Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


First published online December 7, 2006
Stem Cells Vol. 25 No. 3 March 2007, pp. 807 -815
doi:10.1634/stemcells.2006-0442; www.StemCells.com
© 2007 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2006-0442v1
25/3/807    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sansone, P.
Right arrow Articles by Bonafé, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sansone, P.
Right arrow Articles by Bonafé, M.

THE STEM CELL NICHE

p66Shc/Notch-3 Interplay Controls Self-Renewal and Hypoxia Survival in Human Stem/Progenitor Cells of the Mammary Gland Expanded In Vitro as Mammospheres

Pasquale Sansonea,b, Gianluca Storcia,c, Catia Giovanninia,d, Silvia Pandolfia, Simona Pianettia,e, Mario Taffurellif, Donatella Santinig, Claudio Ceccarellia,g, Pasquale Chiecoa, Massimiliano Bonaféa,c

aCenter for Applied Biomedical Research and
Departments of dInternal Medicine and Gastroenterology,
fSurgical and Anesthesiological Sciences, and
gDepartment of Gastroenterology and Pathology, St. Orsola-Malpighi University Hospital, Bologna, Italy;
Departments of bPharmacology,
cExperimental Pathology, and
eExperimental Evolutionary Biology, University of Bologna, Italy

Key Words. Stem cells • Self-renewal • Hypoxia • Notch-3 • p66Shc • Carbonic anhydrase IX

Correspondence: Massimiliano Bonafé, M.D., Department of Experimental Pathology, University of Bologna, Bologna, Italy. Telephone: 39-051-636-4009; Fax: 39-051-636-3902; e-mail: massimiliano.bonafe{at}unibo.it

Received on July 18, 2006; accepted for publication on November 28, 2006.

First published online in STEM CELLS EXPRESS  December 7, 2006.

    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
The comprehension of the basic biology of stem cells is expected to provide a useful insight into the pathogenesis of cancer. In particular, there is evidence that hypoxia promotes stem cell renewal in vitro as well as in vivo. It therefore seems reasonable that stem cell survival and hypoxia response are strictly connected at molecular level. We here report that the 66-kDa isoform of the SHC gene (p66Shc) is induced in a breast cancer cell line by the exposure to hypoxic environment and that it controls the expression of the stem cell regulatory gene Notch-3. Then, we show that p66Shc/Notch-3 interplay modulates self-renewal (by inducing the Notch-ligand Jagged-1) and hypoxia survival (by inducing the hypoxia-survival gene carbonic anhydrase IX) in mammary gland stem/progenitor cells, expanded in vitro as multicellular spheroids (mammospheres). We conclude that mechanisms that regulate stem cell renewal and hypoxia survival are integrated at the level of the p66Shc/Notch3 interplay. Because Notch-3, Jagged-1, and carbonic anhydrase IX are dysregulated in breast cancer, and because p66Shc is an aging-regulating gene, we envision that these data may help in understanding the relationship among aging, cancer, and stem cells.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Recent literature data support the hypothesis that cancer is a stem cell disease [1]. This notion entails the possibility that the comprehension of the basic biology of stem cells will provide an insight into the pathogenesis of cancer [2]. In this regard, there is evidence that hypoxia affects stem cell function and survival [35]. In vitro, hypoxia actively maintains a stem cell/immature phenotype, induces a loss of differentiation markers, and blocks differentiation [69]. In vivo, stem cells express higher levels of hypoxia-regulated genes than do the more mature progeny, as well as high levels of glycolytic enzymes [10, 11]. Accordingly, stem cells reside in tissue regions (the niche) that are low in vasculature and are that thought to provide a low-oxygen environment [8, 10, 12]. Furthermore, stem cells are enriched up to 1,000-fold among a pool of cells (the so-called side population) that express high levels of the hypoxia-survival gene Bcrp-I [13]. Recent data indicate that the stem cell regulatory Notch pathway shares in an interplay with the hypoxia response modulator HIF-1{alpha} to promote the onset of a stem/undifferentiated phenotype [9]. These findings, linking stem cells with hypoxia survival, lead to the hypothesis that the control of stem cell survival and the regulation of hypoxia response are intimately coupled and that they may share common control gene/pathways. In this investigation, we provide evidence that the mammalian longevity modulator p66Shc [14] is induced by the exposure to hypoxic stimuli and that it controls the expression of the stem cells regulatory gene Notch-3 [15]. Then, we report that a p66Shc/Notch-3 interplay elicits an extracellular signal-regulated kinase (ERK)-dependent upregulation of at least two genes: the Notch ligand Jagged-1 [15] and the hypoxia-survival gene carbonic anhydrase [16]. Furthermore, we show that p66Shc/Notch-3/Jagged-1 axis promotes self-renewal of human stem progenitor cells, expanded in vitro as multicellular spheroids (mammospheres) [17, 18]. Finally, we convey that p66Shc/Notch-3/carbonic anhydrase IX (CA-IX) axis sustains mammosphere survival in the presence of hypoxia. We propose that the findings reported here may help in understanding the relationship among aging, cancer, and stem cells at the molecular level.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
Cell Cultures
MCF-7 cells were grown in RPMI 1640 medium with 10% fetal bovine serum (Euroclone, Milan, Italy, http://www.euroclone.net). Hypoxia was generated in a 95% N2, 5% CO2 incubator (Thermo Electron Corporation, Waltham, MA, http://www.thermo.com). Desferoxamine (DFX) (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) was used as hypoxia mimetic [19], and the phosphatidylinositol 3-kinase inhibitor Ly294002 and the MEK1 inhibitor UO126 were purchased from Sigma-Aldrich. Monoclonal antibody (MoAb) that blocks Notch-3/Jagged-1 receptor-ligand interaction was purchased from R&D Systems Inc. (Minneapolis, http://www.rndsystems.com). MCF-7-derived multicellular spheroids (MCF-7S) were generated by resuspending 1 x 104 MCF-7 cells in complete RPMI 1640 medium and plated in 3-cm2 low-attachment plates (Corning, Corning, NY, http://www.corning.com). MCF-7S were assessed at day 7 of culture. MCF-7-derived DFX-resistant clones were isolated by administering MCF-7 cells with 100 µM DFX every 3 days, concomitantly with medium change, for several weeks. Such a treatment elicited a massive cell death of parental MCF-7 (>99% after 10 days), followed by the outgrowth of several clones. The clones were then assessed for resistance to DFX-induced cell death: >90% of survival after 96 hours of exposure to 100 µM DFX was observed for clones 1 and 2 (reported in this investigation), versus 20% ± 15% of survival in parental MCF-7 cells. Such cells were cultured in the absence of DFX for several weeks, without observing appreciable changes in the expression of the genes of interest (Results).

Generation of Mammospheres from Normal and Ductal Breast Carcinoma Human Tissue Specimens
Seven surgical specimens were processed for this investigation (supplemental online Table 1), following a procedure that was approved by the local ethical committee and by the patients' written informed consent. Tumor samples (ductal breast carcinoma) were separated from the surrounding normal tissue, under sterile conditions, and were diagnosed as normal or neoplastic, following standard diagnostic procedures (supplemental online Table 1). Tissues were then processed to generate mammospheres (MS) according to procedures described elsewhere, which were suited to processing tissues samples weighing from 0.3 to 1.5 g [1721]. Briefly, tissues were minced and incubated for 6–12 hours in the presence of collagenase/hyaluronidase mixture enzyme in Epicult medium (Stem Cell Technologies, Vancouver, BC, Canada, http://www.stemcell.com). Cells were pelleted and then resuspended, filtered through a 40-µm nylon mesh, and plated in to 3-cm2 low-attachment wells filled with 3 ml of mammary epithelial growth medium (MEGM) supplemented with B27 supplement, 10 ng/ml epidermal growth factor, 10 ng/ml basic fibroblast growth factor, 10 µg/ml insulin, 10–6M hydrocortisone, and ad hoc aliquots of gentamycin and amphotericine (Cambrex, Walkersville, MD, http://www.cambrex.com). A suitable amount of mammospheres was obtained from seven of seven normal samples and from six of seven tumor samples (supplemental online Table 1). Primary MS started forming after 4–6 days and were processed at day 14. Secondary MS were generated by incubating day 14 primary MS in 1x trypsin-EDTA solution (Cambrex) for 1–3 minutes, followed by two washes in complete MEGM and a filtration through a 40-µm nylon mesh. Secondary MS were assessed at day 7.

p66Shc- and CA-IX-Specific Double-Strand Short Interfering RNA
p66Shc-specific (SHC) and scramble control (SCR) short interfering RNA (siRNA) oligonucleotides were purchased from Qiagen (Valencia, CA, http://www1.qiagen.com). The specificity of the SHC siRNA for the 66-kDa isoform has been reported previously [22]. The transfection of such siRNA did not elicit cytotoxic effects in MCF-7 cells, but it was efficient in inducing gene silencing in mammospheres (supplemental online Fig. 1). CA-IX and appropriate SCR siRNA were purchased from Invitrogen (Carlsbad, CA, http://www.invitrogen.com). SHC/CA-IX/SCR siRNA was transfected to adherent MCF-7 cells (105 cells in a 3-cm2 well) at a concentration of 1 µg/well, using Lipofectamine 2000 (Invitrogen). SHC/CA-IX/SCR siRNA transfection in MS and MCF-7S was performed, by mixing 1 µg of siRNA with in vitro JET-PEI reagent (Poly Plus Transfection, Illkirch, France, http://www.polyplus-transfection.com) in a 5:1 reagent/siRNA proportion per 1 ml of culture medium in a 0.75-cm2 well.

Notch-3-Specific Short Hairpin RNA Transient and Stable Interference
Notch-3-specific short hairpin RNA (shRNA) interference was performed by cloning an oligonucleotide consisting of a BglII site, a 21–22-nucleotide sense sequence (GATCCCCCTCCCCTC ACCACCTAATAAAT TCAAGAGATTTATTA GGTGG TGAGGG GAGTTTTTGGAAC), a short spacer (TTCAAGAGA), a 21–22-nucleotide antisense sequence (TCGAGTTCC AAAAACTC CCC TCA CCACCT AATAAA TCT CT TGAAT TTAT TAGGTGG TGAGGGGAGGGG), five thymidines (a stop signal for RNA polymerase III), and a XhoI site into the pSuper-Puro expression retroviral vector (OligoEngine, Seattle, WA, http://www.oligoengine.com). One µg of the plasmid was transfected on 60% confluent cells in 3-cm2 wells using Lipofectamine 2000 (Invitrogen). The same vector encoding a shRNA that does not match to any human known transcript (5' gatcccc AATATC CTTGGA CACAAG TTG ttcaagaga CAACTT GTGT CCAA GGATATT tttttggaac 3') was used as control for Notch-3-specific (N3) shRNA transfection. The same vector was also used to generate MCF-7 cells stably expressing N3/control (CTR) shRNA. Retroviral gene transfer was performed as follows: Phoenix cells (kindly provided by Dr. K.K. Marcu, Department of Molecular Biology, State University of New York at Stony Brook, Stony Brook, NY) were grown at 85% confluence and were transfected overnight with 10 µg of the pSuper-Puro vector encoding an N3/CTR shRNA using Lipofectamine 2000 (Invitrogen). Two days after transfection, the medium containing newly packaged retrovirus was collected and filtered through a 0.45-µm pore size filter. After supplementation with 4 µg/ml polybrene (Sigma-Aldrich), the augmented medium was applied to MCF-7 cells at 50% confluence for 24 hours. Successfully infected cells were selected by culturing the cells in the presence of 2 µg/ml Puromycin (Sigma-Aldrich) for 2 weeks.

Expression Vectors and Luciferase Assay
The active form of Notch-3 (NICD-3) was cloned by polymerase chain reaction (PCR) using the following primers: forward, TCTTGCTGCTGGTCATTCTC; reverse, GGCCCCCAAGATCTAAGAAC; using Herculase Taq polymerase (Stratagene, La Jolla, CA, http://www.stratagene.com). The PCR product was inserted into pcDNA3.1/V5-His Topo TA expression vector (Invitrogen). pCDNA3.1 expression vectors encoding the wild-type p66Shc protein (p66WT) or serine-to-alanine mutated residue 36 p66Shc (p66S36A) were kindly provided by Dr. Yoshikuni Nagamine (Frederich Miers Center for Research, Basel, Switzerland). Cells (105) plated in 3-cm2 wells were cotransfected with 500 ng of pNICD3 or 800 ng of p66WT or pS36A and 300 ng of empty pCMS vector encoding the green fluorescent protein (Clontech, Palo Alto, CA, http://www.clontech.com) to control for transfection efficiency. Carbonic anhydrase promoter activity was assessed by using a pGL-3 vector containing a luciferase gene under the control of a –174/+63 fragment of the carbonic anhydrase IX promoter (kindly provided by Jaromir Pastorek, Slovak Academy of Sciences, Bratislava, Slovak Republic). Sixty percent confluent cells, plated on 0.75-cm2 wells, were cotransfected with 500 ng of CA-IX Luc and 20 ng of thymidine kinase promoter-driven Renilla luciferase-encoding vector (TK-Renilla; Promega, Madison, WI, http://www.promega.com) to control for transfection efficiency. All the transfections procedures were performed using Lipofectamine 2000. Luciferase activity was assessed by the Dual-Luciferase reporter assay system according the manufacturer's instructions (Promega).

Reverse Transcription-PCR Analysis
Total RNA was extracted from cells using TRIzol (Invitrogen). Primers used in the reverse transcription (RT)-PCR analysis are listed in supplemental online Table 2. PCR primers and reagents were purchased from Invitrogen.

Cell Death Assessment and DNA Oxidative Damage
Cell death was evaluated by trypan blue exclusion (vital staining), counting at least 300 cells for each round of cell death. Cell death in MS was assessed by trypan blue exclusion on entire MS or on single cells obtained after MS digestion with 1x trypsin-EDTA for 3 minutes. Comet assay on MCF-7 and MS was performed to evaluate the extent of DNA oxidation by digesting DNA with formamidopyrimidine DNA glycosylase (Sigma-Aldrich), which catalyzes the excision of oxidized purines from genomic DNA. The procedure has been described in detail elsewhere [23]. The slides were stained with ethidium bromide (10 µg/ml). At least 200 cells were counted for each sample and analyzed by CASP software (available at http://casp.sourceforge.net).

Western Blot
Cell lysates were prepared, run, and blotted using standard methodologies and probed with specific mouse MoAbs against SHC (clone PGP-797; Santa Cruz Biotechnology Inc., Santa Cruz, CA, http://www.scbt.com), ERK and phosphorylated ERK (Cell Signaling Technology, Beverly, MA, http://www.cellsignal.com), CA-IX (clone M-75; kindly provided by J. Pastorek, Slovak Academy of Sciences), β-actin (Sigma-Aldrich), HIF1-{alpha}, and vascular endothelial growth factor-specific (Upstate, Charlottesville, VA, http://www.upstate.com) and Notch-3-specific rabbit polyclonal antibody (H-134; Santa Cruz Biotechnology).

Statistical Analysis
Data were analyzed by two-sided t test (unequal variance assumed), implemented in the SPSS 10.1 package (SPSS, Inc., Chicago, http://www.spss.com).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
p66Shc Promotes Survival of Breast Cancer Cells in a Hypoxic Environment
This investigation started with the observation that the 66-kDa isoform of SHC gene is upregulated in MCF-7 breast cancer cell line exposed to the hypoxia-mimetic DFX at a concentration of 100 µM or to anoxia (<0.1% O2; Fig. 1A).


Figure 1
View larger version (25K):
[in this window]
[in a new window]

 
Figure 1. p66Shc promotes hypoxia survival. (A): MCF-7 cells exposed to 100 µM DFX or to <0.1% O2 for 24 hours: Western blot (WB) analysis of SHC isoforms and reverse transcription-polymerase chain reaction (RT-PCR) analysis of p66Shc mRNA level. (B): MCF-7 cells exposed to 100 µM DFX or <0.1% O2 for 24 hours, pre-exposed to 1 µg of SHC or SCR siRNA for 72 hours: cell death analysis (n = 3 replicates; *, p = .019; #, p = .002), comet assay for the detection of DNA oxidation level (**, p = .003; ##, p = .05; upper panel), and RT-PCR analysis of p66Shc mRNA level (lower panel). (C): DFX-selected MCF-7 clones 1 and 2: RT-PCR analysis of p66Shc mRNA and WB protein expression of SHC isoforms at various times of DFX withdrawal (upper panel), analysis of cell death (n = 3 replicates; *, p = .005; #, p = .006), induced by the exposure to 600 µM DFX for 24 hours in the presence of 1 µg of SCR/SHC siRNA (72 hours of pre-exposure), and RT-PCR analysis of p66Shc mRNA level (lower panel). (D): MCF-7-derived spheroids (MCF-7S at day 7): RT-PCR analysis of p66Shc mRNA level (upper panel), cell death analysis induced by the administration of 1 µg of SCR or SHC siRNA for 48 and 72 hours (n = 3 replicates; *, p = .021; #, p = .008), and RT-PCR analysis of p66Shc mRNA level (lower panel). β2µ mRNA level and β-actin protein level were assessed as quantitative controls for RT-PCR and WB analysis, respectively. Data are reported as mean ± SD. Abbreviations: β2µ, β2-microglobulin; DFX, desferoxamine; SCR, scramble control; SHC, p66Shc-specific; siRNA, short interfering RNA.

 
To assess the role of p66Shc in hypoxia response, a p66Shc-specific short-interfering RNA (SHC siRNA) was administered to MCF-7 cells in the presence of 100 µM DFX or <0.1% O2, and we found that SHC siRNA administration was associated with a higher level of cell death and of genomic DNA oxidative damage in comparison with control SCR siRNA (Fig. 1B). To further test the hypothesis that p66Shc expression confers a survival advantage in the presence of hypoxia, MCF-7 cells were exposed to 100 µM DFX every 3 days for several weeks. Such a treatment caused a massive cell death, followed by the outgrowth of DFX-resistant clones. The clones expanded after such a selection procedure (here are reported two representative clones, named clones 1 and 2) were found to express high levels of the p66Shc isoform, even 4 weeks after DFX withdrawal (Fig. 1C, upper panel). Moreover, the administration of SHC but not SCR siRNA to DFX-resistant cells elicited an increase in cell death and DNA oxidative damage when cells were exposed to DFX (note that cell death was assessed by administering DFX at a concentration of 600 µM, since no appreciable cell death was found at a DFX concentration of 100–500 µM; Fig. 1C, lower panel). To gain additional information on the role of p66Shc upregulation in hypoxia survival, MCF-7 cells were also cultured as multicellular spheroids (MCF-7S), a culture condition that creates a mildly hypoxic environment [24]. In keeping with the expectations, a substantial upregulation of the p66Shc isoform was found in MCF-7S with respect to adherent MCF-7 cells (Fig. 1D, upper panel). Moreover, the administration of SHC siRNA caused an increase in cell death, compared with SCR siRNA (Fig. 1D, lower panel). These data suggest that the upregulation of endogenous p66Shc promotes survival of breast cancer cells in the presence of various kinds of hypoxic environments. Interestingly, such a phenomenon did not occur when MCF-7 cells were exposed to other cytotoxic stimuli (supplemental online Fig. 1, middle panel).

CA-IX Upregulation Mediates p66Shc Hypoxia Survival
We then attempted to search for the regulation of hypoxia-survival genes by the p66Shc gene product. We found that the administration of SHC but not SCR siRNA to MCF-7 cells exposed to DFX, MCF-7S, and DFX-resistant clones downregulated the mRNA of the hypoxia-survival gene CA-IX (Fig. 2A). To prove that CA-IX mRNA is a p66Shc-regulated gene, we transfected MCF-7 cells, in the presence of 100 µM DFX, with a plasmid either empty or encoding p66WT or the serine-to-alanine mutated residue p66Shc (p66S36A) protein. We found that only in the presence of 100 µM DFX did p66S36A-transfected MCF-7 cells exhibit higher levels of CA-IX mRNA with respect to control-transfected ones (Fig. 2B, left panel). No CA-IX upregulation was observed when the transfection was performed in the absence of DFX (data not shown). Accordingly, p66S36A-transfected cells exhibited a lower rate of cell death in the presence of 100 µM DFX with respect to empty vector-transfected cells (Fig. 2B, left panel). Notably, although the transfection of MCF-7 cells with p66WT did not significantly alter the expression of CA-IX mRNA or the rate of cell death (Fig. 2B, left panel), it elicited an increase in cell death rate in the presence of oxidative stress (supplemental online Fig. 1, lower panel), in agreement with previous data [14]. Finally, to verify that CA-IX gene expression mediates cell survival of MCF-7 in hypoxic conditions, a CA-IX-specific siRNA was administered to MCF-7 cells exposed to 100 µM DFX in the presence or absence of p66S36A or empty vector. We found that the administration of CA-IX siRNA yielded to an increase in cell death and halted the prosurvival effects of p66S36A transfection (Fig. 2B, right panel). On the whole, these data suggest that p66Shc promotes hypoxia survival by inducing CA-IX gene expression. Such an activity is inhibited by the phosphorylation at the residue 36 serine of the p66Shc protein.


Figure 2
View larger version (15K):
[in this window]
[in a new window]

 
Figure 2. CA-IX upregulation mediates p66Shc hypoxia survival. (A): Reverse transcription-polymerase chain reaction (RT-PCR) analysis of p66Shc and CA-IX mRNA level in MCF-7 cells and in MCF-7S in the presence or absence of 100 µM DFX (24 hours), and in clone 1 pre-exposed to 1 µg of SHC/SCR siRNA for 72 hours. (B): MCF-7 cells exposed to 100 µM DFX (24 hours) transfected with 800 ng of a pcDNA3.1 plasmid, empty or encoding WT (p66WT) or serine-to-alanine mutated residue 36 (p66S36A) p66Shc protein: cell death analysis at 24 hours in p66S36A-/empty vector-transfected cells, 1 µg pre-exposed to SCR- or CA-IX-specific siRNA for 72 hours (n = 3; *, p = .03), RT-PCR analysis of CA-IX mRNA, and Western blot analysis of SHC isoforms (left panel); cell death analysis at 24 hours in p66S36A-/empty vector-transfected cells, pre-exposed to 1 µg of SCR- or CA-IX-specific siRNA for 72 hours (n = 3; #, p = .040; ##, p = .010), RT-PCR analysis of CA-IX mRNA level. An expression vector encoding green fluorescent protein (pCMS-GFP, 300 ng) was cotransfected to assess for transfection efficiency. β2µ mRNA was assessed as quantitative control for RT-PCR analysis. Data are reported as mean ± SD. Abbreviations: β2µ, β2-microglobulin; CA-IX, carbonic anhydrase IX; DFX, desferoxamine; SCR, scramble control; SHC, p66Shc-specific; siRNA, short interfering RNA; WT, wild-type.

 
p66Shc Upregulates the Stem Cell Regulatory Notch-3 and Jagged-1 Genes
Since the scope of the investigation was to identify a common regulatory mechanism for hypoxia response and stem cell survival, we tested whether p66Shc may modulate the expression of genes that are involved in stem cell renewal. Purposely, we assessed a variety of stem cell regulatory genes in MCF-7 cells transfected with p66WT- or p66S36A-encoding vectors in the presence or absence of 100 µM DFX. We found that both plasmids upregulated the mRNA of Notch-3 and Jagged-1 in the absence of 100 µM DFX (Fig. 3A). The p66S36A transfection was able to upregulate Notch-3 and Jagged-1 mRNA in the presence of 100 µM DFX better than p66WT transfection (Fig. 3A). No upregulation was observed, as far as other stem cell regulatory genes (Notch-1, Notch-2, Notch-4, Musashi-1, Oct-4, Bmi-1, and Bcrp-I) were examined (Fig. 3A). In keeping with these data, we found that the SHC siRNA administration to MCF-7 cells exposed to 100 µM DFX, or to MCF-7S cells exposed to 100 µM DFX, elicited a reduction in Notch-3 and Jagged-1 mRNA expression level (Fig. 3B). These data suggest that p66Shc upregulates Notch-3/Jagged-1 genes and that the absence of serine 36 phosphorylation facilitates such an activity in the presence of hypoxia.


Figure 3
View larger version (25K):
[in this window]
[in a new window]

 
Figure 3. p66Shc upregulates Notch-3 and Jagged-1 mRNA level. (A): Reverse transcription-polymerase chain reaction (RT-PCR) analysis of Jagged-1, Notch-3, Notch-1, Musashi-1, Oct-4, Bmi-1, and Bcrp-I mRNA level in MCF-7 cells transfected with 800 ng of empty, p66WT, or p66S36A vectors in the presence or absence of 100 µM DFX for 24 hours, and Western blot analysis of SHC isoforms. (B): RT-PCR analysis of Notch-3 and Jagged-1 mRNA level in MCF-7S in the presence or absence of 100 µM DFX (24 hours) and pre-exposed to 1 µg of SCR/SHC siRNA for 72 hours. (p66Shc and β2µ mRNA levels are reported in Fig. 2A.) pCMS-GFP (300 ng) was used to assess transfection efficiency. β2µ mRNA was assessed as quantitative control for RT-PCR analysis. Abbreviations: β2µ, β2-microglobulin; DFX, desferoxamine; SCR, scramble control; SHC, p66Shc-specific; siRNA, short interfering RNA; WT, wild-type.

 
Notch-3 Triggers an ERK-Dependent Upregulation of Jagged-1 Gene Expression
In regard to the Notch3/Jagged-1 upregulation by p66Shc, we found that both genes were downregulated when MCF-7 cells were treated with a phosphatidylinositol 3-kinase inhibitor (Ly294002; Fig. 3C). At variance with these findings, the MEK1 kinase inhibitor UO126 was capable of downregulating the Jagged-1 but not the Notch-3 mRNA level (Fig. 3C). Because Notch-3 has previously been shown to be capable of eliciting ERK phosphorylation [25], we reasoned that p66Shc-induced upregulation of Jagged-1 mRNA may be mediated by the upregulation of Notch-3. Accordingly, we found that the transfection of a pCDNA3.1 vector encoding an active Notch-3 protein (pNICD-3) elicited a substantial increase in Jagged-1 mRNA, which in turn was blocked by the administration of UO126 (Fig. 3D). Moreover, the transfection of an N3 shRNA in MCF-7 cells exposed to 100 µM DFX elicited a downregulation of Jagged-1 mRNA, coupled with a reduction in the level of phosphorylated ERK protein, with respect to CTR shRNA (Fig. 4C). These data suggest that Notch-3 upregulates Jagged-1 mRNA in an ERK-dependent manner.


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Figure 4. The upregulation of Jagged-1 is mediated by Notch-3. (A): MCF-7 cells transfected with 800 ng of p66S36A for 24 hours, treated with 30 µM phosphatidylinositol 3-kinase inhibitor Ly294002 or 10 µM MEK1 inhibitor UO126 for 6 hours: reverse transcription-polymerase chain reaction (RT-PCR) analysis of Notch-3 and Jagged-1 mRNA level and Western blot (WB) analysis of SHC isoforms. (B): MCF-7 cells transfected with 500 ng of empty or Notch-3 active fragment (pNICD-3)-encoding pCDNA3.1 vector for 24 hours in the presence or absence of 10 µM UO126 for 6 hours: RT-PCR analysis of Jagged-1 mRNA level and WB analysis of Notch-3 protein level. (C): MCF-7 cells exposed to 100 µM DFX for 24 hours, transfected with 1 µg of N3 or CTR shRNA-encoding plasmid for 48 hours: WB analysis of Notch-3, pERK, and total ERK protein and RT-PCR analysis of Jagged-1 mRNA level. β-Actin and β2µ mRNA were assessed as quantitative CTRs for WB and RT-PCR analysis, respectively. Abbreviations: β2µ, β2-microglobulin; CTR, control; DFX, desferoxamine; ERK, extracellular signal-regulated kinase; N3, Notch-3-specific; pERK, phosphorylated extracellular signal-regulated kinase; shRNA, short hairpin RNA.

 
Notch-3 Elicits an ERK-Dependent Upregulation of the CA-IX Gene in the Presence of Hypoxia
According to our working hypothesis that the stem cell regulatory pathway is linked to hypoxia response, we then sought to investigate whether Notch-3 induces the upregulation of the CA-IX gene. Purposely, we treated MCF-7 cells with N3 shRNA in the presence of 100 µM DFX. We found that N3 shRNA elicited a substantial amount of cell death, accompanied by a down regulation of CA-IX mRNA and protein with respect to CTR shRNA (Fig. 5A). Similarly, a monoclonal antibody that blocks the Notch-3 receptor ligand-interaction ({alpha}-Notch-3) induced a significant reduction in the CA-IX promoter-driven luciferase reporter activity (CA-IX Luc) in the presence of 100 µM DFX (Fig. 5B). Furthermore, in the presence of 100 µM DFX, the transfection of pNICD-3 elicited an increase in CA-IX Luc activity, a phenomenon that was halted by UO126 administration (Fig. 5B). In accordance with our expectations, a stable retroviral infection of N3 shRNA of MCF-7 cells gave rise to a cell population that was more susceptible to DFX-induced cell death and was characterized by a lowered capacity to induce CA-IX mRNA with respect to CTR shRNA-infected cells (Fig. 5C). These data indicate that the Notch-3 gene upregulates CA-IX gene expression in the presence of hypoxia.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

 
Figure 5. Notch-3 mediates the upregulation of the CA-IX gene. (A): MCF-7 cells exposed to DFX or <0.1% O2 for 24 hours: cell death analysis (n = 3; *, p = .013; #, p = .002; left panel); reverse transcription-polymerase chain reaction (RT-PCR) analysis of CA-IX, Notch-3, p66Shc, and VEGF mRNA and Western blot (WB) analysis of Notch-3, CA-IX, and HIF-1{alpha} protein level (right panel). (B): CA-IX Luc (500 ng) in MCF-7 cells exposed to 100 µM DFX (24 hours) in the presence or absence of 1.5 µg/ml monoclonal antibody that blocks the Notch-3 receptor-ligand interaction ({alpha}-Notch-3) for 24 hours or transfected with 500 ng of pNICD-3 or empty pCDNA3.1 vector for 24 hours in the presence or absence of 10 µM UO126 for 6 hours. Data are presented as fold increase over control TK (20 ng) Renilla luciferase activity (n = 3; *, p = .011; #, p = .001). (C): MCF-7 cells stably infected with an N3 or CTR shRNA-carrying retroviral vector: cell death analysis (*, p = .020) and RT-PCR analysis of CA-IX and Notch-3 mRNA level. β-Actin and β2µ mRNA were assessed as quantitative controls for WB and RT-PCR analysis, respectively. Abbreviations: β2µ, β2-microglobulin; CA-IX, carbonic anhydrase IX; CA-IX Luc, carbonic anhydrase promoter-driven luciferase activity; CTR, control; DFX, desferoxamine; N3, Notch-3-specific; NS, not significant; shRNA, short hairpin RNA; TK, thymidine kinase; VEGF, vascular endothelial growth factor.

 
p66Shc/Notch-3/Jagged-1 Axis Promotes Self-Renewal in Normal and Tumor-Derived MS
Normal and cancer progenitors/stem cells of the mammary gland can be propagated in vitro as multicellular spheroids, called MS [17, 21]. Previous data indicate that Notch-3 is highly expressed in MS and that Notch signaling is crucial for MS self-renewal [17, 18]. We then tested the role of the above p66Shc-dependent pathway in MS obtained from normal (N) and tumor (T) mammary tissues of seven women affected by ductal breast carcinoma (Fig. 6A; supplemental online Table 1). First, we found that p66Shc was expressed in N- and T-MS and that the SHC siRNA administration downregulated Jagged-1 and Notch-3 mRNA (Fig. 6B; supplemental online Fig. 2, upper panel). Then, we observed that the administration of SHC siRNA markedly reduced the capacity of primary MS to generate secondary MS without causing an appreciable increase of cell death (Fig. 6C). A similar phenomenon was observed when MS were administered with {alpha}-Notch-3 (Fig. 6D). These data suggest that p66Shc/Notch-3/Jagged-1 pathway promotes self-renewal of MS.


Figure 6
View larger version (57K):
[in this window]
[in a new window]

 
Figure 6. p66Shc/Notch-3/Jagged-1 axis promotes self-renewal of mammary gland stem/progenitor cells. (A): Day 14 N- and T-MS, phase-contrast microscopy of samples 1, 2, and 3. (B): Day 14 N- and T-MS, exposed to 1 µg of SHC or SCR siRNA for 72 hours (sample 2), reverse transcription-polymerase chain reaction (RT-PCR) analysis of Jagged-1, Notch-3, CA-IX, p66Shc mRNA level. (C): Day 7 secondary N-MS (sample 4) generated in the presence of 1 µg of SHC or SCR siRNA for 72 hours: number of MS per well (n = 3; *, p = .04) and RT-PCR analysis of Jagged-1, Notch-3, and p66Shc mRNA level (left panel), trypan blue exclusion assay (vital staining) in primary day 14 MS and in 7 days secondary MS exposed to 1 µg of SHC or SCR siRNA for 72 hours (sample 7; right panel). (D): Day 7 secondary N-MS (sample 4) exposed to 1.5 µg/ml {alpha}-Notch-3 for 72 hours (number of MS per well, n = 3; *, p = .018) and representative phase-contrast picture (left panel), vital staining in primary day 14 MS and in 7-day secondary MS exposed to 1.5 µg/ml {alpha}-Notch-3 (sample 7, right panel). Abbreviations: β2µ, β2-microglobulin; CA-IX, carbonic anhydrase IX; MS, mammospheres; N, normal tissue-derived; NS, not significant; SCR, scramble control; SHC, p66Shc-specific; siRNA, short interfering RNA; T, tumor tissue-derived.

 
p66Shc/Notch-3/CA-IX Promotes Hypoxia Survival of MS
Because CA-IX mRNA was not detectable in N- and T-MS (Fig. 6B), to induce the expression of the gene, MS were exposed to 100 µM DFX. We found that such a treatment induced the expression of CA-IX mRNA and that it was downregulated by SHC siRNA administration (Fig. 7A; supplemental online Fig. 2, upper panel). Furthermore, SHC siRNA elicited an increase in the level of cell death and genomic DNA oxidation in day 14 N-MS (Fig. 7B; supplemental online Fig. 2, lower panel). Similarly, the administration of {alpha}-Notch-3 caused a substantial reduction of the number of vital MS and a consequent reduction in the capacity to generate secondary MS (Fig. 7C). Finally, the administration of CA-IX, but not SCR, siRNA caused a massive cell death of secondary MS in the presence of 100 µM DFX (Fig. 7D). We therefore concluded that the p66Shc/Notch-3/CA-IX axis promotes MS survival in hypoxic environment.


Figure 7
View larger version (31K):
[in this window]
[in a new window]

 
Figure 7. p66Shc/Notch-3/CA-IX axis promotes survival of mammary gland stem/progenitor cells in the presence of hypoxia. (A): Day 14 primary N- and T-MS, treated with 1 µg of SHC/SCR siRNA in the presence of 100 µM DFX for 72 hours (sample 3): reverse transcription-polymerase chain reaction (RT-PCR) analysis of Jagged-1, Notch-3, CA-IX, and p66Shc mRNA level. (B): Day 14 primary N-MS (sample 6) treated with 1 µg of SHC/SCR siRNA in the presence of 100 µM DFX for 72 hours: comet assay (*, p = .050) and vital staining (#, p = .013). (C): Day 14 primary MS (sample 7) in the presence of 100 µM DFX for 72 hours treated with 1.5 µg/ml {alpha}-Notch-3 (##, p = .016; upper panel) and day 7 secondary MS (sample 5) exposed to 1.5 µg/ml {alpha}-Notch-3 in the presence of 100 µM DFX for 72 hours: mean number of MS per well (n = 3 replicates; #, p = .008), RT-PCR analysis of CA-IX and p66Shc mRNA level, and phase-contrast microscopy. (D): Day 7 secondary N-/T-MS (sample 7) treated with 1 µg of CA-IX/SCR siRNA in the presence of 100 µM DFX for 72 hours: vital staining (n = 3; *, p = .018; #, p = .008), RT-PCR analysis of CA-IX mRNA level. Data are reported as mean ± SD. β2µ mRNA was assessed as quantitative control for RT-PCR analysis. Scale bars = 100 µm. Abbreviations: β2µ, β2-microglobulin; CA-IX, carbonic anhydrase IX; DFX, desferoxamine; MS, mammospheres; N, normal tissue-derived; SCR, scramble control; SHC, p66Shc-specific; siRNA, short interfering RNA; T, tumor tissue-derived.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
The data presented here indicate that a stress response gene (p66Shc) and a stem cell regulatory gene (Notch-3) share in an interplay that controls stem cell renewal and hypoxia response. These results are consistent with the tenet that stem cells are harbored in vivo in a low-oxygen environment [110], the niche, and with the consequent hypothesis that self-renewal potential of stem cells is strictly linked to the capacity of these cells to survey in a hypoxic environment. In particular, as far as the role of p66Shc/Notch-3 interplay in stem cell survival is concerned, we here show that Notch-3 upregulates its own ligand, Jagged-1, in an ERK-dependent manner. This finding is in agreement with the recent reports indicating that in addition to its established capability to induce RBP-J{kappa}-dependent transcription of HES-like genes, the activated Notch-3 promotes ERK phosphorylation [15, 25]. In this regard, we show that the administration of an antibody that halts the ligand/receptor Jagged-1/Notch-3 interaction reduces the self-renewal of MS. Consequently, we suggest that these data indicate that the p66Shc/Notch-3/Jagged-1 axis may be crucial for stem/progenitor cell self-renewal and survival and that Notch-3 activity acts throughout a canonical ligand-receptor interaction and activation in the absence of hypoxia [15]. However, in the presence of hypoxic stress, we show that such a pathway is flanked by a p66Shc/Notch-3-dependent hypoxia survival response, which relies on the upregulation of CA-IX gene expression. Interestingly, similarly to what was observed for Jagged-1, the Notch-3-dependent upregulation of CA-IX gene expression is mediated by ERK activation. This finding is in line with a recent report indicating that CA-IX expression is modulated by an ERK1/2-dependent pathway, which functions in a manner parallel to, but independent from, the HIF-1{alpha}-dependent upregulation of CA-IX gene [26]. Intriguingly, a protein-protein interaction between Notch and HIF-1{alpha} proteins has recently been shown to be capable of modulating gene transcription in stem/progenitor cells [9]. In this regard, although we could not demonstrate such a protein-protein complex in the present investigation (data not shown), the available data, together with the results presented here, support the notion that Notch and hypoxia regulation are intimately connected at multiple levels (i.e., HIF-1{alpha} regulation [9] and ERK activation [this investigation]). On the basis of the data reported above, we speculate that these results are consistent with the hypothesis that stem cells are endowed with a genetic program aimed at promoting self-renewal and survival in a hypoxic environment. In turn, low oxygen tension is expected to set the stem cell niche makeup in vivo [10, 12]. Moreover, according to the stem cell hypothesis of cancer, it may be conceived that the dysregulation of such an integrated capacity to survive in a hypoxic environment and to self-renew may confer a growth advantage on cancer (stem) cells. In this regard, there are reports indicating that upregulation of Notch-3, Jagged-1, and CA-IX genes in breast cancer tissues are associated with a poor prognosis [27, 28]. Our results suggest that these genes may be part of a common pathway aimed at promoting survival of cancer (stem) cells. As for p66Shc expression in breast cancer, it has previously been shown that the gene is highly expressed in breast cancer cells with metastatic potential but not in less aggressive ones [29]. In fact, p66Shc has been characterized, so far, for its capacity to induce cell death in the presence of oxidative stress by means of the serine 36 residue phosphorylation [14] (supplemental online Fig. 1). In this investigation, we found that an S36A p66Shc mutant protein is a better inducer of Notch-3 and CA-IX gene expression than wild-type p66Shc protein in the presence of hypoxia. Because the phosphorylation at the serine 36 residue depends upon oxidative stress, our data also suggest that oxidative stress may inhibit the capacity of p66Shc to upregulate stem cell/hypoxia survival. Intriguingly, it has been reported that Rac-1, a potent activator of p66Shc-dependent oxidative stress [30], is crucial for maintaining epidermal tissue stem cell survival and self-renewal [31]. Hence, similarly to (or in cooperation with) Rac-1, p66Shc may operate as a double-edged sword: on one hand, playing a prosurvival role in a low-oxygen environment (such as the niche), and on the other, inducing cell death in a pro-oxidant environment. Intriguingly, p66Shc–/– mice experience an advantage for survival late in life when tissue oxidative stress level is increased [14]. This scenario fits in with the theory of antagonistic pleiotropy [32], which predicts that genes playing detrimental roles late in life are an unforeseen by-product of evolution, due to the selective pressure on such genes to play a vital role in basic functions. In this regard, stem cell survival may be the vital function for which p66shc has been evolutionary selected. In conclusion, our results provide evidence that p66Shc (a major modulator of mammalian aging [14]), Jagged-1/Notch-3 (two members of an evolutionary-conserved stem cell regulatory pathway [15]), and CA-IX (a hypoxia-survival gene [16]) share in a molecular machinery that coordinates stem cell self-renewal and survival in hypoxic conditions. This notion is expected to contribute to the better comprehension of the role of aging in the intricate relationship between cancer and stem cells.


    DISCLOSURES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


    ACKNOWLEDGMENTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 
This work was supported by University of Bologna (ex 60% RFO funds), Cornelia Pallotti and Roberto Pallotti Fundation (to M.B.) and by the FIRB Project (to P.C.). We also thank the Fondazione Cassa di Risparmio in Bologna for supporting the Center for Applied Biomedical Research.


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 Acknowledgments
 References
 

  1. Polyak K, Hahn WC. Roots and stems: Stem cells in cancer. Nat Med 2006;12:296–300.[CrossRef][Medline]

  2. Wicha MS, Liu S, Dontu G. Cancer stem cells: An old idea—A paradigm shift. Cancer Res 2006;66:1883–1890.[Abstract/Free Full Text]

  3. Cejudo-Martin P, Johnson RS. A new Notch in the HIF belt: How hypoxia impacts differentiation. Dev Cell 2005;9:575–576.[CrossRef][Medline]

  4. Covello KL, Kehler J, Yu H et al. HIF-2alpha regulates Oct-4: Effects of hypoxia on stem cell function, embryonic development, and tumor growth. Genes Dev 2006;20:557–570.[Abstract/Free Full Text]

  5. Ramirez-Bergeron DL, Simon MC. Hypoxia-inducible factor and the development of stem cells of the cardiovascular system. STEM CELLS 2001;19:279–286.[Abstract/Free Full Text]

  6. Axelson H, Fredlund E, Ovenberger M et al. Hypoxia-induced dedifferentiation of tumor cells—A mechanism behind heterogeneity and aggressiveness of solid tumors. Semin Cell Dev Biol 2005;16:554–563.[CrossRef][Medline]

  7. Danet GH, Pan Y, Luongo JL et al. Expansion of human SCID-repopulating cells under hypoxic conditions. J Clin Invest 2003;112:126–135.[CrossRef][Medline]

  8. Cipolleschi MG, Dello Sbarba P, Olivotto M. The role of hypoxia in the maintenance of hematopoietic stem cells. Blood 1993;82:2031–2037.[Abstract/Free Full Text]

  9. Gustafsson MV, Zheng X, Pereira T et al. Hypoxia requires Notch signaling to maintain the undifferentiated cell state. Dev Cell 2005;9:617–628.[CrossRef][Medline]

  10. Suda T, Arai F, Hirao A. Hematopoietic stem cells and their niche. Trends Immunol 2005;26:426–433.[CrossRef][Medline]

  11. Unwin RD, Smith DL, Blinco D et al. Quantitative proteomics reveals post-translational control as a regulatory factor in primary hematopoietic stem cells. Blood 2006;107:4687–4694.[Abstract/Free Full Text]

  12. Nilsson SK, Johnston HM, Coverdale JA. Spatial localization of transplanted hemopoietic stem cells: Inferences for the localization of stem cell niches. Blood 2001;97:2293–2299.[Abstract/Free Full Text]

  13. Krishnamurthy P, Ross DD, Nakanishi T et al. The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme. J Biol Chem 2004;279:24218–24225.[Abstract/Free Full Text]

  14. Migliaccio E, Giorgio M, Mele S et al. The p66Shc adaptor protein controls oxidative stress response and life span in mammals. Nature 1999;402:309–313.[CrossRef][Medline]

  15. Bray SJ. Notch signalling: A simple pathway becomes complex. Nat Rev Mol Cell Biol 2006;7:678–689.[CrossRef][Medline]

  16. Robertson N, Potter C, Harris AL. Role of carbonic anhydrase IX in human tumor cell growth, survival, and invasion. Cancer Res 2004;64:6160–6165.[Abstract/Free Full Text]

  17. Dontu G, Abdallah WM, Foley JM et al. In vitro propagation and transcriptional profiling of human mammar stem/progenitor cells. Genes Dev 2003;17:1253–1270.[Abstract/Free Full Text]

  18. Dontu G, Jackson KW, McNicholas E et al. Role of Notch signaling in cell-fate determination of human mammary stem/progenitor cells. Breast Cancer Res 2004;6:R605–R615.[CrossRef][Medline]

  19. Harris AL. Hypoxia—A key regulatory factor in tumour growth. Nat Rev Cancer 2002;2:38–47.[CrossRef][Medline]

  20. Liu S, Dontu G, Mantle ID et al. Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human mammary stem cells. Cancer Res 2006;66:6063–6071.[Abstract/Free Full Text]

  21. Ponti D, Costa A, Zaffaroni N et al. Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res 2005;65:5506–55011.[Abstract/Free Full Text]

  22. Kisielow M, Kleinerm S, Nagasawa M et al. Isoform-specific knockdown and expression of adaptor protein ShcA using small interfering RNA. Biochem J 2002;363:1–5.[CrossRef][Medline]

  23. Martinez-Alfaro M, Palma-Tirado L, Sandoval-Zapata F et al. Correlation between formamidopyrimidine DNA glycosylase (Fpg)-sensitive sites determined by a comet assay, increased MDA, and decreased glutathione during long exposure to thinner inhalation. Toxicol Lett 2006;163:198–205.[CrossRef][Medline]

  24. Chrastina A, Pastorekova S, Pastorek J. Immunotargeting of human cervical carcinoma xenograft expressing CA IX tumor-associated antigen by 125I-labeled M75 monoclonal antibody. Neoplasma 2003;50:13–21.[Medline]

  25. Talora C, Cialfi S, Oliviero C et al. Cross talk among Notch3, pre-TCR, and Tal1 in T-cell development and leukemogenesis. Blood 2006;107:3313–3320.[Abstract/Free Full Text]

  26. Kaluz S, Kaluzova M, Stanbridge EJ. The role of extracellular signal-regulated protein kinase in transcriptional regulation of the hypoxia marker carbonic anhydrase IX. J Cell Biochem 2006;97:207–216.[CrossRef][Medline]

  27. Reedijk M, Odorcic S, Chang L et al. High-level coexpression of JAG1 and NOTCH1 is observed in human breast cancer and is associated with poor overall survival. Cancer Res 2005;65:8530–8537.[Abstract/Free Full Text]

  28. Chia SK, Wykoff CC, Watson PH et al. Prognostic significance of a novel hypoxia-regulated marker, carbonic anhydrase IX, in invasive breast carcinoma. J Clin Oncol 2001;19:3660–3668.[Abstract/Free Full Text]

  29. Jackson JG, Yoneda T, Clark GM et al. Elevated levels of p66 Shc are found in breast cancer cell lines and primary tumors with high metastatic potential. Clin Cancer Res 2000;6:1135–1139.[Abstract/Free Full Text]

  30. Khanday FA, Yamamori T, Mattagajasingh I et al. Rac1 leads to phosphorylation-dependent increase in stability of the p66Shc adaptor protein: Role in Rac1-induced oxidative stress. Mol Biol Cell 2006;17:122–129.[Abstract/Free Full Text]

  31. Benitah SA, Fryem M, Glogauer M et al. Stem cell depletion through epidermal deletion of Rac1. Science 2005;309:933–935.[Abstract/Free Full Text]

  32. Williams GC. Pleiotropy, natural selection, and the evolution of senescence. Evolution 1957;11:398–411.[CrossRef]




This article has been cited by other articles:


Home page
Genes Dev.Home page
L. M. McCaffrey and I. G. Macara
The Par3/aPKC interaction is essential for end bud remodeling and progenitor differentiation during mammary gland morphogenesis
Genes & Dev., June 15, 2009; 23(12): 1450 - 1460.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Guo, Z. Gertsberg, N. Ozgen, and S. F. Steinberg
p66Shc Links {alpha}1-Adrenergic Receptors to a Reactive Oxygen Species-Dependent AKT-FOXO3A Phosphorylation Pathway in Cardiomyocytes
Circ. Res., March 13, 2009; 104(5): 660 - 669.
[Abstract] [Full Text] [PDF]


Home page
Am Soc Clin Oncol Ed BookHome page
L. Miele, N. Takebe, and S. P. Ivy
The Cancer Stem Cell Hypothesis, Embryonic Signaling Pathways, and Therapeutics: Targeting an Elusive Concept
ASCO Educational Book, January 1, 2009; 2009(1): 145 - 156.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Xiao, Y. Ye, K. Yearsley, S. Jones, and S. H. Barsky
The Lymphovascular Embolus of Inflammatory Breast Cancer Expresses a Stem Cell-Like Phenotype
Am. J. Pathol., August 1, 2008; 173(2): 561 - 574.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2006-0442v1
25/3/807    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sansone, P.
Right arrow Articles by Bonafé, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sansone, P.
Right arrow Articles by Bonafé, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS