Stem Cells
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online January 11, 2007
Stem Cells Vol. 25 No. 4 April 2007, pp. 939 -949
doi:10.1634/stemcells.2006-0299; www.StemCells.com
© 2007 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2006-0299v1
25/4/939    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gossrau, G.
Right arrow Articles by Brüstle, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gossrau, G.
Right arrow Articles by Brüstle, O.

EMBRYONIC STEM CELLS

Bone Morphogenetic Protein-Mediated Modulation of Lineage Diversification During Neural Differentiation of Embryonic Stem Cells

Gudrun Gossraua,b, Janine Thieleb, Rachel Konanga, Tanja Schmandta, Oliver Brüstlea

aInstitute of Reconstructive Neurobiology, Life & Brain Center, University of Bonn and Hertie Foundation, Bonn, Germany;
bDepartment of Neurology, University of Dresden Medical Center, Dresden, Germany

Key Words. Embryonic stem cells • Neural crest • Bone morphogenetic protein • Peripheral neurons

Correspondence: Oliver Brüstle, M.D., Institute of Reconstructive Neurobiology, Life & Brain Center, University of Bonn and Hertie Foundation, Sigmund-Freud-Strasse 25, D-53105 Bonn, Germany. Telephone: 49-228-688-5500; Fax: 49-228-688-5501; e-mail: brustle{at}uni-bonn.de

Received on May 19, 2006; accepted for publication on December 27, 2006.

First published online in STEM CELLS EXPRESS  January 11, 2007.

   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Embryonic stem cells (ES cells) can give rise to a broad spectrum of neural cell types. The biomedical application of ES cells will require detailed knowledge on the role of individual factors modulating fate specification during in vitro differentiation. Bone morphogenetic proteins (BMPs) are known to exert a multitude of diverse differentiation effects during embryonic development. Here, we show that exposure to BMP2 at distinct stages of neural ES cell differentiation can be used to promote specific cell lineages. During early ES cell differentiation, BMP2-mediated inhibition of neuroectodermal differentiation is associated with an increase in mesoderm and smooth muscle differentiation. In fibroblast growth factor 2-expanded ES cell-derived neural precursors, BMP2 supports the generation of neural crest phenotypes, and, within the neuronal lineage, promotes distinct subtypes of peripheral neurons, including cholinergic and autonomic phenotypes. BMP2 also exerts a density-dependent promotion of astrocyte differentiation at the expense of oligodendrocyte formation. Experiments involving inhibition of the serine threonine kinase FRAP support the notion that these effects are mediated via the JAK/STAT pathway. The preservation of diverse developmental BMP2 effects in differentiating ES cell cultures provides interesting prospects for the enrichment of distinct neural phenotypes in vitro.

Disclosure of potential conflicts of interest is found at the end of this article.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
In vitro differentiation of embryonic stem (ES) cells into tissue-specific precursors provides a powerful tool for the study of lineage segregation and the generation of donor cells for transplantation. Upon aggregation, ES cells differentiate into EBs, which give rise to cell types of all three germ layers. Although to date the regulation of germ layer specification in ES cell cultures remains poorly understood, several studies indicate that the hierarchy of somatic lineage decisions observed during EB differentiation replicates many aspects of in vivo embryonic development [1–9]. The steadily increasing knowledge on the molecular mechanisms regulating mammalian neural development has been translated into various differentiation protocols that exploit developmental mechanisms for in vitro stem cell differentiation [10–14]. Cell populations highly enriched in mouse and human ES cell-derived neural precursors have been generated using extrinsic factors and selective growth conditions [11, 15–21], as well as genetic lineage selection paradigms [22–24].

We and others have developed growth factor-based protocols that permit the gradual differentiation of EBs into different neural precursor cell populations [15, 25]. In a first stage, EB-derived neural cells are expanded in fibroblast growth factor 2 (FGF2) to give rise to a population of early, pan-neural precursors that efficiently differentiate into neurons [15]. Subsequent propagation of these precursors in FGF2 and epidermal growth factor (EGF) followed by FGF2 and platelet-derived growth factor (PDGF) yields populations of late neural precursors that show a strong propensity for glial differentiation [25].

Bone morphogenetic proteins (BMPs) play a key role in normal development and in vitro stem cell differentiation [26, 27]. They promote cellular differentiation in non-neural tissues, including bone, bone marrow, kidney, and lung [28–31]. Furthermore, BMPs have been reported to sustain self-renewal and pluripotency of mouse ES cells [11]. During neural development, BMPs exert a large variety of region- and stage-specific effects [32, 33]. In the early embryo, high BMP levels promote the differentiation of ectoderm into epidermis while inhibiting neuroectoderm formation [34, 35]. Accordingly, BMP inhibitors from the Spemann's organizer are required for neuroectoderm formation [36–42]. Once the neural tube is established, BMPs induce dorsal precursor fates from which the neural crest evolves [36, 43–46]. Thus, BMPs represent key determinants of neural crest induction and development [47–52]. BMPs have also been reported to promote a neural crest phenotype in central nervous system (CNS) precursors isolated from the embryonic and adult brain and spinal cord [53–55]. Recent evidence indicates that FGF2 is required for BMP-mediated induction of neural crest-like phenotypes in cortical neural stem cells. Specifically, this phenotype shift appears to result from BMP-mediated activation of the canonical Wnt-signaling pathway under the permissive influence of FGF2 [56]. In the telencephalon, BMPs have also been shown to support neuronal and astrocytic differentiation in a stage-specific manner. BMP2, in particular, modulates the differentiation of subventricular zone progenitors, and specifically the generation of astrocytes [57–59].

In this study, we set out to explore whether and to what extent treatment of EBs, FGF2-treated early pan-neural precursors, and FGF2/EGF-expanded late neural precursors with BMP2 promotes the generation of peripheral neural cells and other phenotypes. Our data show that exposure of EBs to BMP2 inhibits neuronal differentiation and promotes the generation of non-neural ectoderm, as well as mesoderm and neural crest cell fates. In EB-derived early neural precursors, BMP2 induces distinct peripheral nervous system (PNS) fates and promotes astrocytic lineage differentiation. BMP2 treatment of FGF2/EGF-propagated late neural precursors revealed that this promotion of astrocyte differentiation occurs at the expense of oligodendrocyte development. The preservation of these developmental effects and their underlying mechanisms in different stages of neural ES cell differentiation provides interesting prospects for enhancing the derivation of biomedically relevant cell types in vitro.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
ES Cell Differentiation
In vitro differentiation of mouse ES cells (line J1 [60], line CJ7 [61]) was performed as described [15]. In brief, ES cells were expanded on {gamma}-irradiated mouse embryonic fibroblasts in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen, Karlsruhe, Germany, http://www.invitrogen.com) supplemented with 20% fetal bovine serum (Biochrom AG, Berlin, http://www.biochrom.de), 1x MEM-nonessential amino acids (Invitrogen), 8 mg/l adenosine, 8.5 mg/l guanosine, 7.3 mg/l cytidine, 7.3 mg/l uridine, 2.4 mg/l thymidine, 0.1 mM 2-mercaptoethanol, 26 mM N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES) (all from Sigma-Aldrich, Taufkirchen, Germany, http://www.sigmaaldrich.com), and 103 U/ml leukemia inhibitory factor (LIF) (Chemicon, Hofheim, Germany, http://www.chemicon.com). After passage on gelatin-coated dishes (0.1% gelatin; Sigma-Aldrich), ES cells were trypsinized and aggregated to EBs. EBs were grown for 4 days without LIF and subsequently plated onto tissue culture dishes. For selection of embryonic stem cell-derived neural precursors (ESNPs), the cells were further grown in DMEM/Ham's F-12 medium (F12; Invitrogen) supplemented with 5 µg/ml insulin (Sigma-Aldrich), 50 µg/ml human APO-transferrin (Chemicon), 30 nM sodium selenite (Sigma-Aldrich), 2.5 µg/ml fibronectin (Invitrogen), and penicillin/streptomycin (Invitrogen) (ITSFn). After 4 days, cells were trypsinized, triturated to a single cell suspension, and propagated for 4 days in polyornithine-coated dishes in a DMEM/F12-based medium supplemented with 10 ng/ml FGF2 (ESNPFGF2-PROL; R&D Systems, Wiesbaden, Germany, http://www.rndsystems.com). Differentiation was induced by growth factor withdrawal (ESNPFGF2-DIFF). In some experiments, plated EBs were propagated through ITS followed by a 4-day culture period in N3 medium, consisting of DMEM/F12 (Invitrogen) supplemented with 20 µM progesterone, 0.1 M putrescine, 30 nM sodium selenite (all from Sigma-Aldrich), 25 µg/ml insulin, and 50 µg/ml human APO-transferrin without growth factors (EBITS-DIFF). For the generation of glial precursors, cells were further propagated in FGF2 and EGF (20 ng/ml; R&D Systems; ESNPFGF2-EGF-PROL) [8]; differentiation was induced by growth factor withdrawal (ESNPFGF2-EGF-DIFF).

BMP and Rapamycin Treatment
Cells were exposed to BMP2 (R&D Systems) at different stages of in vitro differentiation (details are given in flow charts in Figs. 1GoGo–4). Initial dose-finding experiments revealed that exposure of EBs or ESNPFGF2-EGF to 10 ng/ml BMP2 impaired generation and viability of the neural precursors, respectively. Thus, experiments at these differentiation stages were performed with 5 ng/ml BMP2. EBs were subjected to RNA extraction either directly after a 3-day-exposure to BMP2 or after additional plating in ITS medium and subsequent differentiation (Fig. 1, ESNPITS-DIFF). In some experiments, BMP2-treated EBs were further propagated in growth factor-containing media as described above. For analysis of BMP2 effects on FGF2-propagated neural precursors, ESNPs proliferated for 4 days in FGF2 were cultured in the presence of FGF2 and 10 ng/ml BMP2 for another 4 days. BMP2 treatment of ESNPFGF2-EGF-PROL cultures was done for 2 days at a concentration of 5 ng/ml. Density-dependent induction of astrocytes and smooth muscle cells was studied at plating densities of 105 cells per cm2 and 103 cells per cm2. Rapamycin (Sigma-Aldrich) was applied at a concentration of 1 µM. For Western blot and immunofluorescence analysis of STAT and Smad phosphorylation, cells were withdrawn from FGF2 in the presence of BMP2.


Figure 1
View larger version (28K):
[in this window]
[in a new window]

  		Figure 1. Effects of BMP2 on early embryonic stem (ES) cell differentiation. (A): Schematic illustration of the ES cell differentiation protocols. ES cells were aggregated to EBs and subjected to a stepwise differentiation protocol involving ITS medium and sequential proliferation of ESNPs in FGF2 and FGF2/EGF. Differentiation was induced by 4-day growth factor withdrawal (DIFF). (B): Reverse transcription-polymerase chain reaction (RT-PCR) analysis of BMP receptor transcripts relevant for neural differentiation (+, positive control: E16 mouse embryo; –, no template control). (C): BMP2 treatment of EBs resulted in an induction of brachyury (mesoderm) and FGF5 (ectoderm) and a downregulation of the neuronal marker ßIII-tubulin in quantitative RT-PCR analysis. (D): Upon plating and differentiation in ITS medium (EBITS-DIFF in [A]), BMP2-treated EBs showed enhanced expression of neural crest markers. Abbreviations: AFP, {alpha}-fetoprotein; BMP, bone morphogenetic protein; BMPR, bone morphogenetic protein receptor; DIFF, differentiated; EGF, epidermal growth factor; ESNP, embryonic stem cell-derived neural precursor; FGF, fibroblast growth factor; PROL, proliferated; SMA, smooth muscle actin.

 
5-Bromo-2'-deoxyuridine Incorporation Assay
Concomitantly with the onset of BMP2 exposure, ESNPFGF2-PROL cultures were treated with 10 µM 5-bromo-2'-deoxyuridine (BrdU) (Sigma-Aldrich) for a total period of 4 days. After fixation, cells were processed for double immunofluorescence using primary antibodies to BrdU (BD Biosciences, Heidelberg, Germany, http://www.bdbiosciences.com; 1:100), glial fibrillary acidic protein (GFAP) (1:200; Dako, Hamburg, Germany, http://www.dako.com), and smooth muscle actin (SMA) (1:200; Dako).

Immunofluorescence Analysis
The cultures were fixed with 4% parafomaldehyde in phosphate-buffered saline (PBS) for 10 minutes and incubated with primary antibodies to nestin (Rat-401; 1:200; Developmental Studies Hybridoma Bank, Iowa City, IA, http://www.uiowa.edu/~dshbwww), ßIII-tubulin (TUJ1; 1:500; Covance, Berkley, CA, http://www.covance.com), p75 (1:1,000; Chemicon), peripherin (1:200; Chemicon), Mash1 (1:200; RDI, Concord, MA, http://www.researchd.com), Brn3.0 (1:200; Chemicon), Sox10 (1:3; a gift from L. Sommer), Ret (1:10; R&D Systems), O4 (1:200; R&D Systems), P0 (1:50; a gift from A. Baron-van Evercooren), SMA (1:200; Dako), GFAP (1:200; Dako), choline acetyltransferase (ChAT; 1:200; Chemicon), calretinin (1:200; Biozol), Islet-1 (isl-1; 1:50; Developmental Studies Hybridoma Bank), serotonin (5HT; 1:1,000; AbD Serotec, Oxford, U.K., http://www.ab-direct.com), GABA (1:200; Sigma-Aldrich), phosphorylated Smad1 (1:200; Upstate, Charlottesville, VA, http://www.upstate.com), or tyrosine hydroxylase (TH; 1:200; Sigma-Aldrich) for 2 hours in PBS containing 1% normal goat serum. Triton X-100 (0.1%; Sigma-Aldrich) was added for labeling intracellular antigens. Detection of primary antibodies was performed with appropriate fluorescein isothiocyanate-, Cy3-, or rhodamine-conjugated secondary antibodies (Jackson Immunoresearch Laboratories, West Grove, PA, http://www.jacksonimmuno.com). Microscopical analysis was performed using Zeiss Axioskop 2 or Zeiss LSM510 microscopes.

Western Blot
Nuclear extracts were prepared with NE-PER nuclear and cytosolic extraction reagents (Pierce, Rockford, IL, http://www.piercenet.com) according to the supplier's instructions using protease and phosphatase inhibitors. Normalized protein lysates including positive controls were loaded on 10% polyacrylamide gels and blotted on nitrocellulose membranes. Blots were probed with antibodies directed against phosphorylated STAT3 (Ser 727; Cell Signaling Technology, Beverly, MA, http://www.cellsignal.com), phosphorylated Smad1 (Cell Signaling Technology), and appropriate alkaline phosphatase-conjugated secondary antibodies (Sigma-Aldrich). Signal was detected by chemiluminescence.

Immunoprecipitation
Total cell lysates were produced as described elsewhere [62]. Normalized lysates were incubated with antibodies against FKBP12 or FRAP overnight at 4°C. After incubation with protein G-Sepharose beads (GE Healthcare, Little Chalfont, Buckinghamshire, U.K., http://www.gehealthcare.com/), immune complexes were washed, heated at 70°C, separated by SDS-polyacrylamide gel electrophoresis, and transferred onto nitrocellulose. Blots were probed with antibodies against FKBP12 (Transduction Laboratories, Lexington, KY, http://www.bdbiosciences.com/pharmingen), BMP receptor 1A (BMPR 1A; R&D Systems), FRAP (Transduction Laboratories), and STAT3 (Cell Signaling Technology).

Quantification and Statistical Analysis
Quantification of labeled cells was based on 20 high-power fields in each of three independent experiments, with a minimum of 1,000 cells counted per experiment. Data are presented as mean values ± SEM. Statistical analyses were done using the {chi}2 test; p values ≤0.05 were regarded significant. In the case of low filled cells, a two-tailed Fisher's exact test was performed.

Reverse Transcription-Polymerase Chain Reaction and Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction Analysis
For reverse transcription-polymerase chain reaction (RT-PCR) analysis, cultures were harvested in Trizol (Invitrogen) for isolation of RNA, which was then used for first-strand cDNA synthesis (Superscript II; Invitrogen). RT-PCR was performed using primers for ß-actin [11], Mash1 [63], dHand (sense [s], TACCAGCTACATCGCTCCT; antisense [as], TCACTGCTTGAGCTCCAGGG), snail (s, GTGGAAAGGCCTTCTCTAGG; as, CAGACTCTTGGTGCTTGTGG), peripherin [64], c-Ret [65], Msx1 [43], SMA [66], ßIII-tubulin (s, CAGATGCTGCTTGTCTTGGC; as, GATGATGACGAGGAATCGGAA), GFAP (s, GAGTACCACGATCTACTCAAC; as, CCACAGTCTTTACCACGATGT), Sox10 (s, AGG TCA AGA AGG AAC AGC AG; as, TAC TGG TCG GCT AGC TTT CT), BMPR IA (s, GCTCCATGGCACTGGTATG; as, GCAATAGTTCGCTGAACC), BMPR IB (s, GCCTGCCATAAGTGAGAAGC; as, ACAGGCAACCCAGAGTCATC), BMPR II (s, CTCTGAGCATTCGATGTCCAG; as, CAAGCTAGAACTGGTACTGC), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (s, ACGACCCCTTCATTGACCTCAACT; as, ATATTTCTCGTGGTTCACACCCAT), BF-1 (s, ATGACTTCGCAGACCAGCAC; as, AACGTTCACTTACAGTCTGG), brachyury (s, CCGGTGCTGAAGGTAAATGT; as, CCTCCATTGAGCTTGTTGGT), FGF5 (s, GAAAAGACAGGCCGAGAGTG; as, GAAGTGGGTGGAGACGTGTT), AFP (s, AAAATTTGGATCCCGAAACC; as, TGCGTGAATTATGCAGAAGC), Mitf (s, AACCGACAGAAGAAGCTGGA; as, TGATGATCCGATTCACCAGA), Pax6 (s, AACAACCTGCCTATGCAACC; as, CTTGGACGGGAACTGACACT), and Hb9 (s, ACAGGCGGCTCTCTATGGGACA; as, TTCCCCAAG AGGTTCGACTGC).

All RNA probes underwent a DNase digestion (Promega, Mannheim, Germany, http://www.promega.com). In cases of non-exon-spanning primer pairs, a PCR without the reverse transcription step was performed to exclude contaminating genomic DNA. Quantitative real-time RT-PCR was carried out using the iCycler System (Bio-Rad, Munich, Germany, http://www.bio-rad.com), and amplification was monitored and analyzed by measuring the binding of the fluorescent dye SYBR Green I to double-stranded DNA. Expression of GAPDH was used for normalization.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Differential Expression of BMP Receptors During Neural ES Cell Differentiation
ES cells were aggregated to EBs to induce differentiation and subsequently propagated in ITS medium, which favors the survival of neuroepithelial cells (Fig. 1A). To enrich for neural precursors, cells were first propagated in the presence of FGF2 (ESNPFGF2-PROL) [15]. Further expansion was performed in FGF2 and EGF to obtained cultures enriched in late neural precursors. (ESNPFGF2-EGF-PROL) [25]. Both ESNPFGF2-PROL and ESNPFGF2-EGF-PROL were induced to differentiate by a 4-day growth factor withdrawal (ESNPFGF2-DIFF; ESNPFGF2-EGF-DIFF). This protocol results in a sequential generation of neurons, astrocytes, and oligodendrocytes, as described before [22, 25, 67]. As a first step toward the study of BMP effects in differentiating ES cells we analyzed the expression of BMPR IA, BMPR IB, and BMPR II (i.e., BMP receptors known to be involved in neural lineage establishment [43]). BMPR IA and BMPR II were robustly expressed throughout in vitro differentiation. BMPR IB, in contrast, was strongly induced in ESNPFGF2-EGF-DIFF cultures, which are primarily composed of differentiating glial cells (Fig. 1B) [25].

Promotion of Neural Crest Generation in BMP-Treated EBs
Following up on the early expression of BMP receptors in the EB stage, we first studied whether stimulation of EBs with BMP2 affects the expression of germ layer markers. A 3-day exposure of EBs to BMP2 led to a strong increase of the mesoderm marker brachyury (Fig. 1C). EBs showed spontaneous expression of ßIII-tubulin, indicating differentiation of neuroectodermal cells. BMP2 increased the ectoderm marker FGF5, whereas it decreased the expression of the neuronal differentiation marker ßIII-tubulin (Fig. 1C). Similar results were obtained using a different ES cell line (CJ7; data not shown). EBs also showed expression of Sox10, an early neural crest marker. This provides the possibility that neural crest cells (NCCs) may exist in EBs, and therefore the treatment of EBs with BMP2 might increase putative NCCs. Therefore, we tested whether BMP2 treatment at the EB stage affects the elaboration of neural crest fates in subsequent culture steps. Upon plating and culture in ITS neural selection medium (Fig. 1A, EBITS-DIFF), BMP-treated EBs gave rise to cells with enhanced expression of several neural crest-related genes, including Snail, Sox10, p75, Mitf, and SMA (Fig. 1D). Snail is expressed in both premigratory and—together with Sox10 and p75—migrating neural crest precursors [68]. Mitf is a characteristic marker of early melanoblasts [69], whereas SMA is expressed in smooth muscle cells, which originate either from the neural crest or the mesoderm. Neural crest-derived smooth muscle cells, but not mesoderm-derived smooth muscle cells, coexpress p75 [53]. Considering the strong induction of the mesoderm marker brachyury in BMP-treated EBs and the only moderate increase of p75 transcripts in the EBITS-DIFF cultures, it appears likely that both routes contribute to the strong induction of SMA.

Inhibition of Neuronal Differentiation Coincides with an Upregulation of PNS Markers
The pronounced inhibition of neuronal differentiation in BMP-treated EBs was not restricted to the EB stage but was preserved in all subsequent culture steps. For instance, ESNPFGF2-DIFF cultures derived from BMP2-treated EBs contained only 21% ± 2% ßIII-tubulin-positive neurons compared with 63% ± 4% in ESNPFGF2-DIFF cultures derived from untreated EBs (supplemental online Fig. 6). Inhibition of neuronal differentiation was also observed when BMP2 was added to early ES cell-derived neural precursors proliferating in FGF2 (Fig. 2A, 2B). Following growth factor withdrawal, only 28% ± 0.6% of BMP2-treated ESNPFGF2-DIFF gave rise to ßIII-tubulin-positive neurons, compared with 49% ± 1.5% of their untreated counterparts (Fig. 2B). A pronounced decrease in neuronal differentiation was also noted upon treatment with 10 ng/ml BMP4 (data not shown). On the other hand, within the decreased fraction of neurons originating from BMP-treated ESNPFGF2-DIFF, the percentage of peripherin-positive cells increased from 45.6% ± 3% to 66.6% ± 2% (Fig. 2C, 2D). Such an increase in peripherin-positive cells could also be observed in ESNPs derived from a different ES cell line (CJ7; data not shown). Both the overall decrease in neuronal differentiation and the relative increase of peripherin-positive neurons were abolished by cotreatment with noggin, a known BMP inhibitor (Fig. 2B, 2C). Since we were interested in the generation of peripheral neurons, we investigated the differentiated cells for coexpression of peripherin and ßIII-tubulin. Dose-response experiments indicated that BMP2-mediated promotion of peripherin- and ßIII-tubulin-positive cells saturated at 10 ng/ml BMP2 (Fig. 2D). Data from quantitative RT-PCR confirmed the increase of peripherin and the decrease of ßIII-tubulin transcripts following BMP2 treatment (Fig. 2E, 2F). Furthermore, the expression of BF-1, a transcription factor typically expressed in the telencephalon, and Pax6, a neural progenitor marker within telencephalon and intermedioventral spinal cord, was downregulated in BMP2-treated ESNPFGF2-DIFF (Fig. 2E). In contrast, c-ret and Mash1, which are expressed in a subset of peripheral neurons, were upregulated upon BMP2 treatment. We also observed that BMP2 induced an increased expression of the neural crest marker snail.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

  		Figure 2. BMP2 inhibits neuronal differentiation and promotes peripherin-positive fates in ESNPs. BMP2 treatment during FGF2-mediated proliferation (A) decreased overall neuronal differentiation in ESNPFGF2-DIFF cultures (B). At the same time, the ratio of peripherin-expressing neurons increased markedly (C). Both effects were abolished by noggin treatment. (D): Dose-dependent effect of BMP2 on the generation of peripherin-expressing neurons. (E): Quantitative reverse transcription-polymerase chain reaction analyses confirmed a decrease in ßIII-tubulin transcripts and showed a concomitant induction of the neural crest-associated markers c-ret, snail, and Mash1. At the same time, Pax6 and BF-1 were downregulated. (F): Representative anti-peripherin/ßIII-tubulin double immunofluorescence of a BMP-treated ESNPFGF2-DIFF culture. Scale bar = 20 µm. Abbreviations: BMP, bone morphogenetic protein; DIFF, differentiated; ESNP, embryonic stem cell-derived neural precursor; FGF, fibroblast growth factor.

 
BMP2 Modulates the Subspecification of Peripherin-Positive ES Cell-Derived Neurons
We next studied to what extent BMP2 exposure during FGF2-mediated proliferation influences the segregation of peripherin-expressing neurons in ESNPFGF2-DIFF cultures. We found that BMP2 treatment increased ChAT-positive cells within the peripherin-positive fraction (12.4% ± 2% vs. 6.7% ± 2%; Fig. 3B, 3C, 3J). At the same time, exposure to BMP2 decreased the number of peripherin/Islet-1-positive neurons. Islet-1 (isl-1) is a transcription factor that is enriched not only in cholinergic spinal cord motoneurons but also in a subgroup of dorsal root ganglion cells. Thus, our findings raised the possibility that the increase of ChAT-positive cells induced by BMP2 reflected the promotion of cholinergic PNS neurons rather than an increase of spinal cord motoneurons. To test this possibility, we investigated the expression of the homeobox gene Hb9, a specific marker of motoneurons [70]. Quantitative RT-PCR showed that Hb9 transcription, too, decreased upon BMP2 treatment (Fig. 3C). Double immunolabelings revealed ChAT-positive neurons with and without co-expression of isl-1 (Fig. 3D). Interestingly, BMP2 treatment resulted in the appearance of calretinin/peripherin double-labeled neurons (5.2% ± 2% vs. 0%; Fig. 3B, 3I). This combination is observed in peripheral somatosensory neurons, including sensory enteric neurons [71, 72]. We further noticed an increase of peripherin-positive neurons expressing GABA (6.1% ± 1% vs. 2.2% ± 1%; Fig. 3B, 3G) and, to a lesser extent, serotonin (1.2% ± 0.2% vs. 0.2% ± 0.2%; Fig. 3B, F). A subset of the serotonin/peripherin-positive neurons was also found to express ChAT (data not shown). Within the peripherin-positive population, BMP2 further favored the development of putative Mash1-positive autonomic neurons (2.7% ± 1.2% vs. 0.7% ± 0.5%; Fig. 3B, 3H). In contrast, BMP2 treatment resulted in slightly but insignificantly decreased numbers of TH/peripherin-positive putative catecholaminergic PNS neurons and Brn3.0/peripherin-positive presumptive sensory phenotypes (Fig. 3B, 3E). Quantitative RT-PCR confirmed the increase of ChAT and the decrease of isl-1 expression upon BMP2 treatment (Fig. 3C). Thus, BMP2 has diverse effects on the subspecification of ES cell-derived peripherin-positive neuronal progeny.


Figure 3
View larger version (26K):
[in this window]
[in a new window]

  		Figure 3. BMP2 modulates the fate of peripherin-positive embryonic stem cell-derived neurons. (A, B): BMP2 treatment during FGF2-mediated proliferation of ESNPs increased the number of peripherin/ChAT-expressing cells in their differentiated progeny. At the same time, BMP2 decreased the peripherin/isl-1-positive neurons. BMP2 exposure further favored the generation of peripherin-positive neurons co-expressing calretinin, GABA, 5HT, and Mash-1. No significant differences in the emergence of peripherin/TH-expressing and peripherin/Brn3.0-positive neurons were observed between the BMP2-treated and control group. (C): Quantitative reverse transcription-polymerase chain reaction analysis confirmed the BMP effects on ChAT, Hb9, and isl-1 expression. (D–J): Representative examples of neurons co-expressing ChAT and isl-1 (D), peripherin and Brn3.0 (E), serotonin (F), GABA (G), Mash1 (H), calretinin (I), and ChAT (J). Scale bars = 10 µm (D, E, G–J) and 20 µm (F). Single channel captures are given in supplemental online Figure 7. Abbreviations: 5HT, serotonin; BMP, bone morphogenetic protein; ChAT, choline acetyltransferase; DIFF, differentiated; FGF, fibroblast growth factor; GABA, {gamma}-aminobutyric acid; PNS, peripheral nervous system; TH, tyrosine hydroxylase.

 
The BMP2 Effect on Astrocyte and Smooth Muscle Differentiation Is Density-Dependent
The results of previous studies indicate that BMP signaling promotes the development of GFAP-positive glia and smooth muscle phenotypes from primary neuroepithelial precursors [53, 56, 59, 62]. To study whether this phenomenon can be translated to ES cell-derived neural precursors, we determined the number of GFAP- and SMA-positive cells generated from BMP2-treated ESNPFGF2-DIFF cultures (Fig. 4A1, 4A2). Application of BMP2 to high-density cultures resulted in a clear increase of GFAP-positive astrocytes from 9% ± 2.3% to 20% ± 2.3% (Fig. 4B, 4C). Remarkably, this effect was restricted to high-density cultures. In low-density cultures, the same regimen increased instead SMA-positive smooth muscle cells (5% ± 1.5% vs. 31% ± 1.5%; Fig. 4D, 4E). In contrast, BMP2 treatment of low- and high-density cultures had no significant effect on the number of GFAP- and SMA-positive cells, respectively (not shown). Simultaneous application of noggin abolished the BMP2-induced differentiation effects (Fig. 4B, 4E). Quantitative RT-PCR analyses confirmed the increased expression of GFAP in high-density cultures and SMA in low-density cultures after BMP treatment (Fig. 4F). Although these and previous data [53, 56] argue for an instructive role of BMPs on astrocyte and smooth muscle differentiation, the changes we observed could also be due to a selective mechanism against other cell fates. To distinguish between these two possibilities, cells were subjected to a proliferation assay. In high-density cultures, BMP2 caused a decrease in BrdU-labeled cells from 50% ± 2.3% to 27% ± 2.5% (supplemental online Fig. 8). Similarly, BMP2-treated low-density cultures showed a reduction of BrdU-positive cells (66% ± 2.3% vs. 45% ± 2.5%; supplemental online Fig. 8). No increase of BrdU/GFAP and BrdU/SMA double-labeled cells was observed in high- and low-density cultures, respectively. These findings argue against a selective promotion of astrocyte or smooth muscle proliferation by BMP2. Furthermore, an increase in astrocyte differentiation was also observed when BMP2 was solely added during FGF2 withdrawal (data not shown), indicating that this effect does not depend on proliferation imposed by exogenous FGF2 treatment.


Figure 4
View larger version (40K):
[in this window]
[in a new window]

  		Figure 4. Density-dependent promotion of astrocyte and smooth muscle differentiation in BMP2-treated ESNPs. HD and LD cultures of FGF2-propagated ESNPs were exposed to 10 ng/ml BMP2 and subsequently differentiated by growth factor withdrawal (A1 A2). In HD cultures (plating density, 105 cells per cm2), BMP2 resulted in a clear increase of astrocyte differentiation (B, C). In contrast, LD cultures (plating density, 103 cells per cm2) responded with increased smooth muscle differentiation (D, E). These findings were confirmed by qRT-PCR analysis of GFAP and SMA expression (F). Simultaneous application of noggin and BMP2 abolished both effects (B, E). Rapamycin inhibited BMP2-mediated astrocyte induction in HD cultures, whereas smooth muscle differentiation in LD cultures remained unaffected (B, E). (G–I): BMP treatment also promoted astrocyte differentiation in ESNPFGF2-EGF-PROL cultures. This effect occurred at the expense of oligodendrocyte formation. Co-application of BMP2 and rapamycin reduced astrocyte differentiation to subcontrol levels and restored oligodendrocyte differentiation as shown by quantitative (G) and qualitative (I) assessment of GFAP and O4 expression. Scale bars = 30 µm (C), 25 µm (D), and 10 µm (I). Abbreviations: BMP, bone morphogenetic protein; DIFF, differentiated; EGF, epidermal growth factor; FGF, fibroblast growth factor; GFAP, glial fibrillary acidic protein; HD, high-density; LD, low-density; qRT-PCR, quantitative reverse transcription-polymerase chain reaction; Rapa, rapamycin; SMA, smooth muscle actin.

 
We wondered whether the effect of BMP2 on astrocyte differentiation is maintained at later stages of neural differentiation. In our experimental set-up, EB-derived early neural precursors proliferate as multipotent ESNPFGF2-PROL cultures [5]. Subsequent propagation in the presence of EGF and FGF2 gives rise to a population of late neural precursors that, upon simultaneous withdrawal of both growth factors, generates primarily astrocytes and oligodendrocytes [25]. Under standard conditions, ESNPFGF2-EGF-DIFF cultures contained 72% ± 3% GFAP-positive astrocytes and 14.8% ± 2% O4-expressing oligodendrocytes. BMP2 exposure during FGF2/EGF application increased the number of astrocytes (89.4% ± 2.4%), while decreasing that of oligodendrocytes (0.6% ± 1%; Fig. 4G). A similar increase in GFAP-positive cells at the expense of oligodendrocyte differentiation was detected upon treatment with BMP4 or in ESNPFGF2-EGF-DIFF cultures prepared from a different ES cell line (CJ7; data not shown). ESNPFGF2-EGF-PROL cultures exposed to BMP2 also gave rise to 1.6% ± 0.4% SMA-positive smooth muscle cells, which were undetectable in non-BMP-treated cultures. P0-positive putative Schwann cells, ranging from 1% to 3% of the cells in untreated ESNPFGF2-EGF-DIFF cultures, were no longer detectable after BMP2 treatment (not shown).

Differential Activation of the JAK/STAT and Smad Pathways in Astrocyte and Smooth Muscle Specification
Recent data on primary neural precursor cells suggest that BMP4 activates distinct signaling pathways in a density-dependent manner [62]. Specifically, it has been suggested that astrocyte induction in high-density cultures is mediated via activation of the JAK/STAT pathway, with the serine/threonine kinase FRAP playing a crucial role in linking the Smad and JAK/STAT signaling pathways (Fig. 5A). We explored this hypothesis by co-application of BMP2 and rapamycin, a potent FRAP inhibitor [73]. Rapamycin-treated high-density cultures showed a marked attenuation of astrocyte induction, with the number of GFAP-positive cells dropping from 20% ± 3% to 6% ± 2% (Fig. 4B). In contrast, rapamycin treatment of BMP2-exposed low-density cultures elicited no significant changes in the differentiation of both astrocytes and smooth muscle cells (Fig. 4E). Western blot analysis with an antibody directed against phosphorylated STAT3 was used to explore whether BMP2 treatment activates the JAK/STAT pathway. Activation of this pathway by CNTF or LIF has been shown to promote glial differentiation in neural precursors [62, 73, 74]. Indeed, the levels of phospho-STAT3 (pSer727) were increased upon treatment of ESNPs with BMP2 (Fig. 5B) compared with control cultures exposed to FGF2 alone. Notably, cotreatment with BMP2 and rapamycin abolished the increase of phospho-STAT3, thus supporting the hypothesis that BMP activates STAT3 through FRAP. Western blot analysis also confirmed increased Smad phosphorylation in BMP-treated low-density cultures giving rise to smooth muscle cells (Fig. 5C). Binding of BMP2 to its receptor BMPR IA is considered to disrupt the interaction of BMPR IA with FKBP12, which prevents Smad activation in the absence of receptor ligand [75, 76]. Upon dissociation from BMPR IA, FKBP12 binds to FRAP, which in turn phosphorylates STAT3, thereby enhancing the translocation of the latter into the nucleus [77–84]. Consistent with this scenario, co-immunoprecipitation of BMPR IA and FKBP12 from ESNPFGF2-DIFF was reduced following BMP2 treatment (Fig. 5J). Concomitantly, co-immunoprecipitation of STAT3 and FRAP was increased (Fig. 5K, 5L).


Figure 5
View larger version (38K):
[in this window]
[in a new window]

  		Figure 5. Cross-signaling between BMPR and the JAK/STAT pathway. Recent evidence from primary cell cultures suggests that BMP2-mediated astrocyte induction in high-density cultures is executed via the serine threonine kinase FRAP and cross-activation of the JAK/STAT pathway ([A], adapted from [62]). Cotreatment with BMP2 and the FRAP inhibitor rapamycin was used to test for this hypothesis. Indeed, BMP treatment increased the level of STAT3 phosphorylation in high-density cultures, an effect that could be abolished by rapamycin (B) (+, positive control: 2-day-LIF-treated ESNPFGF2-EGF-PROL). Vice versa, BMP2 led to an increase in phosphorylated Smad1 in low-density cultures, giving rise to smooth muscle cells (C). Cross-signaling between BMPR and the JAK/STAT pathway was further supported by a decreased immunoprecipitation of FKBP12 and BMPR IA (D) and an increased immunoprecipitation of FRAP and STAT3 (E, F) (quantification via chemiluminescence) after BMP2 treatment. Both increased STAT3 phosphorylation and co-immunoprecipitation of FRAP and STAT3 cold be abolished by rapamycin (B, E). Abbreviations: BMP, bone morphogenetic protein; BMPR, bone morphogenetic protein receptor; DIFF, differentiated; ESNP, embryonic stem cell-derived neural precursor; FGF, fibroblast growth factor.

 
As in the ESNPFGF2 cultures, addition of rapamycin to BMP2-treated ESNPFGF2-EGF cultures abolished the effect of BMP2 on astrocyte differentiation, yielding fewer GFAP-positive cells than in rapamycin-untreated cultures (52.4% ± 7% vs. 72% ± 3%). At the same time, rapamycin rescued oligodendroglial differentiation (Fig. 4G, 4I), restoring the level of O4-positive cells to 13% ± 1.5%. In contrast, rapamycin had no effect on the number of SMA-positive smooth muscle and P0-immunoreactive Schwann cells as compared with non-rapamycin-treated BMP2-exposed ESNPFGF2-EGF-DIFF cultures. Due to poor survival at low density, these experiments could only be performed in high-density cultures, yet the data indicate that BMP2-mediated promotion of astrocyte induction is maintained in ES cell-derived glial precursors and occurs at the expense of oligodendroglial differentiation. The neutralization of the BMP2 effect by rapamycin suggests that astrocyte induction at the glial precursor stage, too, is mediated via cross-signaling between the Smad and JAK/STAT pathway.


   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 Acknowledgments
 References
 
The results of this study show that BMP2 exerts a variety of diverse and stage-specific effects on the in vitro differentiation of murine ES cells. The data obtained have implications on several levels. From a biomedical point of view, the effects of BMP2 on ES cell differentiation may provide a basis for the enrichment of specific phenotypes for cell replacement strategies. In particular, BMP2 treatment of differentiating ES cell cultures may be used for the enrichment of therapeutically relevant peripheral neural phenotypes. From a developmental perspective, our data indicate that many of the BMP2-mediated differentiation events observed during embryonic development are preserved in differentiating ES cell cultures, although clonal analyses will be required to fully delineate the differentiation potential of the various BMP-induced precursor cell stages and their lineage relationship. Finally, on a mechanistic level, our data give further support to the hypothesis that some of the BMP2-induced differentiation effects are based on a cross-signaling between the Smad and the JAK/STAT pathways.

Early Effects: Inhibition of Neuronal Differentiation and Promotion of Neural Crest Fates
BMP signaling plays a key role in early embryonic patterning. The BMP2-induced differentiation events observed in the early stages of our ES cell differentiation paradigm are in line with these developmental effects. BMP2 application to differentiating ES cells promotes the expression of ectodermal and mesodermal markers while suppressing neuronal differentiation. Similar findings have been made in ES cell differentiation paradigms involving retinoic acid and stromal cell cocultures [85, 86]. The inhibitory effect on neuronal differentiation was sustained when FGF2-propagated neural precursors were exposed to BMP2. This finding correlates to previous studies on FGF2-expanded embryonic cortical progenitors, which showed decreased neuronal differentiation upon BMP treatment [87, 88].

During neurulation, the ectoderm divides into neural plate and prospective epidermis. The boundary region in-between is the source of the neural crest. The induction of this transient population is influenced by many factors, including Wnt signals, FGF, retinoic acid [89], and, most prominently, BMPs [44, 89–92]. BMPs have been shown to act at various phases of neural crest generation [91], migration [93], and differentiation [94]. Furthermore, several studies have shown that in vivo and in vitro exposure of embryonic neuroepithelial precursors to BMP2/4 results in increased neural crest differentiation [53–56, 95]. In keeping with this, exposure of EBs to BMP2 resulted in a pronounced increase of neural crest marker expression in EB-derived neural cells.

Elaboration of Different Peripheral Neuronal Subtypes
Promotion of neural crest differentiation by BMP2 was not restricted to EBs but could also be elicited in FGF2-propagated ESNPs. Despite the overall decrease of ßIII-tubulin-positive neurons in BMP2-treated ESNPFGF2-DIFF cultures, we noted a relative increase of the fraction of peripherin-positive neurons. In contrast, the generation of peripherin-positive neurons form BMP-treated EBs was highly variable and inefficient. We also found a decreased expression of the telencephalic transcription factor BF-1, suggesting that in our model, BMP2 favors the generation of peripheral neurons at the expense of anterior CNS neurons. Pax6, too was downregulated by BMP2, a phenomenon compatible with the dorsalizing effect of BMPs in the developing neural tube [96–98].

There is evidence that BMPs not only promote the differentiation of peripherin-expressing neurons but also modulate their subspecification. In primary neural crest stem cells, BMPs have been shown to induce cholinergic neurons [94]. This effect was reflected in our ES cell system, where the enhanced expression of peripherin and ChAT but not isl-1 and Hb9 upon BMP2 treatment pointed to an enhanced differentiation of peripheral cholinergic neurons. Another striking effect observed upon BMP treatment was the induction of calretinin/peripherin-positive neurons, a phenotype that was virtually undetectable in non-BMP-treated controls. Coexpression of calretinin and peripherin is typically found in primary afferent enteric neurons [71]. In the chick, BMP has been found to promote the generation of calretinin-positive neurons in the brainstem [99].

In primary neural crest cells, BMPs have been shown to inhibit peripheral sensory neuron differentiation [100]. This effect, too, is reflected in our experimental paradigm, where BMP2 treatment of ES cell-derived neural progenitors resulted in a slight decrease of peripherin/Brn3.0-expressing putative peripheral sensory neurons. However, there is evidence for sensory neuron generation despite the presence of BMP2 [101], indicating once again that depending on time and dosage, BMPs may have diverse effects on neural differentiation.

Other effects of BMP2 on the subspecification of peripherin-positive neurons include induction of peripherin/Mash1- and peripherin/GABA-neurons.

Mechanisms of BMP-Mediated Astrocyte Induction
Studies on primary neural precursors indicate that BMPs promote astrocytic differentiation while inhibiting the development of oligodendrocytes [32, 59, 102–104]. Both effects were well represented in our culture system. Upon treatment with BMP2, multipotent FGF2-propagated neural precursors showed a clear increase in astrocyte differentiation. This effect was preserved in ESNPFGF2-EGF-DIFF cultures, a differentiation stage primarily composed of late neural precursor cells [105], which, upon simultaneous withdrawal of both growth factors, give predominantly raise to astrocytes and oligodendrocytes [106]. In these cultures, BMP2 also led to a decrease in oligodendroglial phenotypes. Thus, BMP-mediated promotion of astrocyte differentiation and inhibition of oligodendrocyte development can be translated to ES cell-derived neural precursors.

Remarkably, in FGF2-propagated ES cell-derived neural precursors, the effect of BMP2 on astrocyte differentiation was strictly density-dependent. Whereas BMP2 induced astrocytic differentiation in high-density cultures, it promoted smooth muscle development in low-density cultures. Similar observations have been made by others in BMP-treated primary neural precursors [45, 56]. It has been proposed that BMP-induced astrocytic differentiation is mediated via cross-signaling between the Smad and JAK/STAT pathways [62]. This phenomenon is supposed to be mediated via the serine-threonine kinase FRAP (Fig. 5A). Indeed, the FRAP inhibitor rapamycin blocked BMP-mediated astrocyte induction in both high-density ESNPFGF2 and ESNPFGF2-EGF cultures. Cross-signaling between BMPR activation and the JAK/STAT pathway was supported by an increase in STAT3 phosphorylation upon BMP2 treatment. Furthermore, BMP2 decreased the level of BMPR 1A coimmunoprecipitated with FKBP12 and increased the amount of STAT3 co-immunoprecipitated with FRAP. Importantly, all three effects could be abolished by rapamycin. Although interaction between the Smad and JAK/STAT pathways might occur without FKB12/FRAP activation [107–110], our data, together with those of Rajan et al., suggest that activation of the JAK/STAT pathway is a universal principle in BMP-mediated astrocyte induction [62].

Perspectives for Peripheral Nervous System Repair
The results of this study indicate that a variety of BMP-mediated effects on germ layer differentiation, neural crest induction, and neural sublineage segregation observed during normal development can be recapitulated during the stepwise differentiation of ES cells into neural precursors (supplemental online Fig. 9). So far, BMP-related studies on ES cells have mainly focused on maintenance of pluripotency [11, 111], neural induction [11, 107–109], or formation of mesoderm and extra-embryonic endoderm [110, 112–117]. It is only recently that BMP signaling has been identified as a promising tool to promote neural crest differentiation of ES cells. Mizuseki et al. have shown that ES cells cocultured with PA6 stromal cells and exposed to BMP4 can generate a variety of neural crest phenotypes [85]. In analogy to this observation, Pomp et al. have induced neural crest phenotypes in human ES cells by PA6 stromal cell coculture [118]. Most recently, Lazzari et al. have shown that bovine ES cells cultivated serum-free with supplementation of FGF2 and EGF form polarized rosette structures and exhibit cell junction distribution as in the developing neural tube [119]. In vitro expansion of neural rosettes gave rise to p75-positive neural crest precursor cell lines [120]. Our data confirm and extend these observations, indicating that BMP2 exposure during ES cell differentiation can be used to enrich individual neural crest-associated subpopulations. This approach might be combined with lineage selection strategies involving expression of selectable markers under control of cell type-specific promoters, thus yielding purified and therapeutically relevant donor cell populations. One candidate disorder for cell transplantation in the PNS is Hirschsprung disease, which is characterized by a circumscribed loss of enteric neurons in defined segments of the gut. First studies on the survival and differentiation of transplanted fetal CNS precursors indicate that this disorder might become a target for transplantation therapies [121]. In that regard, BMP-mediated generation of ES cell-derived peripheral neurons could serve as a starting point for the generation of disease-specific donor cells.


   DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
References
 
This work was supported by the DFG (Go-1066/1-1), the Hertie Foundation, BONFOR, and European Union project LSHB-CT-2003-503005 (EuroStemCell). We gratefully acknowledge Heinz Reichmann, Andrea Kempe, Anke Altkrüger, Hassan Mziaut, Cemile Jakopoglu, Sabine Schenk, and Barbara Steinfarz for advice and technical support and L. Sommer for helpful discussions.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 

  1. Gajovic S, Chowdhury K, Gruss P. Genes expressed after retinoic acid-mediated differentiation of embryoid bodies are likely to be expressed during embryo development. Exp Cell Res 1998;242:138–143.[CrossRef][Medline]

  2. Brivanlou AH, Gage FH, Jaenisch R et al. Stem cells. Setting standards for human embryonic stem cells. Science 2003;300:913–916.[Abstract/Free Full Text]

  3. Keller G. Embryonic stem cell differentiation: Emergence of a new era in biology and medicine. Genes Dev 2005;19:1129–1155.[Abstract/Free Full Text]

  4. Doetschman TC, Eistetter H, Katz M et al. The in vitro development of blastocyst-derived embryonic stem cell lines: Formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol 1985;87:27–45.[Medline]

  5. Lake J, Rathjen J, Remiszewski J et al. Reversible programming of pluripotent cell differentiation. J Cell Sci 2000;113:555–566.[Abstract]

  6. Shen MM, Leder P. Leukemia inhibitory factor is expressed by the preimplantation uterus and selectively blocks primitive ectoderm formation in vitro. Proc Natl Acad Sci U S A 1992;89:8240–8244.[Abstract/Free Full Text]

  7. Coucouvanis E, Martin GR. BMP signaling plays a role in visceral endoderm differentiation and cavitation in the early mouse embryo. Development 1999;126:535–546.[Abstract]

  8. Rathjen J, Rathjen PD. Mouse ES cells: Experimental exploitation of pluripotent differentiation potential. Curr Opin Genet Dev 2001;11:587–594.[CrossRef][Medline]

  9. Blyszczuk P, Czyz J, Kania G et al. Expression of Pax4 in embryonic stem cells promotes differentiation of nestin-positive progenitor and insulin-producing cells. Proc Natl Acad Sci U S A 2003;100:998–1003.[Abstract/Free Full Text]

  10. Tropepe V, Hitoshi S, Sirard C et al. Direct neural fate specification from embryonic stem cells: A primitive mammalian neural stem cell stage acquired through a default mechanism. Neuron 2001;30:65–78.[CrossRef][Medline]

  11. Ying QL, Stavridis M, Griffiths D et al. Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol 2003;21:183–186.[CrossRef][Medline]

  12. Lee KJ, Dietrich P, Jessell TM. Genetic ablation reveals that the roof plate is essential for dorsal interneuron specification. Nature 2000;403:734–740.[CrossRef][Medline]

  13. Wichterle H, Lieberam I, Porter JA et al. Directed differentiation of embryonic stem cells into motor neurons. Cell 2002;110:385–397.[CrossRef][Medline]

  14. Billon N, Jolicoeur C, Ying QL et al. Normal timing of oligodendrocyte development from genetically engineered, lineage-selectable mouse ES cells. J Cell Sci 2002;115:3657–3665.[Abstract/Free Full Text]

  15. Okabe S, Forsberg-Nilsson K, Spiro AC et al. Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech Dev 1996;59:89–102.[CrossRef][Medline]

  16. Carpenter MK, Inokuma MS, Denham J et al. Enrichment of neurons and neural precursors from human embryonic stem cells. Exp Neurol 2001;172:383–397.[CrossRef][Medline]

  17. Bibel M, Richter J, Schrenk K et al. Differentiation of mouse embryonic stem cells into a defined neuronal lineage. Nat Neurosci 2004;7:1003–1009.[CrossRef][Medline]

  18. Reubinoff BE, Itsykson P, Turetsky T et al. Neural progenitors from human embryonic stem cells. Nat Biotechnol 2001;19:1134–1140.[CrossRef][Medline]

  19. Zhang SC, Wernig M, Duncan ID et al. In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat Biotechnol 2001;19:1129–1133.[CrossRef][Medline]

  20. Conti L, Cattaneo E. Controlling neural stem cell division within the adult subventricular zone: An APPealing job. Trends Neurosci 2005;28:57–59.[CrossRef][Medline]

  21. Benzing C, Segschneider M, Leinhaas A et al. Neural conversion of human embryonic stem cell colonies in the presence of fibroblast growth factor-2. Neuroreport 2006;17:1675–1681.[CrossRef][Medline]

  22. Schmandt T, Meents E, Gossrau G et al. High-purity lineage selection of embryonic stem cell-derived neurons. Stem Cells Dev 2005;14:55–64.[CrossRef][Medline]

  23. Li M, Pevny L, Lovell-Badge R et al. Generation of purified neural precursors from embryonic stem cells by lineage selection. Curr Biol 1998;8:971–974.[CrossRef][Medline]

  24. Lee SH, Lumelsky N, Studer L et al. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat Biotechnol 2000;18:675–679.[CrossRef][Medline]

  25. Brüstle O, Jones KN, Learish RD et al. Embryonic stem cell-derived glial precursors: A source of myelinating transplants. Science 1999;285:754–756.[Abstract/Free Full Text]

  26. Muñoz-Sanjuan I, Brivanlou AH. Neural induction, the default model and embryonic stem cells. Nat Rev Neurosci 2002;3:271–280.[CrossRef][Medline]

  27. Zhang J, Li L. BMP signaling and stem cell regulation. Dev Biol 2005;284:1–11.[CrossRef][Medline]

  28. Attisano L, Wrana JL. Signal transduction by the TGF-beta superfamily. Science 2002;296:1646–1647.[Abstract/Free Full Text]

  29. Tiedemann H, Asashima M, Grunz H et al. Pluripotent cells (stem cells) and their determination and differentiation in early vertebrate embryogenesis. Dev Growth Differ 2001;43:469–502.[CrossRef][Medline]

  30. Hogan BL. Bone morphogenetic proteins in development. Curr Opin Genet Dev 1996;6:432–438.[CrossRef][Medline]

  31. Kaplan FS, Shore EM. Encrypted morphogens of skeletogenesis: Biological errors and pharmacologic potentials. Biochem Pharmacol 1998;55:373–382.[CrossRef][Medline]

  32. Mehler MF. Mechanisms regulating lineage diversity during mammalian cerebral cortical neurogenesis and gliogenesis. Results Probl Cell Differ 2002;39:27–52.[Medline]

  33. Mehler MF, Mabie PC, Zhang D et al. Bone morphogenetic proteins in the nervous system. Trends Neurosci 1997;20:309–317.[Medline]

  34. Wilson SI, Graziano E, Harland R et al. An early requirement for FGF signalling in the acquisition of neural cell fate in the chick embryo. Curr Biol 2000;10:421–429.[CrossRef][Medline]

  35. Knecht AK, Harland RM. Mechanisms of dorsal-ventral patterning in noggin-induced neural tissue. Development 1997;124:2477–2488.[Abstract]

  36. Hemmati-Brivanlou A, Melton D. Vertebrate embryonic cells will become nerve cells unless told otherwise. Cell 1997;88:13–17.[CrossRef][Medline]

  37. Smith JL, Wilson JE, Macdonald PM. Overexpression of oskar directs ectopic activation of nanos and presumptive pole cell formation in Drosophila embryos. Cell 1992;70:849–859.[CrossRef][Medline]

  38. Sasai Y, Lu B, Steinbeisser H et al. Xenopus chordin: A novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 1994;79:779–790.[CrossRef][Medline]

  39. De Robertis EM. Spemann's organizer and self-regulation in amphibian embryos. Nat Rev Mol Cell Biol 2006;7:296–302.[CrossRef][Medline]

  40. Delaune E, Lemaire P, Kodjabachian L. Neural induction in Xenopus requires early FGF signalling in addition to BMP inhibition. Development 2005;132:299–310.[Abstract/Free Full Text]

  41. Xanthos JB, Kofron M, Tao Q et al. The roles of three signaling pathways in the formation and function of the Spemann Organizer. Development 2002;129:4027–4043.[Abstract/Free Full Text]

  42. Kuroda H, Wessely O, De Robertis EM. Neural induction in Xenopus: Requirement for ectodermal and endomesodermal signals via Chordin, Noggin, beta-Catenin, and Cerberus. PLoS Biol 2004;2:E92.[CrossRef][Medline]

  43. Panchision DM, Pickel JM, Studer L et al. Sequential actions of BMP receptors control neural precursor cell production and fate. Genes Dev 2001;15:2094–2110.[Abstract/Free Full Text]

  44. Liem KF Jr, Tremml G, Roelink H et al. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 1995;82:969–979.[CrossRef][Medline]

  45. Nguyen VH, Trout J, Connors SA et al. Dorsal and intermediate neuronal cell types of the spinal cord are established by a BMP signaling pathway. Development 2000;127:1209–1220.[Abstract]

  46. Kishimoto Y, Lee KH, Zon L et al. The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 1997;124:4457–4466.[Abstract]

  47. Murphy M, Reid K, Ford M et al. FGF2 regulates proliferation of neural crest cells, with subsequent neuronal differentiation regulated by LIF or related factors. Development 1994;120:3519–3528.[Abstract]

  48. Baker CV, Bronner-Fraser M. The origins of the neural crest. Part I: Embryonic induction. Mech Dev 1997;69:3–11.[CrossRef][Medline]

  49. Sieber-Blum M, Zhang JM. Growth factor action in neural crest cell diversification. J Anat 1997;191:493–499.[CrossRef][Medline]

  50. Mayor R, Guerrero N, Martinez C. Role of FGF and noggin in neural crest induction. Dev Biol 1997;189:1–12.[CrossRef][Medline]

  51. Villanueva S, Glavic A, Ruiz P et al. Posteriorization by FGF, Wnt, and retinoic acid is required for neural crest induction. Dev Biol 2002;241:289–301.[CrossRef][Medline]

  52. Schneider C, Wicht H, Enderich J et al. Bone morphogenetic proteins are required in vivo for the generation of sympathetic neurons. Neuron 1999;24:861–870.[CrossRef][Medline]

  53. Mujtaba T, Mayer-Proschel M, Rao MS. A common neural progenitor for the CNS and PNS. Dev Biol 1998;200:1–15.[CrossRef][Medline]

  54. Gajavelli S, Wood PM, Pennica D et al. BMP signaling initiates a neural crest differentiation program in embryonic rat CNS stem cells. Exp Neurol 2004;188:205–223.[CrossRef][Medline]

  55. Alexanian AR, Sieber-Blum M. Differentiating adult hippocampal stem cells into neural crest derivatives. Neuroscience 2003;118:1–5.[CrossRef][Medline]

  56. Sailer MH, Hazel TG, Panchision DM et al. BMP2 and FGF2 cooperate to induce neural-crest-like fates from fetal and adult CNS stem cells. J Cell Sci 2005;118:5849–5860.[Abstract/Free Full Text]

  57. Mehler MF, Mabie PC, Zhu G et al. Developmental changes in progenitor cell responsiveness to bone morphogenetic proteins differentially modulate progressive CNS lineage fate. Dev Neurosci 2000;22:74–85.[CrossRef][Medline]

  58. Molné M, Studer L, Tabar V et al. Early cortical precursors do not undergo LIF-mediated astrocytic differentiation. J Neurosci Res 2000;59:301–311.[CrossRef][Medline]

  59. Gross RE, Mehler MF, Mabie PC et al. Bone morphogenetic proteins promote astroglial lineage commitment by mammalian subventricular zone progenitor cells. Neuron 1996;17:595–606.[CrossRef][Medline]

  60. Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 1992;69:915–926.[CrossRef][Medline]

  61. Swiatek PJ, Gridley T. Perinatal lethality and defects in hindbrain development in mice homozygous for a targeted mutation of the zinc finger gene Krox20. Genes Dev 1993;7:2071–2084.[Abstract/Free Full Text]

  62. Rajan P, Panchision DM, Newell LF et al. BMPs signal alternately through a SMAD or FRAP-STAT pathway to regulate fate choice in CNS stem cells. J Cell Biol 2003;161:911–921.[Abstract/Free Full Text]

  63. Rathjen J, Haines BP, Hudson KM et al. Directed differentiation of pluripotent cells to neural lineages: Homogeneous formation and differentiation of a neurectoderm population. Development 2002;129:2649–2661.[Abstract/Free Full Text]

  64. Robertson J, Doroudchi MM, Nguyen MD et al. A neurotoxic peripherin splice variant in a mouse model of ALS. J Cell Biol 2003;160:939–949.[Abstract/Free Full Text]

  65. Baloh RH, Tansey MG, Golden JP et al. TrnR2, a novel receptor that mediates neurturin and GDNF signaling through Ret. Neuron 1997;18:793–802.[CrossRef][Medline]

  66. Yang AH, Chen JY, Lin JK. Myofibroblastic conversion of mesothelial cells. Kidney Int 2003;63:1530–1539.[CrossRef][Medline]

  67. Brüstle O, Spiro AC, Karram K et al. In vitro-generated neural precursors participate in mammalian brain development. Proc Natl Acad Sci U S A 1997;94:14809–14814.[Abstract/Free Full Text]

  68. Kalcheim C, Burstyn-Cohen T. Early stages of neural crest ontogeny: Formation and regulation of cell delamination. Int J Dev Biol 2005;49:105–116.[CrossRef][Medline]

  69. Opdecamp K, Nakayama A, Nguyen MT et al. Melanocyte development in vivo and in neural crest cell cultures: Crucial dependence on the Mitf basic-helix-loop-helix-zipper transcription factor. Development 1997;124:2377–2386.[Abstract]

  70. Miles GB, Yohn DC, Wichterle H et al. Functional properties of motoneurons derived from mouse embryonic stem cells. J Neurosci 2004;24:7848–7858.[Abstract/Free Full Text]

  71. Brehmer A, Croner R, Dimmler A et al. Immunohistochemical characterization of putative primary afferent (sensory) myenteric neurons in human small intestine. Auton Neurosci 2004;112:49–59.[CrossRef][Medline]

  72. Furness JB, Jones C, Nurgali K et al. Intrinsic primary afferent neurons and nerve circuits within the intestine. Prog Neurobiol 2004;72:143–164.[CrossRef][Medline]

  73. Brown EJ, Beal PA, Keith CT et al. Control of p70 s6 kinase by kinase activity of FRAP in vivo. Nature 1995;377:441–446.[CrossRef][Medline]

  74. Bonni A, Sun Y, Nadal-Vicens M et al. Regulation of gliogenesis in the central nervous system by the JAK-STAT signaling pathway. Science 1997;278:477–483.[Abstract/Free Full Text]

  75. Chen S, Kulik M, Lechleider RJ. Smad proteins regulate transcriptional induction of the SM22alpha gene by TGF-beta. Nucleic Acids Res 2003;31:1302–1310.[Abstract/Free Full Text]

  76. Stockwell BR, Schreiber SL. TGF-beta-signaling with small molecule FKBP12 antagonists that bind myristoylated FKBP12-TGF-beta type I receptor fusion proteins. Chem Biol 1998;5:385–395.[CrossRef][Medline]

  77. Wang T, Li BY, Danielson PD et al. The immunophilin FKBP12 functions as a common inhibitor of the TGF beta family type I receptors. Cell 1996;86:435–444.[CrossRef][Medline]

  78. Chen YG, Liu F, Massague J. Mechanism of TGFbeta receptor inhibition by FKBP12. EMBO J 1997;16:3866–3876.[CrossRef][Medline]

  79. Hamilton GS, Steiner JP. Immunophilins: Beyond immunosuppression. J Med Chem 1998;41:5119–5143.[CrossRef][Medline]

  80. Choi J, Chen J, Schreiber SL et al. Structure of the FKBP12-rapamycin complex interacting with the binding domain of human FRAP. Science 1996;273:239–242.[Abstract]

  81. Siekierka JJ, Wiederrecht G, Greulich H et al. The cytosolic-binding protein for the immunosuppressant FK-506 is both a ubiquitous and highly conserved peptidyl-prolyl cis-trans isomerase. J Biol Chem 1990;265:21011–21015.[Abstract/Free Full Text]

  82. Vilella-Bach M, Nuzzi P, Fang Y et al. The FKBP12-rapamycin-binding domain is required for FKBP12-rapamycin-associated protein kinase activity and G1 progression. J Biol Chem 1999;274:4266–4272.[Abstract/Free Full Text]

  83. Gingras AC, Raught B, Sonenberg N. Regulation of translation initiation by FRAP/mTOR. Genes Dev 2001;15:807–826.[Free Full Text]

  84. Yokogami K, Wakisaka S, Avruch J et al. Serine phosphorylation and maximal activation of STAT3 during CNTF signaling is mediated by the rapamycin target mTOR. Curr Biol 2000;10:47–50.[CrossRef][Medline]

  85. Mizuseki K, Sakamoto T, Watanabe K et al. Generation of neural crest-derived peripheral neurons and floor plate cells from mouse and primate embryonic stem cells. Proc Natl Acad Sci U S A 2003;100:5828–5833.[Abstract/Free Full Text]

  86. Motohashi T, Aoki H, Chiba K et al. Multipotent cell fate of neural crest-like cells derived from embryonic stem cells. STEM CELLS 2007;25:402–410.[Abstract/Free Full Text]

  87. Finley MF, Devata S, Huettner JE. BMP-4 inhibits neural differentiation of murine embryonic stem cells. J Neurobiol 1999;40:271–287.[CrossRef][Medline]

  88. Furuta Y, Piston DW, Hogan BL. Bone morphogenetic proteins (BMPs) as regulators of dorsal forebrain development. Development 1997;124:2203–2212.[Abstract]

  89. Knecht AK, Bronner-Fraser M. Induction of the neural crest: A multigene process. Nat Rev Genet 2002;3:453–461.[CrossRef][Medline]

  90. LaBonne C, Bronner-Fraser M. Molecular mechanisms of neural crest formation. Annu Rev Cell Dev Biol 1999;15:81–112.[CrossRef][Medline]

  91. Glavic A, Silva F, Aybar MJ et al. Interplay between Notch signaling and the homeoprotein Xiro1 is required for neural crest induction in Xenopus embryos. Development 2004;131:347–359.[Abstract/Free Full Text]

  92. Liem KF Jr, Tremml G, Jessell TM. A role for the roof plate and its resident TGFbeta-related proteins in neuronal patterning in the dorsal spinal cord. Cell 1997;91:127–138.[CrossRef][Medline]

  93. Barth KA, Kishimoto Y, Rohr KB et al. Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development 1999;126:4977–4987.[Abstract]

  94. Sela-Donenfeld D, Kalcheim C. Regulation of the onset of neural crest migration by coordinated activity of BMP4 and Noggin in the dorsal neural tube. Development 1999;126:4749–4762.[Abstract]

  95. Shah NM, Groves AK, Anderson DJ. Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 1996;85:331–343.[CrossRef][Medline]

  96. Haubst N, Berger J, Radjendirane V et al. Molecular dissection of Pax6 function: The specific roles of the paired domain and homeodomain in brain development. Development 2004;131:6131–6140.[Abstract/Free Full Text]

  97. Pituello F, Yamada G, Gruss P. Activin A inhibits Pax-6 expression and perturbs cell differentiation in the developing spinal cord in vitro. Proc Natl Acad Sci U S A 1995;92:6952–6956.[Abstract/Free Full Text]

  98. Stoykova A, Treichel D, Hallonet M et al. Pax6 modulates the dorsoventral patterning of the mammalian telencephalon. J Neurosci 2000;20:8042–8050.[Abstract/Free Full Text]

  99. Briscoe J, Sussel L, Serup P et al. Homeobox gene Nkx2.2 and specification of neuronal identity by graded Sonic hedgehog signalling. Nature 1999;398:622–627.[CrossRef][Medline]

  100. Hornbruch A, Ma G, Ballermann MA et al. A BMP-mediated transcriptional cascade involving Cash1 and Tlx-3 specifies first-order relay sensory neurons in the developing hindbrain. Mech Dev 2005;122:900–913.[CrossRef][Medline]

  101. Guha U, Gomes WA, Samanta J et al. Target-derived BMP signaling limits sensory neuron number and the extent of peripheral innervation in vivo. Development 2004;131:1175–1186.[Abstract/Free Full Text]

  102. Gambaro K, Aberdam E, Virolle T et al. BMP-4 induces a Smad-dependent apoptotic cell death of mouse embryonic stem cell-derived neural precursors. Cell Death Differ 2006;13:1075–1087.[CrossRef][Medline]

  103. Gomes WA, Mehler MF, Kessler JA. Transgenic overexpression of BMP4 increases astroglial and decreases oligodendroglial lineage commitment. Dev Biol 2003;255:164–177.[CrossRef][Medline]

  104. Mabie PC, Mehler MF, Marmur R et al. Bone morphogenetic proteins induce astroglial differentiation of oligodendroglial-astroglial progenitor cells. J Neurosci 1997;17:4112–4120.[Abstract/Free Full Text]

  105. Mekki-Dauriac S, Agius E, Kan P et al. Bone morphogenetic proteins negatively control oligodendrocyte precursor specification in the chick spinal cord. Development 2002;129:5117–5130.[Medline]

  106. Fedele DE, Koch P, Scheurer L et al. Engineering embryonic stem cell derived glia for adenosine delivery. Neurosci Lett 2004;370:160–165.[CrossRef][Medline]

  107. Gerrard L, Rodgers L, Cui W. Differentiation of human embryonic stem cells to neural lineages in adherent culture by blocking bone morphogenetic protein signaling. STEM CELLS 2005;23:1234–1241.[Abstract/Free Full Text]

  108. Okada Y, Shimazaki T, Sobue G et al. Retinoic-acid-concentration-dependent acquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells. Dev Biol 2004;275:124–142.[CrossRef][Medline]

  109. Rohwedel J, Guan K, Zuschratter W et al. Loss of beta1 integrin function results in a retardation of myogenic, but an acceleration of neuronal, differentiation of embryonic stem cells in vitro. Dev Biol 1998;201:167–184.[CrossRef][Medline]

  110. Wang L, Cerdan C, Menendez P et al. Derivation and characterization of hematopoietic cells from human embryonic stem cells. Methods Mol Biol 2006;331:179–200.[Medline]

  111. Qi X, Li TG, Hao J et al. BMP4 supports self-renewal of embryonic stem cells by inhibiting mitogen-activated protein kinase pathways. Proc Natl Acad Sci U S A 2004;101:6027–6032.[Abstract/Free Full Text]

  112. Wiles MV, Johansson BM. Embryonic stem cell development in a chemically defined medium. Exp Cell Res 1999;247:241–248.[CrossRef][Medline]

  113. Taha MF, Valojerdi MR, Mowla SJ. Effect of bone morphogenetic protein-4 (BMP-4) on adipocyte differentiation from mouse embryonic stem cells. Anat Histol Embryol 2006;35:271–278.[CrossRef][Medline]

  114. Winnier G, Blessing M, Labosky PA et al. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev 1995;9:2105–2116.[Abstract/Free Full Text]

  115. Kawaguchi J, Mee PJ, Smith AG. Osteogenic and chondrogenic differentiation of embryonic stem cells in response to specific growth factors. Bone 2005;36:758–769.[Medline]

  116. Kramer J, Hegert C, Guan K et al. Embryonic stem cell-derived chondrogenic differentiation in vitro: Activation by BMP-2 and BMP-4. Mech Dev 2000;92:193–205.[CrossRef][Medline]

  117. Pera MF, Andrade J, Houssami S et al. Regulation of human embryonic stem cell differentiation by BMP-2 and its antagonist noggin. J Cell Sci 2004;117:1269–1280.[Abstract/Free Full Text]

  118. Pomp O, Brokhman I, Ben-Dor I et al. Generation of peripheral sensory and sympathetic neurons and neural crest cells from human embryonic stem cells. STEM CELLS 2005;23:923–930.[Abstract/Free Full Text]

  119. Lazzari G, Colleoni S, Giannelli SG et al. Direct derivation of neural rosettes from cloned bovine blastocysts: A model of early neurulation events and neural crest specification in vitro. STEM CELLS 2006;24:2514–2521.[Abstract/Free Full Text]

  120. Kalcheim C, Le Douarin NM. Requirement of a neural tube signal for the differentiation of neural crest cells into dorsal root ganglia. Dev Biol 1986;116:451–466.[CrossRef][Medline]

  121. Chalazonitis A, D'Autreaux F, Guha U et al. Bone morphogenetic protein-2 and -4 limit the number of enteric neurons but promote development of a TrkC-expressing neurotrophin-3-dependent subset. J Neurosci 2004;24:4266–4282.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
S. Takei, H. Ichikawa, K. Johkura, A. Mogi, H. No, S. Yoshie, D. Tomotsune, and K. Sasaki
Bone morphogenetic protein-4 promotes induction of cardiomyocytes from human embryonic stem cells in serum-based embryoid body development
Am J Physiol Heart Circ Physiol, June 1, 2009; 296(6): H1793 - H1803.
[Abstract] [Full Text] [PDF]

Home page
 J. Neurosci.Home page
J. H. Reyes, K. S. O'Shea, N. L. Wys, J. M. Velkey, D. M. Prieskorn, K. Wesolowski, J. M. Miller, and R. A. Altschuler
Glutamatergic Neuronal Differentiation of Mouse Embryonic Stem Cells after Transient Expression of Neurogenin 1 and Treatment with BDNF and GDNF: In Vitro and In Vivo Studies
J. Neurosci., November 26, 2008; 28(48): 12622 - 12631.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2006-0299v1
25/4/939    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gossrau, G.
Right arrow Articles by Brüstle, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gossrau, G.
Right arrow Articles by Brüstle, O.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST CME ALPHAMED PRESS JOURNALS