|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
STEM CELL GENETICS AND GENOMICS |
aDepartment of Cell and Developmental Biology, Max Planck Institute for Molecular Biomedicine, Münster, Germany;
bDepartment of Bioscience and Biotechnology, Bio-Organ Research Center, Konkuk University, Gwangjin-Gu, Seoul, South Korea
Key Words. Differentiation • F9 EC cells • Fusion • Oct4 • Xist • Reprogramming
Correspondence: Hans R. Schöler, Ph.D., Department of Cell and Developmental Biology, Max Planck Institute for Molecular Biomedicine, Röntgenstrasse 20 48149 Münster, Germany. Telephone: 49-251-70365-300; Fax: 49-251-70365-399; e-mail: schoeler{at}mpi-muenster.mpg.de
Received on October 30, 2006;
accepted for publication on January 2, 2007.
First published online in STEM CELLS EXPRESS January 11, 2007.
| ABSTRACT |
|---|
|
|
|---|
Disclosure of potential conflicts of interest is found at the end of this article.
| INTRODUCTION |
|---|
|
|
|---|
Pluripotent cells are able to differentiate into all three germ layers and germ cells upon differentiation. ES-somatic hybrid cells also differentiate into derivatives of the three germ layers [3] and contribute to chimeras [8]. As the hybrid cells undergo differentiation, regulatory programs of gene expression change along with alterations of DNA methylation. In our current study, we ask whether somatic cells keep some memory of their origin or whether it is lost after reprogramming, because reprogramming itself does not necessarily mean that the somatic cells completely lose their memory. Specifically, we examined the change of gene expression and DNA methylation of fusion hybrid cells during redifferentiation. We fused female mouse-derived neurosphere cells (NSCs) and F9 EC cells. NSCs, which have been isolated from fetal brain tissue, have the potential to differentiate into the neural lineage including neurons, oligodendrocytes, and astrocytes. We used F9 EC cells as a pluripotent fusion partner instead of ES cells because, albeit in principle pluripotent [9–12], after exposure to retinoic acid (RA), F9 EC cells have a more restricted differentiation potential than ES cells. In the presence of RA, they preferentially differentiate into primitive or parietal endoderm but not to the neural lineage [13, 14]. Therefore, we considered F9-NSC hybrid cells a suitable model to investigate whether neural cells keep some memory after fusion with F9 EC cells or whether the pluripotent F9 EC cells solely dictate the NSCs' differentiation potential. We found that F9 EC cells not only can reprogram NSCs but that the epigenetic memory of the NSCs indeed has been lost, as determined by the differentiation potential and the change in gene expression and methylation status of the F9-NSC hybrid cells during redifferentiation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
NSC Culture
To derive NSCs, brain tissue was collected from 12.5- to 16.5-days postcoitum (dpc) fetuses, which were ROSA26/OG2 heterozygous double transgenic. The ovaries (female) and testes (male) can be distinguished by their morphology from 12.5 dpc. Female NSCs were obtained from the female fetuses that have ovaries. Neurospheres cultured from brain tissue were prepared as described in detail in our previous article [2]. In brief, the cortex was dissected, enzymatically dissociated, and passed through a 70-µm nylon mesh (Falcon; Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). The NSCs were further purified by centrifugation in 0.9 M sucrose in 0.5x Earle's balanced salt solution (EBSS) at 750g for 10 minutes and in 4% bovine serum albumin (BSA) in EBSS solution at 200g for 7 minutes. The standard NSC culture medium was supplemented with 20 ng/ml epidermal growth factor (Gibco BRL), 20 ng/ml basic fibroblast growth factor, B27 supplement (Gibco BRL), 8 mM HEPES, 2 mM glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin in DMEM-F12 medium (Gibco BRL). Primary neurospheres were cultured for 6–7 days at 37°C under 5% CO2 in air and then used for fusion experiments. Animal experiments were approved and performed according to the Animal Protection Guidelines of the Government of Max Planck Society, Münster, Germany.
Cell Fusion and Subsequent Culture
F9 EC cells were mixed with NSCs in a ratio of 1:1 and washed in PBS. The mixture was centrifuged in 50-ml conical tubes at 130g for 5 minutes. After removal of the supernatant, 1 ml of a prewarmed 50% polyethylene glycol (PEG1500; Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) was added to the cell pellet drop by drop. DMEM was added up to 25 ml over the 5 minutes, with constant stirring. The cells were centrifuged at 130g for 10 minutes, washed gently with DMEM, and seeded onto gelatin-coated dish in ES culture medium containing leukemia inhibitory factor (LIF).
Karyotype Analysis
Cells cultured in a 10-cm culture dish were treated with 3 µg/ml Nocodazole for 4 hours, followed by trypsinization using 0.25% trypsin/EDTA. The cells were recovered and treated with hypotonic (0.56% [w/v]) KCl solution for 15 minutes. The cells were collected by centrifugation and fixed with fresh fixative (methanol/acetic acid, 3:1). The cells were washed three times in fixative and dropped onto clean glass slides. The slides were air-dried, stained with 4,6-diamidino-2-phenylindole (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com), and observed under a fluorescence microscope.
X-Gal Staining
Whole fetal embryos were washed with PBS and fixed for 1 hour at 4°C in 4% formaldehyde. They were then washed three times with PBS and LacZ rinse buffer supplemented with 5 mM EGTA, 0.01% deoxycholate, 0.02% Nonidet P40, and 2 mM MgCl2. The fetuses were incubated overnight at 37°C in 5-bromo-4-chloro-3-indolyl-galactosidase (X-gal) staining buffer supplemented with 1 mg/ml X-gal (Sigma-Aldrich), 5 mM K2Fe(CN)6, 5 mM K4Fe(CN)6, and 1 mM MgCl2. Blue staining is visible under a light microscopy.
Flow Cytometry
Dissociated hybrid cells were washed with PBS, filtered through a 40-µm nylon mesh, and resuspended in standard EC cell medium. Highly intense green fluorescent protein (GFP)-positive cells were sorted directly into lysis buffer RLT (Qiagen GmbH, Hilden, Germany, http://www.qiagen.com) using a FACSAria cell sorter (Becton, Dickinson and Company) with FACSDiva software (Becton, Dickinson and Company).
In Vitro Differentiation of F9-NSC Hybrid Cells
Differentiation of F9-NSC hybrid cells was induced by treatment with RA. The GFP-positive hybrid cells recovered by trypsinization were replated onto bacteriological dishes in DMEM (15% FCS) in the absence of LIF for 4 days. After the formation of EBs, they were treated with 5 µM RA for 4 days in bacteriological dishes and seeded onto gelatin-coated culture dishes for 5 days. GFP-negative cells were sorted by fluorescence-activated cell sorting (FACS) directly into buffer RLT (Qiagen GmbH) and analyzed for real-time reverse transcription-polymerase chain reaction (RT-PCR) and bisulfite DNA sequencing.
Blastocyst Injection
Blastocysts were obtained from B6C3F1 x B6C3F1 nontransgenic mice (Harlan Winkelmann GmbH, Borchen, Germany, http://www.harlan.com/). F9-NSC hybrid cells were recovered by trypsinization, washing with PBS, and placed in a drop of PBS (0.4% BSA) under mineral oil. The B6C3F1 blastocysts were placed in an adjacent drop of PBS (0.4% BSA). GFP-positive cells (10 to 15 cells) were picked up with the injection pipette and injected into a blastocyst. Ten to 15 injected blastocysts were transferred into the uterus of each pseudopregnant ICR mouse.
RNA Extraction, cDNA Synthesis, and Real-Time RT-PCR
For real-time quantification of the gene expression, GFP-positive cells were sorted by FACS directly into buffer RLT (Qiagen GmbH), and the RNA was extracted on RNeasy microcolumns (Qiagen GmbH), according to the manufacturer's instructions. The quality and concentration of the total RNA were determined with the Bioanalyzer RNA 6000 (Agilent Technologies, Palo Alto, CA, http://www.agilent.com), using a nano or pico chip according to the number of sorted cells. Complementary DNA synthesis was performed with the High Capacity cDNA Archive Kit (Applied Biosystems GmbH, Darmstadt, Germany, http://www.appliedbiosystems.com/) following the manufacturer's instructions, scaling down the reaction volume to 20 µl. Transcript levels were determined using the ABI PRISM Sequence Detection System 7900HT (Applied Biosystems) and the ready-to-use 5' Nuclease Assays-on-Demand.
The raw quantification data of the transcripts were normalized on the endogenous Bact gene within the log-linear phase of the amplification curve (
Ct method, ABI PRISM 7700 Sequence Detection System User Bulletin 2; Applied Biosystems). The theoretical background of real-time polymerase chain reaction (PCR) is extensively described in our previous article [15]. The choice of the Bact gene as endogenous control was made based on the comparison of the total RNA amount used in the reaction and the un-normalized expression level of four ubiquitously expressed genes typically used as internal controls in quantitative PCR (Hprt, Bact, B2m, and Tbp) [16].
Oligos for the following genes were designed by the Taqman Assay-on-Demand service: Oct4 (Mm00658129_gH), Sox2 (Mm00488369_s1), Sox1 (Mm00486299_s1), Nestin (Mm00450205_m1), Glur6 (Mm00599860_m1), Olig2 (Mm01210556_m1), Xist (Mm01232884_m1), Hprt (Mm00446968_m1), Gata1 (Mm00484678_m1), Esx1 (Mm00468385_m1), Ard1 (Mm00502342_m1), Hdac6 (Mm00515945_m1), Figf (Mm00438965_m1), Gspt2 (Mm00492464_s1), Fshprh (Mm00521454_m1), Afp (Mm000431715_m1), Hnf4a (Mm00433964_m1), Tbx1 (00448948_m1), Otx2 (00446859_m1), Meox1 (00440285_m1), and Bact (Mm00607939_s1). Oligos for Nanog amplification were custom designed (primer forward: 5'AACCAGTGGTTGAATACTAGCAATG, primer reverse: 5'-CTGCAATGGATGCTGGGATACT, probe: 5'-6FAM-TTCAGAAGGGCTCAGCAC-MGB).
Three replicates were used for each real-time PCR; an RT– blank and a no-template blank served as negative controls, together with H2O eluted from the micro RNeasy column. The analysis using the Taqman software automatically sets a confidence level of 95%, indicating that differences among the values are always significant with a p < .05.
Bisulfite Sequencing Analysis
To investigate the methylation status of target genes, bisulfite sequencing PCR (BS-PCR) was adopted. Genomic DNA isolated by phenol-chloroform method was treated with sodium bisulfite to convert all unmethylated cytosines to uracil using the One Day MSP kit (In2Gen, Seoul, Korea, http://www.in2gen.com/English/) according to manufacturer's protocol. In brief, 1 µg of purified genomic DNA was denatured with 3 N sodium hydroxide at 37°C for 10 minutes, and modification was induced with sodium bisulfite (5 M) at 50°C for 16 hours in the dark. Modified DNA was then diluted with 20 µl of distilled water after desulfonation, neutralization, and desalting. Subsequently, BS-PCR amplification was carried out using 1-µl aliquots of modified DNA for each PCR. In the present study, the regulatory regions of the Oct4 (proximal enhancer [PE] and promoter) and the Xist region 1, known to control the expression of the Xist, were analyzed to monitor their methylation changes during the reprogramming and redifferentiation. All regions of the hybrid cells were investigated using a nested PCR approach after bisulfite treatment. PCR was performed with SuperTaq polymerase (Ambion, Austin, TX, http://www.ambion.com) in a 25-µl volume. All PCR amplification included a total of 40 cycles of denaturation at 94°C for 30 seconds, annealing at proper temperature for each target region for 30 seconds, and extension at 72°C for 30 seconds with a first denaturation at 94°C for 5 minutes and final extension at 72°C for 10 minutes. The primers and annealing temperatures used were as follows: Oct4 promoter (Pro) first sense 5'-GGGATTTTTAGATTGGGTTTAGAAAA-3', Oct4 Pro first antisense 5'-CCACCCTCTAACCTTAACCTCTAAC-3' (1,211 base pairs [bp], 45°C); Oct4 Pro second sense 5'-TGAGGAGTGGTTTTAGAAATAATTG-3', Oct4 Pro second antisense 5'-AATCCTCTCACCCCTACCTTAAAT-3' (190 bp, 55°C); Oct4 PE first sense 5'-GGTTTTTTGAGGTTGTGTGATTTAT-3', Oct4 PE first antisense 5'-CTCCCCTAAAAACAACTTCCTACTC-3' (423 bp, 45°C); Oct4 PE second sense 5'-GGGATTTTTAGATTGGGTTTAGAAAA-3', Oct4 PE second antisense 5'-CTCCTCAAAAACAAAACCTCAAATA-3' (200 bp, 55°C); Xist first sense 5'-GTTAATTAATGTAGAAGAATTTTTAGTGTTTA-3', Xist first antisense 5'-AAATATTCCCCCAAAACTCCTTAAATAA-3' (458 bp, 50°C); and Xist second sense 5'-TGTAATTTTTGTGGTTATTTTTTTT-3', Xist second antisense 5'-ATATTCCCCCAAAACTCCTTAAATA-3' (159 bp, 55°C). Each 3 µl of the first PCR products were used as the template for the second PCR. The second PCR products were subcloned using PCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) according to the manufacturer's protocol. The reconstructed plasmids were purified with QIAprep Spin Miniprep kit (Qiagen GmbH), and then individual clones were sequenced (GATC Biotech, Konstanz, Germany, http://www.gatc-biotech.com/en/). Clones were only accepted with
A90% cytosine conversion, and all possible clonalities were excluded based on criteria from the BiQ Analyzer software (Max Planck Society). At least 10 replicates were performed for each of the selected regions in fusion hybrids, and more than three separate bisulfite treatments were carried out for the samples shown to verify the results.
| RESULTS |
|---|
|
|
|---|
|
|
|
) and mesodermal (Tbx1 and Meox1) gene expression with that of the neural marker Otx2. The visceral endoderm marker Afp, which was not expressed in NSCs, F9 EC cells, and hybrid cells, was drastically upregulated after redifferentiation (Fig. 3D). Hnf4
, which was not expressed in NSCs, was upregulated to the same level as in F9 EC cells after fusion and was further upregulated upon differentiation. The mesoderm markers Tbx1 and Meox1 were not expressed in NSCs but upregulated to a lower (Tbx1) or a higher (Meox1) level than F9 level after fusion. When the hybrid cells were differentiated, these mesoderm-related genes were further upregulated. These data indicate that the F9-NSC hybrid cells lose the memory of their somatic genome and preferentially differentiate into endodermal and mesodermal lineages. This was confirmed by determining the in vivo differentiation potential after blastocyst injection; X-gal-positive cells contribute to inner parts of the body but not to brain tissue (Fig. 3E). In contrast, P19-NSC hybrid cells did differentiate along the neural lineage, and the neural markers were upregulated when the hybrid cells were differentiated (supplemental online Fig. S1). These results indicate that the differentiation potential of the hybrid cells depend on the differentiation potential of the pluripotent fusion partner and that the differentiation potential is not a specific feature of the NSCs.
Change of the Xist Gene During Reprogramming and Redifferentiation After Fusion
To study the reactivation of the inactive X chromosome, we measured the Xist RNA level. The Xist RNA is responsible for the inactivation of one of the X chromosome by coating this X chromosome. Xist RNA is transcribed only from the inactive X chromosome (Xi), not from the active X chromosome (Xa) [17, 18]. Therefore, the reactivation of the Xi can be measured by quantitative real-time RT-PCR, allowing quantification of the Xist transcripts. The Xist RNA that is responsible for the X chromosome inactivation was highly expressed only in female NSCs containing Xi and not in male NSCs, since they lack Xi (Fig. 3F). F9 EC cells (derived from a male mouse carcinoma), however, expressed 500 times less Xist RNA than female NSCs. In fusion hybrid cells, the Xist RNA level decreased and reached a level almost identical to that of F9 EC cells, and that was upregulated about 10-fold when the hybrid cells had lost their Oct4-GFP signal upon differentiation.
To test whether the change of Xist RNA levels affects the re-establishment of X-linked genes expression, we examined the RNA levels of eight X-linked genes, Hprt, Gata1, Esx1, Ard1, Hdac6, Figf, Gspt2, and Fshprh (Fig. 3F). For these X-linked genes, expression levels were equal or slightly lower than in F9 EC cells or completely absent (Gata1 and Esx1). Six genes, Hprt, Gata1, Ard1, Hdac6, Figf, and Gspt2, were found to be upregulated to the level of (or slightly lower than) F9 EC cells and then downregulated upon differentiation. Esx1, which was not expressed in NSCs, was upregulated after fusion with F9 EC cells, but the level was still 50-fold lower than that of F9 EC cells. Interestingly, this gene was further upregulated after the hybrid cells were differentiated (Oct4-GFP-negative). On the other hand, the level of Fshprh was not changed after fusion and redifferentiation, indicating that the expression of some genes is not affected by fusion-induced reprogramming.
Dynamics of DNA Methylation Status on the Oct4 PE and the Promoter Region After Fusion and Redifferentiation
The CpG sites of the Oct4 PE and the promoter region in NSCs were partially methylated (55.0 and 46.0%, respectively). In contrast, all CpG sites of the PE and the promoter region in F9 EC cells (which highly express Oct4) were completely unmethylated (0%) (Fig. 4A). Interestingly, the partial methylation patterns of the PE and the promoter region of female NSCs dramatically declined to 0% (Fig. 4A), indicating the complete demethylation of the Oct4 regulatory region in the somatic fusion partner. This result supports that pluripotency markers are expressed in both NSCs and F9 EC genomes, because methylation of the Oct4 regions is fully erased and any partial methylation clones could not be identified in the hybrid cells. After differentiation, however, the GFP-negative hybrid cells resume a hypermethylation status in the PE and the promoter regions (60.0 and 48.9%, respectively).
|
| DISCUSSION |
|---|
|
|
|---|
We have shown that the reprogramming of somatic nuclei by fusion with F9 EC cells is accompanied by the downregulation of tissue-specific markers and the activation of pluripotency genes, and redifferentiation of the hybrid cells is associated with the downregulation of pluripotency genes and activation of endoderm and mesoderm markers, whereas NSC-specific markers (Nestin, Glur6, and Olig2) and Sox1 were not upregulated after differentiation. The fusion hybrid cells preferentially differentiate to endodermal and mesodermal lineages, indicating that the NSCs lose the memory of their origin. It has been suggested that F9 EC cells have a lower rate of spontaneous differentiation and a more restricted differentiation potential in comparison with other EC cell lines after exposure to RA [13]. By profiling global patterns of gene expression during the differentiation of F9 EC cells using microarray technology, Harris and Childs showed that many of the genes were related to parietal endoderm yolk sac and placenta [14]. We also showed that Esx1, which is expressed in placenta, was upregulated upon differentiation of hybrid cells (Fig. 3F). Mesoderm markers were also induced during the differentiation of F9 EC cells, such as bone morphogenic protein (BMP), twist, and T-box gene (Tbx1) [14]. BMP was known as a regulatory protein that induces growth and differentiation of chondroblast and osteoblast lineage cells in vitro [23]. Twist genes are expressed in developing somites and regulate epithelial-mesenchymal transition [24, 25]. Tbx1 gene is a transcription factor that regulates early cardiac lineage development [26]. However, these genes are multifunctional, with a wide range of regulation in various cell types. Therefore, the mesoderm markers examined in the present study, Tbx1 and Meox1, could be expressed during the primitive or parietal endoderm commitment of F9 EC cells. In an earlier study, Liesi et al. suggested that long-term culture of F9 cells with RA and dibutyryl cyclic AMP could induce neural cells expressing neurofilament [27]. However, the F9-derived neuron-like cells have been found to display characteristics of parietal endoderm and do not show neural cell characteristics [28].
Taken together with previous data, our results suggest that F9-NSC fusion hybrid cells display a differentiation potential identical to that of their pluripotent fusion partners (F9 EC cells). To validate whether this observation is also true when NSCs are fused with other pluripotent cells, we generated other hybrid cells with P19 EC cells. Contrary to F9 EC cells, P19 EC cells can differentiate into neurons, glia, and fibroblast-like cells after RA treatment [29]. If the NSCs adopt the differentiation potential of P19 EC cells, their fusion hybrid cells should be able to differentiate along the neural lineage. Therefore, we compared the differentiation potential of F9-NSC and P19-NSC hybrid cells. Differentiation of P19-NSC hybrid cells was induced with the same protocol as that used for F9-NSC hybrid cells. The P19-NSC hybrids displayed an upregulation of the NSC markers after RA-induced differentiation (supplemental online Fig. S1). This result confirms the conclusion that hybrid cells lose the memory of the somatic origin and adopt an identical differentiation potential to that of their respective pluripotent fusion partner.
In mammals, one of the two X chromosomes of female somatic cells is transcriptionally inactive to achieve dosage compensation, since male cells only contain one X chromosome. The Xist RNA is responsible for the inactivation of the X chromosome by covering the X chromosome. Although the mechanism involved in Xist-mediated silencing is unknown, a series of epigenetic changes on the Xi by recruitment of silencing factors are likely to be involved, such as hypoacetylation of histones and DNA methylation [30]. The Xist expression seems to be controlled by methylation of the 5' region of the Xist gene [19, 20]; this region is hypermethylated on the Xa but hypomethylated on the Xi. In the present study, we have shown that F9 EC cells express about 500-fold less Xist RNA than female (XiXa) NSCs, suggesting a partially active state of the X chromosome in F9 EC cells. This result is consistent with previous reports showing that Xist RNA was detectable at a low level in female [18, 31, 32] and male ES cells [7]. By quantifying the Xist transcripts using real-time RT-PCR and bisulfite DNA sequencing, we demonstrated that hybrid cells displayed an identical state of X chromosome (Xã) to that of F9 EC cells—a lower level of Xist RNA and the partial methylation patterns (about 70%) of the Xist R1.
It has been suggested that Xist expression is upregulated from the inactivated X chromosome upon differentiation [18, 32]. Our data showed that the Xist RNA level was upregulated about 10-fold after the hybrid cells were induced to differentiate, although the level was still 50-fold lower than in female NSCs that contain Xi. However, the methylation status of the reactivated X chromosome (from Xi to Xã) did not return to the Xi state even after the hybrid cells were differentiated and the Oct4-GFP signal disappeared. This result indicates that the X chromosome expressing a 10-fold higher level of Xist RNA was still in the Xã-like state. It could be possible that only a high level of Xist expression (almost at the female NSC level) can represent the expression of the complete Xi. However, the Oct4 PE and the promoter regions resume the differentiated state of DNA methylation in parallel to downregulation of Oct4 expression (about 10-fold). This is probably because a critical level of Oct4 protein is crucial for the maintenance of pluripotency; only a twofold difference in Oct4 protein level leads to differentiation [33]. Thus, pluripotency might have already been lost when the Oct4 RNA level was downregulated about 10-fold (but was still at a higher level when compared with NSC levels). It is also possible that, at least in F9-NSC hybrid cells, demethylation of the Xist region (reinactivation of X chromosome) could hardly occur or need more time than that of Oct4.
It has been suggested that fusion-induced reprogramming entails the erasure of the somatic epigenome and leads to the loss of the differentiation-related gene expression. However, reprogramming itself does not necessarily mean that the somatic cells completely lose their memory, because the hybrid cells might be preferentially committed to the lineage of the somatic cells that had been fused with the pluripotent cells under differentiation-inducing conditions. In the present study, by showing the inability to restore the neural memory, even when the hybrid cells have differentiated, we demonstrated that the NSCs completely lose their memory and acquire a differentiation potential identical to that of their pluripotent fusion partner.
| DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. T. Do, D. W. Han, L. Gentile, I. Sobek-Klocke, M. Stehling, and H. R. Scholer Enhanced Reprogramming of Xist by Induced Upregulation of Tsix and Dnmt3a Stem Cells, November 1, 2008; 26(11): 2821 - 2831. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Cantz, G. Key, M. Bleidissel, L. Gentile, D. W. Han, A. Brenne, and H. R. Scholer Absence of OCT4 Expression in Somatic Tumor Cell Lines Stem Cells, March 1, 2008; 26(3): 692 - 697. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Han, J. T. Do, L. Gentile, M. Stehling, H. T. Lee, and H. R. Scholer Pluripotential Reprogramming of the Somatic Genome in Hybrid Cells Occurs with the First Cell Cycle Stem Cells, February 1, 2008; 26(2): 445 - 454. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| STEM CELLS | THE ONCOLOGIST | CME | ALPHAMED PRESS JOURNALS |