvision.com).
Plasmid Construction
The expression constructs of cytosolic and transmembrane mesenchymal Ig µHC was generated as follows: transcripts were cloned from the MBA-2.1 cDNA library into pCANmycA vector (Stratagene, LA Jolla, CA, http://www.stratagene.com). The cytosolic mesenchymal Ig µHC was amplified using the sense primer 5'-CCGGAATTCGGCTGCCTAGCCCGGGACTTCC-3' and the antisense primer 5'-CGGCTCGAGTCAATAGCAGGTGCCGCCTGTGTC-3'; the transmembrane mesenchymal Ig µHC was amplified using the sense primer 5'-CCGGAATTCGGCTGCCTAGCCCGGGACTTCC-3' and the antisense primer 5'-CGGCTCGAGTCATTTCACCTTGAACAGGGTGACG-3'. Both fragments were digested with XhoI and EcoRI and ligated into pCANmycA vector. Another construct of the cytosolic mesenchymal Ig µHC was designed for the cell-free transcription/translation assay described. The insert was cloned into the vector pBluescript II KS (±) (Stratagene) using the same primers (only the XhoI restriction site was modified by NotI). The vector containing the cytosolic form of the full-length Ig µHC was a kind gift from Dr. Yair Argon (University of Chicago, Chicago, www.uchicago.edu).
Cell-Free Transcription/Translation
The transcription/ translation experiment was performed by means of the TNT quick-coupled transcription/translation system (Promega, Madison, WI, http://www.promega.com) according to the instructions of the producer.
Northern Blots
Total RNA was extracted using TriReagent (Molecular Research Center, Cincinnati, OH, http://www.mrcgene.com) and 2- to 40-µg samples were hybridized with the µHC constant region probe. Separation of RNA samples by electrophoresis was performed on 1% agarose, 5.2% formaldehyde (37% solution), and 1x 4-morpholinepropanesulfonic acid (MOPS) gels. RNA was transferred to a Hybond-N membrane (Amersham Biosciences, Piscataway, NJ, http://www.amersham.com). The blot was hybridized at 68°C for 60 minutes in express hybridization solution containing
-[32P]-labeled probe. After washing, the blot was exposed to x-ray film (Kodak, Rochester, NY, http://www.kodak.com).
Western Blots
Cells were harvested in 400 µl ice-cold radioimmunoprecipitation assay lysis buffer (50 mM Tris, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 10% glycerol, and 1 mM EDTA, pH 8, plus 1/100 protease Inhibitor Cocktail [Sigma-Aldrich]) followed by centrifugation (15,000g, 15 minutes, 4°C). The supernatants were boiled after the addition of SDS sample buffer (5% glycerol, 2% SDS, 62.5 mM Tris-HCl, pH 6.8, 2% 2-mercaptoethanol, and 0.01% bromphenol blue), separated on 10% SDS-polyacrylamide gel, and transferred to nitrocellulose membranes (Whatman Schleicher and Schuell, Keene, NH, http://www.whatman.com/). The membranes were incubated for 1 hour in TBS-T (25 mmol/l Tris-base, 150 mmol/l NaCl, and 0.05% Tween 20, pH 7.4) containing 5% (wt/vol) nonfat dry milk to block nonspecific antibody binding and then incubated with horseradish peroxidase-goat anti-mouse IgM antibody (115-035-020, 1:5,000; Jackson). Antibody-labeled proteins were detected by enhanced chemiluminescence (ECL) substrate on Kodak film.
In Situ Hybridization
WT and IgM–/– embryos (12.5 days post coitum [dpc]) and their extraembryonic tissues were fixed in buffered 10% formalin at 4°C for 16 hours and processed for paraffin embedding. The 5-µm thick paraffin sections were prepared and mounted on TESPA-subbed SuperFrost Plus slides (Menzel-Glaser, http://www.menzel.de). To generate the probes, a consensus fragment of either mesenchymal Ig µHC or mesenchymal Ig
HC cDNAs was cloned into pCDNA3 vector (Stratagene) and pGEM-T (Promega), respectively. Sense and antisense riboprobes were transcribed in vitro (Promega kit) using 35S-labeled UTP. Radioactive in situ hybridization was performed according to a previously published protocol [33] with slight modifications. In brief, deparaffinized sections were heated in 2x standard saline citrate (SSC) at 70°C for 30 minutes, rinsed in distilled water, and incubated with 10 µg/ml proteinase K in 0.2 M Tris-HCl, pH 7.4, and 0.05 M EDTA at 37°C for 20 minutes. After proteinase digestion, slides were postfixed in 10% formalin in PBS (20 minutes), quenched in 0.2% glycine (5 minutes), rinsed in distilled water, rapidly dehydrated through graded ethanols, and air-dried. The hybridization mixture contained 50% formamide, 4x SSC, pH 8.0, 1x Denhardt's solution, 0.5 mg/ml herring sperm DNA, 0.25 mg/ml yeast RNA, 10 mM dithiothreitol (DTT), 10% dextran sulfate, and 3 x 104 cpm/µl 35S-UTP-labeled riboprobe. After application of the hybridization mixture sections were covered with sheets of polypropylene film cut from autoclavable disposable bags and incubated in humidified chamber at 65°C overnight. After hybridization, covering film was floated off in 5x SSC with 10 mM DTT at 65°C, and slides were washed at high stringency (2x SSC, 50% formamide, and 10 mM DTT at 65°C for 30 minutes) and treated with RNAse A (10 µg/ml) for 30 minutes at 37°C. Slides were next washed in 2x SSC and 0.1x SSC (15 minutes each) at 37°C. Then slides were rapidly dehydrated through ascending ethanols and air-dried. For autoradiography, slides were dipped in Kodak NTB-2 nuclear track emulsion diluted 1:1 with double-distilled water and exposed for 3 weeks in light-tight box containing desiccant at 4°C. Exposed slides were developed in a Kodak D-19 developer, fixed in a Kodak fixer, and counterstained with hematoxylin-eosin. Microphotographs were taken using Zeiss Axioscop-2 microscope (Carl Zeiss, Jena, Germany, http://www.zeiss.com) equipped with Diagnostic Instruments Spot RT CCD camera (Sterling Heights, MI, http://www.diaginc.com/).
Reverse Transcription-Polymerase Chain Reaction Analysis
Reverse transcription-polymerase chain reaction (RT-PCR) was performed on cDNAs obtained from the indicated cells and tissues. Total RNA was isolated from the above cells or tissues using either TriReagent (Molecular Research Center) or RNeasy Mini Kit (Qiagen, Valencia, CA, http://www1.qiagen.com) in accordance with the manufacturer's instructions. To prevent genomic DNA contamination, samples were treated with DNase (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com). Single-strand cDNAs were then prepared using SuperScript reverse transcriptase (Invitrogen, Carlsbad, CA, http://www.invitrogen.com). Analysis of gene expression was done using polymerase chain reaction (PCR) with ReadyMix PCR Master Mix (ABgene, Surrey, U.K., http://www.abgene.com). The primers that were used are summarized below. Primers generated for heavy and light chains were designed to the constant region of the specific chain mentioned. The oligonucleotide primers examined are shown as follows:
µHC sense (s) 5'-TAGGTTCAGTTGCTCACGAG-3', antisense (as) 5'-GTGACCATCGAGAACAAAGG-3';
HC s 5'-CTCCTCTCAGAGTGCAAAGCC-3', as 5'-GGATGTTCACAGTGAGGTTGC-3';
HC s 5'-CATGAGCAGCCAGTTAACCCTG-3', as 5'-ATGCAGCCATCGCACCAGCAC-3';
HC s 5'-GACTCCCTGAACATGAGCACTG-3', as 5'-GGTACTGTGCTGGCTGTTTGAG-3';
1HC s 5'-CTGGAGTCTGACCTCTACACTCTG-3', as 5'-CAGGTCAGACTGACTTTATCCTTG-3';
2AHC s 5'-GATGTCTGTGCTGAGGCCCAGG-3', as 5'-GGAAGCTCTTCTGATCCCAGAG-3';
2BHC s 5'-GAGTCAGTGACTGTGACTTGGAAC-3', as 5'-ACCAGGCAAGTGAGACTGAC-3';
3 HC s 5'-CTGGCTGCAGTGACACATCT-3', as 5'-GGTGGTTATGGAGAGCCTCA-3';
LC s 5'-CTTGCAGATCTAGTCAGAGCC-3', as 5'-CAATGGGTGAAGTTGATGTCTTG-3';
LC s 5'-CCAAGTCTTCGCCATCAGTCAC-3', as 5'-GAACAGTCAGCACGGGACAAAC-3', VH deg s 5'-SARGTNMAGCTGSAGSAGTCWGG-3' adopted from [34],VH J558 s 5'-ATAGCAGGTGTCCACTCC-3' adopted from [35],
5 s 5'-TGGGGTTTGGCTACACAGAT-3', as 5'-CCCACCACCAAAGACATACC-3'; VpreB s 5'-GTACCCTGAGCAACGACCAT-3', as 5'-GTACCCTGAGCAACGACCAT-3'; Ig
s 5'-TGCCTCTCCTCCTCTTCTTG-3', as 5'-TGATGATGCGGTTCTTGGTA-3'; Igβ s 5'-TCAGAAGAGGGACGCATTGTG-3', as 5'-TTCAAGCCCTCATAGGTGTGA-3'; and B220 s 5'-CAAAGTGACCCCTTACCTGCT-3', as 5'-CTGACATTGGAGGTGTGTGT-3'.
Rapid Amplification of cDNA Ends
The 5'-end of the mesenchymal Ig µHC or mesenchymal Ig
HC transcripts were mapped using the FirstChoice RNA Ligase-Mediated Rapid amplification of cDNA Ends kit (Ambion, Austin, TX, http://www.ambion.com) in accordance with manufacturer's instructions. RNA was isolated from either MBA-2.1 cells or IgM–/– MEFs using the RNeasy Mini Kit (Qiagen) according to manufacturer's instructions. Nested PCRs were used to amplify the 5'-end of the mesenchymal Ig µHC transcript. The 5'-rapid amplification of cDNA ends (RACE) outer primer provided was used for the outer PCR reaction, together with the specific primer 5'-CACGGCAGGTGTACACATTCAGGTTC-3', whereas the 5'-RACE inner primer provided, together with the specific primer 5'-CGTGGCCTCGCAGATGAGTTTAGACTTG-3', was used for the inner PCR reaction. Nested PCRs were then used to amplify the 5'-end of the mesenchymal Ig
HC transcript. The 5' RACE outer primer provided was used for the outer PCR reaction together with the specific primer 5'-GGATGTTCACAGTGAGGTTGC-3', whereas the 5'-RACE inner primer provided, together with the specific primer 5'-AGTGACCTGGAGGACCATTG-3', was used for the inner PCR reaction. The 3'-end of the mesenchymal Ig
HC transcript was mapped using the same total RNAs. First-strand cDNA was generated using a tagged oligo(dT) primer (Gibco-BRL, Gaithersburg, MD, http://www.gibcobrl.com) followed by RNAse-H reaction. The cDNA was then used as a template for PCR performed with the universal amplification primer (UAP) provided and the specific primer 5'-GCAACCTCACTGTGAACATCCTG-3'. A second PCR was obtained with the same UAP primer and the specific primer 5'-GCTTAATGCCAGCAAGAGCCTAG-3'. The resultant PCR products were cloned into pGEM-T (Promega) and sequenced.
Statistical Analysis
Student's paired t-test was used to evaluate the significance of differences between experimental groups.
 |
RESULTS
|
|---|
Expression of Pre-BCR/BCR Components in Primary and Long-Term Cultured Mesenchyme: IgM Deficiency Results in Upregulation of
Chain mRNA
We set out to examine the possibility that the mesenchyme expresses BCR components. RT-PCR detected expression of Ig µHC mRNA in primary MEF cell strains from 12.5-dpc embryos and in a cloned mouse bone marrow stromal cell line, MBA-2.1 [32] (Fig. 1Ai). In contrast, MEFs from IgM–/– that serve as a negative control had no such transcript. No expression of light chains was detected in WT MEF or MBA-2.1 cells, indicating that the µHC expression is not as a result of contamination of the mesenchymal cell cultures with lymphocytes. Northern blot analysis of mRNA from MBA-2.1 cells with a probe for µHC revealed a short transcript (
2 kilobases) (Fig. 1B). Analysis of additional Ig isotypes indicated that
chain is not found. Surprisingly,
substituted for µ isotype in the IgM–/– MEF (Fig. 1Ai). We further identified VpreB expression in the three cell types under study (Fig. 1Aii), as well as Ig
, Igβ, and
5 that were, however, detected inconsistently in WT and IgM–/– MEFs and were not expressed in the MBA-2.1 cell line (Fig. 1C). Neither
nor
Ig isotypes were expressed in MEFs, nor were
and
LCs (Fig. 1Ai). The µHC transcript was further detected in several murine mesenchymal cells lines that exhibit MSC functions [22, 24, 25] as well as in primary bone marrow-derived MSCs (Fig. 1D).

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1. Pre-B cell receptor (pre-BCR)/B cell receptor gene expression in mesenchyme. (A): Reverse transcription-polymerase chain reaction (RT-PCR) analysis of cDNAs obtained from the MBA-2.1 cell line, WT MEFs, and IgM–/– MEFs. (i): Expression of the constant regions of the different Ig isotypes; (ii): Expression of SLCs and the pre-BCR accessory molecules. RNA from WT spleen and water (DDW) were used for positive and negative controls, respectively (the same controls were used for the RT-PCR analyses shown in Fig. 2). (B): Northern blot analysis of Ig µHC transcripts. The amount of total RNA loaded in each lane: MBA-2.1 cells (40 µg), IgM–/– MEFs (5 µg), and WT spleen from 10-week old mice (2 µg). (C): A schematic summary of RT-PCR analysis from three independent experiments. Red, expression; green, no expression; yellow, inconsistent (only some cell batches were positive). (D): µHC expression by several murine mesenchymal cell lines and primary MSCs. Abbreviations: DDW, double-distilled water; HC, heavy chain; kb, kilobase(s); MEFs, mouse embryo fibroblasts; WT, wild type.
|
|
Expression of Pre-BCR/BCR Components in the Early Embryo
To ascertain that the detection of Ig gene products in cultured mesenchyme was not an in vitro-restricted phenomenon, we turned to the examination of these mRNAs in embryonic tissues. Two different sets of primers were designed to enable RT-PCR detection of, and differentiation between, germline versus rearranged Ig µHC transcripts. Unfertilized oocytes were found to express an unrearranged Ig µHC transcript, whereas
HC was not detected (Fig. 2). In addition, light chains expression was not observed (data not shown). Because the µHC transcripts were found in cells and tissues that were not expected to harbor such mRNAs, we verified the validity of the analysis by examining tissues from µ chain-deficient mice in which such transcripts were indeed absent as expected (Fig. 2). In the IgM–/– mouse oocytes, the unrearranged Ig µHC transcript was replaced by an unrearranged Ig
HC transcript. Likewise, morulae from WT mice expressed unrearranged Ig µHC mRNA, whereas no
HC was detectable. The reverse was found in the IgM–/– mice (Fig. 2). Although these results could imply that the expression of µ and
chains is mutually exclusive, analysis of 11.5-dpc heterozygous (IgM+/–) embryos revealed that both the unrearranged Ig µHC and the Ig
HC transcripts were concomitantly detectable (Fig. 2). We subsequently investigated the expression of the Ig µHC mRNA in older 12.5-dpc WT and IgM–/– embryos. The Ig µHC mRNA transcript was expressed both in the embryo proper and in the yolk sac, whereas no Ig
HC expression was observed. In the IgM–/– embryos and yolk sacs, expression of only the
HC mRNA was observed. The lack of expression of the B-cell marker B220 (data not shown) or transcripts derived from Ig µ rearrangements further supports the inference that the Ig µHC gene in WT embryos and Ig
HC in IgM–/– embryos are being expressed by nonlymphoid cells. To further assure that maternal lymphocytes do not account for detection of Ig transcripts in the embryonic tissues, RT-PCR analysis was performed using 12.5-dpc WT embryos that were transplanted, at the morulae stage, into IgM–/– pseudopregnant recipient mothers. These embryos did express µHC (Fig. 2), thus providing strong evidence that Ig HC mRNAs that were detected are endogenous to the embryo.
Although IgM–/– mice exhibit normal B-cell development and maturation [30], the antibody repertoire in these animals is altered [31]. The question was therefore raised as to whether the lack of µHC mRNA would impact mesenchymal cell functions and early development. In our animal stock, IgM–/– mice had smaller litter sizes than their WT counterparts (Fig. 3Ai). To examine early stages of development, we obtained 2.5-dpc morulae from both IgM–/– and WT mice. Four independent experiments were performed; in each experiment, morulae were harvested from 12 to 20 female mice per group. The results of the average total number of morulae per female are shown in Figure 3Aii. IgM–/– mice had an average number of 9.66 ± 0.26 total morulae per female compared with 16.2 ± 0.28 per WT female. Furthermore, morulae were scored as having good developmental potential (being "intact") if compacted and containing at least four cells and up to 16 cells. IgM–/– mice had an average number of 2.9 ± 0.14 intact morulae per female compared with 7.2 ± 0.14 per WT female (Fig. 3Aiii). The reduced frequency of intact morulae imply a role for µ chain mRNA or protein in early development. Western blot analysis of protein extracts from 12.5-dpc embryo proper versus the yolk sac detected protein bands of 75 and 50 kDa only in WT yolk sac (Fig. 3Bi) visceral layer (Fig. 3Bii). This protein was maternally derived; 2.5-dpc WT morulae were transplanted into IgM–/– pseudopregnant recipient mothers and vice versa. Subsequently, embryos were collected at 12.5 dpc. Both Western (Fig. 3Ci) and immunohistochemical (Fig. 3Cii, 3Ciii) analysis of tissues indicate that only yolk sacs derived from IgM–/– embryos transplanted into WT pseudopregnant recipient mothers were IgM-positive (Fig. 3Ci, 3Ciii).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3. Increased incidence of defective morulae in IgM–/– pregnancies and maternal origin of yolk sac IgM. (A): Litter size and morulae properties: litter size (i) (averages were derived from 120 deliveries in the IgM–/– stock and 500 deliveries in the WT stock) and total number of morulae (ii), and number of intact morulae (iii) (a total of 65 IgM–/– and 82 WT female mice). Values are means ± standard error (p < .0001). All differences shown are statistically significant. (B): (i) Western analysis using anti-IgM antibody. Immunohistochemical staining using anti-IgM antibody of yolk sac from WT (ii) and IgM–/– 12.5-dpc embryos (iii). Original magnifications x40, bar, 50 µM. (C): (i) Western blot analysis using anti-IgM antibody. Immunohistochemical analysis using anti-IgM antibody was performed on sections from 12.5-dpc WT embryo transplanted into IgM–/– pseudopregnant recipient mother (ii) and 12.5-dpc IgM–/– embryo transplanted into WT pseudopregnant recipient mother (iii). Original magnifications: x10; bar, 200 µM. The abbreviations WT in IgM–/– refers to WT embryos that were transplanted at the morulae stage into IgM–/– pseudo-pregnant recipient mothers, and the abbreviation IgM–/– in WT refers to IgM–/– embryos that were transplanted at the morulae stage into WT pseudopregnant recipient mothers. Abbreviations: E, embryo; WT, wild type; YS, yolk sac.
|
|
Identification of the µHC and
HC mRNA-Expressing Cells Within Mid-Gestation Mouse Embryo
We next examined the nature of cells in mid-gestation that express BCR components. Sections from both WT and IgM–/– embryos were hybridized in situ with 35S-labeled antisense RNA probes derived from the constant regions of either µHC (Fig. 4) or
HC (Fig. 5). In 12.5-dpc WT embryos, the positive cells expressing µHC were mesenchymal cells located in the loosely packed mesenchyme adjacent to the spinal cord (Fig. 4A–4C), attached to the yolk sac (Fig. 4D), or similar cells in the proximity of blood vessels (Fig. 4E, 4F). No signal for µHC was detected in IgM–/– embryos (Fig. 4G, 4H). In 12.5-dpc IgM–/– embryos,
HC-positive cells were observed located in the proximity of blood vessels (Fig. 5A–5C) or embedded within loose mesenchymal tissue (Fig. 5D). Thus, the in vivo identification of the Ig HC mRNA-expressing cells in mid-gestation embryos corroborates the in vitro detection of these mRNAs in mesenchyme.

View larger version (104K):
[in this window]
[in a new window]
|
Figure 4. In situ hybridization localizes Ig µHC mRNA to embryonic mesenchyme. 35S-Labeled anti-sense RNA probe derived from the constant region of Ig µHC was used to hybridize wild type (WT) (A–F) and IgM–/– (G, H) 12.5-dpc embryos. Transverse sections of WT (A, B) and IgM–/– (G, H) embryos stained with hematoxylin-eosin (A, C, D, E, F) and dark-field views of (A) (B) and (G) (H) are shown, as well as an enlargement (C) of the boxed area in image (A). Arrows point to representative positive cells. Original magnifications: x10, bar, 200 µM (A, B, G, H); x126 (C, D) and x63 (E, F), bar, 20 µM.
|
|

View larger version (125K):
[in this window]
[in a new window]
|
Figure 5. In situ hybridization detects Ig HC RNA-expressing cells in IgM–/– embryos: 35S-Labeled anti-sense RNA probe derived from the constant region of Ig HC was used to hybridize IgM–/– (A–D) and WT (E, F) 12.5-dpc embryo sections. Dark-field images of (A) and (E) are shown in (B) and (F), respectively. (C, D): Enlarged images of areas in (A), and the insets in these images show more details of the boxed areas. Original magnifications: x20, bar, 100 µM (A, B, E, F); x63, bar, 50 µM (C) and x90 (inset); and x40, bar, 50 µM (D) and x60 (inset).
|
|
Cloning and Structure Analysis of Ig µ and
HC Transcripts from Mesenchymal Cells
RACE using RNA derived from MBA-2.1 cells indicated that the mesenchymal Ig µHC transcript is an unrearranged truncated form (Fig. 6B). A unique 5'-UTR is found in the mRNA that is homologous to a part of the µ switch region D-q52. Downstream to this 5'-UTR, the clone encodes the complete four exons of the Ig µHC constant region. Thus, this mRNA is a hybrid transcript that includes some exons from previously characterized genes (supplemental online Fig. 1). Both cytosolic and membrane type of transcript were cloned from the stromal cell line (Fig. 6B). The mesenchymal from of
HC lacks the variable segments that are upstream to the µHC constant region in the Ig locus (Fig. 6A). The MEF form of
HC consists of only the C region of the lymphoid form. The DNA sequence is composed of two C-region domains, C
1 and C
3, separated by the C
H hinge domain. A 5'-UTR stretch of 39 bases is present upstream to the described C region (Fig. 6D and supplemental online Fig. 1), which is homologous to a part of the µ switch region D-q52. Four distinctive 3' ends that generate four mRNA isoforms of the mesenchymal truncated
were isolated (Fig. 6D). Thus, mesenchyme expresses truncated forms of µ and
HCs that consist of the C region only, that is, Cµ and C
. Because both transcripts contained in-frame ATGs (Fig. 6B, 6D), proteins could potentially be encoded.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6. Schematic structure of µ and HC mRNAs cloned from wild type (WT) and IgM–/– mouse embryonic fibroblasts, respectively. (A): The exon-intron structure of the entire immunoglobulin heavy chain (HC) locus. (B): The mesenchymal truncated Ig µHC mRNA transcripts: the two isoforms comprise six identical axons. *, the unique genomic sequence TTCTAAAGGGGTCTATGATAGTGTGAC found on this mRNA; Cµ1–Cµ4-, the Ig µHC constant region exons. (C): An enlargement of the constant HC region locus (1–7). (D): Illustration of the mesenchymal truncated HC transcripts: all four isoforms (i–iv) comprise the same first three exons. , the unique genomic sequence AAAGAATGGTATCAAAGGACAGTGCTTAGATCCAAGGTG; C 1,C H, and C 3, the Ig HC constant region exons (1–3). The four isoforms differ in their ending exons: isoform i possesses exon 4, which does not have any known properties (colored in light gray); isoform ii possesses exon 5, which has cytosolic features represents as (s); isoform iii possesses exon 6, which contains a transmembrane domain, represented as m, and isoform iv differs from isoform iii only in its additional noncoding 3'-end sequence (exon 7, colored in dark gray). Abbreviations: J2, JH2 sequence; L, leader sequence; m, exons of the transmembrane domain; s, secreted form sequence (isoform i).
|
|
Cµ mRNA Encodes a 50-kDa Protein That Assumes an Intracellular Localization and Causes Growth Arrest
To examine whether the mesenchyme derived Cµ does encode a protein, we first examined the cDNA in an in vitro transcription/translation system. Figure 7A shows that this mRNA encodes a newly synthesized protein of approximately 50 kDa. An expression vector containing the mesenchymal Cµ transcript and the full-length Ig µHC were used to transfected 293T cells (Fig. 7B). Western blot analysis of extracts from Cµ-transfected cells showed a protein band at about 50 kDa (Figure Aiii). Whereas mesenchymal Cµ was found in a diffuse cytoplasmic staining, the full-length µHC chain was observed in punctate structures scattered throughout the cells (Fig. 7B). To get an insight as to the possible function of this truncated protein, we studied the effects of overexpression in cultured cell lines. The mesenchymal Cµ and the full-length µHC-form B lymphocytes were compared following transfection of 293T cells. The overexpression of mesenchymal Cµ results in morphological changes in the cultured cells that were not seen with the full-length µHC (Fig. 7Cii). Flow cytometric analysis showed that cells expressing the mesenchymal Cµ exhibit a pronounced G1 arrest (Fig. 7Di, right panel). Cells negative for IgM expression (Fig. 7Di, left panel) or cells transfected with empty plasmid (Fig. 7Dii) have normal cell-cycle distribution. In contrast, overexpression of full-length Ig µHC did not affect the cell cycle in a similar manner (data not shown).

View larger version (49K):
[in this window]
[in a new window]
|
Figure 7. Cµ mRNA encodes a 50-kDa protein that causes growth arrest upon overexpression. (A): Cµ protein synthesis in a cell-free system translation/transcription system using 35S-methionine as the radiolabel for the newly synthesized protein (i) and detection of the protein by antibodies to IgM µ chain (ii) and protein expression of Cµ mRNA cloned in a mammalian expression vector and transfected into 293T cells (iii). (B): Cellular localization of the cytosolic mesenchymal Cµ or full-length Ig µHC. Immunofluorescence microscope analysis with anti-IgM antibodies was performed on cells transfected with cytosolic mesenchymal Cµ (i) or cytosolic full-length Ig µHC (ii) in 293T cells. Original magnifications x63; bar, 20 µM. (C): Phase-contrast images of 293T cells 24 hours after transfection with empty vector (i), cytosolic mesenchymal Cµ (ii), and cytosolic full-length Ig µHC (iii). Original magnifications x20; bar, 100 µM. (D): Overexpression of mesenchymal Cµ in 293T cells results in G1 arrest. (i): Gating of cells stained positive and negative for IgM expression is shown in the middle panel. Left arrow shows cell-cycle status of unstained 293T cells, and the right arrow shows cell-cycle status of positively stained 293T cells. (ii): Cell-cycle pattern of 293T cells overexpressing empty vector. Abbreviations: FITC, fluorescein isothiocyanate; PI, propidium iodide.
|
|
 |
DISCUSSION
|
|---|
The precise gene expression pattern of mesenchymal cells has thus far not been determined. We have previously demonstrated that these poorly defined cell populations express TCR mRNA components that are of germ-line nature [20]. It is shown herein that unfertilized mouse oocytes, as well as morulae, express components of the BCR. This expression continues later in embryogenesis in at least a subset of mesenchymal cells, as well as in cultured adult mesenchymal cells. Because the mesenchyme is widely represented in most organs and tissues, it is possible that the presence of the mesenchymal Ig Cµ transcripts may be similarly frequent. This premise is corroborated by the report of expression of truncated TCR forms in neuronal cells [36, 37].
Various forms of truncated Ig µHC transcripts have previously been characterized, such as the Dµ protein encoded by a DJH rearrangement [9, 38] and the heavy chain disease [39] µ chain protein, which lacks the entire variable region [40]. The Ig HC D to JH rearrangement occurs frequently in developing T cells [19], but the V to DJH rearrangement is limited to developing B cells [41]. All of these occurrences of truncated forms of Ig HCs were reported to occur in lymphoid cells, whereas we report herein that Ig µHC and
HC transcripts are expressed in nonlymphoid, mesenchymal cells as well as in unfertilized oocytes and early embryos.
The sequence analysis and expression of the recombinant cDNAs clearly show that the truncated mesenchymal Cµ and C
mRNAs may encode proteins. The calculated predicted molecular size of the putative mesenchymal Cµ protein is 50 kDa, whereas the complete form is 75 kDa. Although a 50-kDa band reactive with anti-IgM antibodies was detected in the yolk sac, this protein was shown in our experiments to originate from a maternal source. Thus, the yolk sac seems to be a sequestration site for maternal IgM. The fact that this IgM is found both in a high and a low mol. wt. form may indicate that it is in a process of degradation. It is possible therefore that the yolk sac serves, in this respect, as a barrier that adsorbs and degrades IgM to minimize the transfer of the molecule into the embryo. Indeed, IgG and small amounts of IgM are placentally transferred from the mother to fetus during gestation in the mouse [42, 43]. Light chains from maternal sources were found to be involved in cell-cell interactions during cerebral cortical development in brain from 12-dpc embryos [44]. These maternal light chains are involved in immunoglobulin-like immunoreactivity. The degradation machinery may be more effective within the embryo proper and could explain our lack of ability to demonstrate the presence of significant amount of µ chain protein despite the abundance of the corresponding mRNA.
Several lines of evidence suggest that the expression of Ig µ chain mRNAs may have functional significance in mesenchymal cells. First, the fact that
substituted for µ suggests that the former may compensate for the lack of µ chain. One possibility is that the presence of µ in WT cells suppresses
expression, which is derepressed in the IgM–/– mice. However, because both chains are expressed concomitantly in mesenchyme in heterozygous mice, and also in B lymphocytes, a more feasible interpretation is that
compensates for the lack of µ. The deletion of µHC positions the
gene closer to a putative promoter upstream to the Cµ region and may result in the observed expression of
in the IgM–/– mice. Second, overexpression of the mesenchymal µ chain in 293T cells caused a morphological change that was not observed following overexpression of the full-length form of this molecule. The functions of other truncated Ig µHC proteins, which have been characterized in B cells, were also shown to be different from the functions of full-length rearranged Ig µHC [9, 14, 40, 45–51]. Although Dµ is functional [11, 52, 53], its activity is aberrant because it blocks further B-cell development [10, 12, 13]. Third, overexpression of the Cµ in 293T cells resulted in growth arrest, suggesting possible involvement in cell growth control. Fourth, µHC deficiency was associated with a poor number of intact morulae that could be derived from pregnant females. These findings point to the possible requirement of Ig gene expression in early development. In the IgM–/– animals used in this study, a deletion of the Cµ and µ-
intron including the regulatory cis-elements for C
expression has been performed [30]. However, the animals exhibit a normal compartment of immature B cells. IgM+ cells were absent but were replaced by IgD-positive cells. Consequently, IgM–/– animals were capable of mounting specific B-cell responses. In view of this normal capability, it is expected that any defect that IgM–/– animals may exhibit, including the reduced incidence of intact morulae, would not be secondary to immune deficiency [30].
We did not observe truncated IgM proteins in the embryo corresponding to the mRNAs that we detected. It should be therefore considered that either the truncated Ig proteins are expressed at a very low level, below the power of detection of the methods used due to, for example, a high-level of degradation. On the other hand, the transcripts may not encode a significant amount of protein, and thus, the implied functions could be mediated by the mRNA itself. Our findings imply that this mRNA or the encoded proteins may have more than one function: the one could be related to early embryo development and the other to mesenchymal cell functions. The mesenchymal undifferentiated appearance, taken together with the capacity of MSCs to differentiate to a variety of cell types, suggests that these cells may in fact be in a stem state, expressing a vast range of genes [54, 55]. The same holds for the early embryo that harbors bona fide stem cells. The findings reported herein might reflect the promiscuous gene expression of stem cells but further suggest that the expression of BCR mRNAs serves specific functions.
 |
DISCLOSURES
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
D.Z. is an incumbent of the Joe and Celia Weinstein Professorial Chair at the Weizmann Institute of Science. We are indebted to Varda Segal for excellent technical assistance. This work was supported by The Charles and David Wolfson Charitable Trust and Ruth Zeigler Trust grants for Stem Cell Research at the Weizmann Institute of Science and by the Gabrielle Rich Center for Transplantation Biology.
 |
REFERENCES
|
|---|
- McLean GR, Nakouzi A, Casadevall A et al. Human and murine immunoglobulin expression vector cassettes. Mol Immunol 2000;37:837–845.[CrossRef][Medline]
- Chen J, Trounstine M, Kurahara C et al. B cell development in mice that lack one or both immunoglobulin kappa light chain genes. Embo J 1993;12:821–830.[Medline]
- Brack C, Hirama M, Lenhard-Schuller R et al. A complete immunoglobulin gene is created by somatic recombination. Cell 1978;15:1–14.[CrossRef][Medline]
- Seidman JG, Leder A, Nau M et al. Antibody diversity. Science 1978;202:11–17.[Abstract/Free Full Text]
- Seidman JG, Leder P. The arrangement and rearrangement of antibody genes. Nature 1978;276:790–795.[CrossRef][Medline]
- Seidman JG, Nau MM, Norman B et al. Immunoglobulin V/J recombination is accompanied by deletion of joining site and variable region segments. Proc Natl Acad Sci U S A 1980;77:6022–6026.[Abstract/Free Full Text]
- Oettinger MA, Schatz DG, Gorka C et al. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 1990;248:1517–1523.[Abstract/Free Full Text]
- Reth M. Antigen receptors on B lymphocytes. Annu Rev Immunol 1992;10:97–121.[CrossRef][Medline]
- Reth MG, Alt FW. Novel immunoglobulin heavy chains are produced from DJH gene segment rearrangements in lymphoid cells. Nature 1984;312:418–423.[CrossRef][Medline]
- Chang Y, Paige CJ, Wu GE. Enumeration and characterization of DJH structures in mouse fetal liver. Embo J 1992;11:1891–1899.[Medline]
- Ehlich A, Martin V, Muller W et al. Analysis of the B-cell progenitor compartment at the level of single cells. Curr Biol 1994;4:573–583.[CrossRef][Medline]
- Gu H, Kitamura D, Rajewsky K. B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound D mu protein and selection of DH element reading frames. Cell 1991;65:47–54.[CrossRef][Medline]
- Haasner D, Rolink A, Melchers F. Influence of surrogate L chain on DHJH-reading frame 2 suppression in mouse precursor B cells. Int Immunol 1994;6:21–30.[Abstract/Free Full Text]
- Bakhshi A, Guglielmi P, Siebenlist U et al. A DNA insertion/deletion necessitates an aberrant RNA splice accounting for a mu heavy chain disease protein. Proc Natl Acad Sci U S A 1986;83:2689–2693.[Abstract/Free Full Text]
- Franklin EC, Frangione B, Prelli F. The defect in mu heavy chain disease protein GLI. J Immunol 1976;116:1194–1195.[Abstract/Free Full Text]
- Karasuyama H, Kudo A, Melchers F. The proteins encoded by the VpreB and lambda 5 pre-B cell-specific genes can associate with each other and with mu heavy chain. J Exp Med 1990;172:969–972.[Abstract/Free Full Text]
- Corcos D, Iglesias A, Dunda O et al. Allelic exclusion in transgenic mice expressing a heavy chain disease-like human mu protein. Eur J Immunol 1991;21:2711–2716.[Medline]
- Corcos D, Grandien A, Vazquez A et al. Expression of a V region-less B cell receptor confers a tolerance-like phenotype on transgenic B cells. J Immunol 2001;166:3083–3089.[Abstract/Free Full Text]
- Kemp DJ, Harris AW, Adams JM. Transcripts of the immunoglobulin C mu gene vary in structure and splicing during lymphoid development. Proc Natl Acad Sci U S A 1980;77:7400–7404.[Abstract/Free Full Text]
- Barda-Saad M, Shav-Tal Y, Rozenszajn AL et al. The mesenchyme expresses T cell receptor mRNAs: Relevance to cell growth control. Oncogene 2002;21:2029–2036.[CrossRef][Medline]
- Zipori D, Duksin D, Tamir M et al. Cultured mouse marrow stromal cell lines. II. Distinct subtypes differing in morphology, collagen types, myelopoietic factors, and leukemic cell growth modulating activities. J Cell Physiol 1985;122:81–90.[CrossRef][Medline]
- Zipori D, Friedman A, Tamir M et al. Cultured mouse marrow cell lines: Interactions between fibroblastoid cells and monocytes. J Cell Physiol 1984;118:143–152.[CrossRef][Medline]
- Zipori D, Toledo J, von der Mark K. Phenotypic heterogeneity among stromal cell lines from mouse bone marrow disclosed in their extracellular matrix composition and interactions with normal and leukemic cells. Blood 1985;66:447–455.[Abstract/Free Full Text]
- Zipori D, Lee F. Introduction of interleukin-3 gene into stromal cells from the bone marrow alters hemopoietic differentiation but does not modify stem cell renewal. Blood 1988;71:586–596.[Abstract/Free Full Text]
- Benayahu D, Kletter Y, Zipori D et al. Bone marrow-derived stromal cell line expressing osteoblastic phenotype in vitro and osteogenic capacity in vivo. J Cell Physiol 1989;140:1–7.[CrossRef][Medline]
- Benayahu D, Fried A, Zipori D et al. Subpopulations of marrow stromal cells share a variety of osteoblastic markers. Calcif Tissue Int 1991;49:202–207.[Medline]
- Baudry A, Yang ZZ, Hemmings BA. PKBalpha is required for adipose differentiation of mouse embryonic fibroblasts. J Cell Sci 2006;119:889–897.[Abstract/Free Full Text]
- Garreta E, Genove E, Borros S et al. Osteogenic differentiation of mouse embryonic stem cells and mouse embryonic fibroblasts in a three-dimensional self-assembling peptide scaffold. Tissue Eng 2006;12:2215–2227.[CrossRef][Medline]
- Lengner CJ, Lepper C, van Wijnen AJ et al. Primary mouse embryonic fibroblasts: A model of mesenchymal cartilage formation. J Cell Physiol 2004;200:327–333.[CrossRef][Medline]
- Lutz C, Ledermann B, Kosco-Vilbois MH et al. IgD can largely substitute for loss of IgM function in B cells. Nature 1998;393:797–801.[CrossRef][Medline]
- Han S, Zhang X, Xu R et al. IgD+IgM-B cells mount immune responses that exhibit altered antibody repertoire. Eur J Immunol 2004;34:661–668.[CrossRef][Medline]
- Zipori D. Cultured stromal cell lines from hemopoietic tissues. In: Mehdi T, ed. Blood Cell Formation: The Role of the Hemopoietic Microenvironment.Clifton, NY: Humana Press,1989;287–333.
- Faerman A, Shani M. Transgenic mice: Production and analysis of expression. Methods Cell Biol 1997;52:373–403.[Medline]
- Wang Z, Raifu M, Howard M et al. Universal PCR amplification of mouse immunoglobulin gene variable regions: The design of degenerate primers and an assessment of the effect of DNA polymerase 3' to 5' exonuclease activity. J Immunol Methods 2000;233:167–177.[CrossRef][Medline]
- Chardes T, Villard S, Ferrieres G et al. Efficient amplification and direct sequencing of mouse variable regions from any immunoglobulin gene family. FEBS Lett 1999;452:386–394.[CrossRef][Medline]
- Nishiyori A, Hanno Y, Saito M et al. Aberrant transcription of unrearranged T-cell receptor beta gene in mouse brain. J Comp Neurol 2004;469:214–226.[CrossRef][Medline]
- Syken J, Shatz CJ. Expression of T cell receptor beta locus in central nervous system neurons. Proc Natl Acad Sci U S A 2003;100:13048–13053.[Abstract/Free Full Text]
- Tsubata T, Tsubata R, Reth M. Cell surface expression of the short immunoglobulin mu chain (D mu protein) in murine pre-B cells is differently regulated from that of the intact mu chain. Eur J Immunol 1991;21:1359–1363.[Medline]
- Wahner-Roedler DL, Kyle RA. Heavy chain diseases. Best Pract Res Clin Haematol 2005;18:729–746.[Medline]
- Bakhshi A, Guglielmi P, Coligan JE et al. A pre-translational defect in a case of human mu heavy chain disease. Mol Immunol 1986;23:725–732.[CrossRef][Medline]
- Hsu LY, Liang HE, Johnson K et al. Pax5 activates immunoglobulin heavy chain V to DJ rearrangement in transgenic thymocytes. J Exp Med 2004;199:825–830.[Abstract/Free Full Text]
- Appleby P, Catty D. Transmission of immunoglobulin to foetal and neonatal mice. J Reprod Immunol 1983;5:203–213.[CrossRef][Medline]
- Parr EL, Parr MB. Localization of immunoglobulins in the mouse uterus, embryo, and placenta during the second half of pregnancy. J Reprod Immunol 1985;8:153–171.[CrossRef][Medline]
- Weiner JA, Chun J. Maternally derived immunoglobulin light chain is present in the fetal mammalian CNS. J Neurosci 1997;17:3148–3156.[Abstract/Free Full Text]
- Corcos D, Dunda O, Butor C et al. Pre-B-cell development in the absence of lambda 5 in transgenic mice expressing a heavy-chain disease protein. Curr Biol 1995;5:1140–1148.[CrossRef][Medline]
- Shaffer AL, Schlissel MS. A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development. J Immunol 1997;159:1265–1275.[Abstract]
- Pollok BA, Anker R, Eldridge P et al. Molecular basis of the cell-surface expression of immunoglobulin mu chain without light chain in human B lymphocytes. Proc Natl Acad Sci U S A 1987;84:9199–9203.[Abstract/Free Full Text]
- Mathur A, Lynch RG, Kohler G. Expression, distribution and specificity of Fc receptors for IgM on murine B cells. J Immunol 1988;141:1855–1862.[Abstract]
- Sayegh CE, Demaries SL, Pike KA et al. The chicken B-cell receptor complex and its role in avian B-cell development. Immunol Rev 2000;175:187–200.[CrossRef][Medline]
- Sayegh CE, Ratcliffe MJ. Perinatal deletion of B cells expressing surface Ig molecules that lack V(D)J-encoded determinants in the bursa of Fabricius is not due to intrafollicular competition. J Immunol 2000;164:5041–5048.[Abstract/Free Full Text]
- Horne MC, Roth PE, DeFranco AL. Assembly of the truncated immunoglobulin heavy chain D mu into antigen receptor-like complexes in pre-B cells but not in B cells. Immunity 1996;4:145–158.[CrossRef][Medline]
- Loffert D, Ehlich A, Muller W et al. Surrogate light chain expression is required to establish immunoglobulin heavy chain allelic exclusion during early B cell development. Immunity 1996;4:133–144.[CrossRef][Medline]
- Reth MG, Ammirati P, Jackson S et al. Regulated progression of a cultured pre-B-cell line to the B-cell stage. Nature 1985;317:353–355.[CrossRef][Medline]
- Zipori D. The nature of stem cells: State rather than entity. Nat Rev Genet 2004;5:873–878.[Medline]
- Zipori D. The stem state: Plasticity is essential, whereas self-renewal and hierarchy are optional. STEM CELLS 2005;23:719–726.[Abstract/Free Full Text]