First published online April 19, 2007
Stem Cells
Vol. 25 No.
6
June 2007, pp.
1595
-1601
doi:10.1634/stemcells.2006-0234; www.StemCells.com
© 2007 AlphaMed Press
TRANSLATIONAL AND CLINICAL RESEARCH |
Prevention of Graft-Versus-Host Disease by Intra-Bone Marrow Injection of Donor T Cells
Junichi Fukuia,b,
Muneo Inabaa,c,
Yusuke Uedaa,d,
Takashi Miyakea,b,
Naoki Hosakaa,c,
A-Hon Kwonb,
Yutaku Sakaguchia,e,
Masanobu Tsudaa,f,
Mariko Omaea,g,
Yasuo Kamiyamab,
Susumu Ikeharaa,c
aFirst Department of Pathology,
bDepartment of Surgery,
cRegeneration Research Center for Intractable Diseases,
dDepartment of Orthopedic Surgery,
eThird Department of Internal Medicine,
fDepartment of Emergency and Critical Care Medicine,
gDepartment of Otolaryngology, Kansai Medical University, Osaka, Japan
Key Words. Intra-bone marrow • Bone marrow transplantation • Donor lymphocyte infusion • Graft-versus-host disease • Bone marrow stromal cells • Regulatory T cells • Helper T1/helper T2 polarization
Correspondence: Susumu Ikehara, M.D., Ph.D., First Department of Pathology, Kansai Medical University, Fumizono-cho, Moriguchi City, Osaka, Japan, 570-8506. Telephone: +81-6-6992-1001 (ext. 2474 or 2475); Fax: +81-6-6992-1219; e-mail: ikehara{at}takii.kmu.ac.jp
Received on April 19, 2006;
accepted for publication on March 9, 2007.
First published online in STEM CELLS EXPRESS April 19, 2007.
 |
ABSTRACT
|
|---|
We have recently found that intra-bone marrow-bone marrow transplantation (IBM-BMT) can be used to prevent graft-versus-host disease (GvHD), even when intensive donor lymphocyte infusion (DLI) is carried out. In the present study, in conjunction with IBM-BMT, allogeneic splenic T cells as DLI were also injected into the bone marrow cavity of lethally irradiated (8.5 Gy) recipients. The extent of GvHD was compared with that of recipients that had received allogeneic IBM-BMT plus i.v. injection of allogeneic T cells (intravenous DLI [IV-DLI]). GvHD in recipients treated with allogeneic IBM-BMT plus IBM-DLI was far milder than in those treated with allogeneic IBM-BMT plus IV-DLI. This was confirmed macroscopically and histopathologically. The frequency of regulatory T cells (Tregs) detected as CD4+CD25+ and CD4+Foxp3+ cells was significantly higher in recipients treated with IBM-BMT plus IBM-DLI than in those treated with IBM-BMT plus IV-DLI. Donor-derived helper T (Th) cells polarized to Th2 type in recipients treated with IBM-BMT plus IBM-DLI, whereas Th1 cells were dominant in recipients treated with IBM-BMT plus IV-DLI. Furthermore, the production of transforming growth factor-β and hepatocyte growth factor from bone marrow stromal cells was enhanced after IBM-DLI. Thus, IBM-BMT plus IBM-DLI seem to preferentially induce Tregs and Th2, resulting in the prevention of GvHD.
Disclosure of potential conflicts of interest is found at the end of this article.
 |
INTRODUCTION
|
|---|
Bone marrow transplantation (BMT) is a powerful strategy for the treatment of congenital immunodeficiency, hematological disorders, and metabolic disorders [1]. In view of the restricted number of donor candidates, a new method for allogeneic BMT has been long awaited. However, there are several problems to be resolved in allogeneic BMT. One of the important subjects is how to control graft-versus-host responses (GvHR) or to reduce/prevent graft-versus-host diseases (GvHD). It is well known that GvHR can facilitate donor cell engraftment through the elimination of residual T cells (of host origin) that recognize donor major histocompatibility complex (MHC). Furthermore, allogeneic BMT can induce graft-versus-leukemia effects in patients with hemopoietic malignancies, including leukemia, lymphoma, and multiple myeloma [2–5]. Therefore, the control or regulation of GvHR is a key element in the success of donor cell engraftment after BMT.
We have recently found that the injection of donor bone marrow cells (BMCs) directly into the bone marrow cavity (intra-bone marrow [IBM]-BMT) induces persistent donor-specific tolerance in mice even if the radiation doses are reduced to sublethal levels [6]. IBM-BMT also enhances the rapid recovery or reconstitution of the hematolymphoid system (including bone marrow stromal cells [BMSCs]) of donor origin, resulting in the complete amelioration of autoimmune diseases in MRL/lpr mice, in which conventional intravenous BMT (IV-BMT) had been unsuccessful. In addition, we have found that normal mice treated with "a lethal dose (9 Gy) + IBM-BMT + donor lymphocyte infusion (DLI)" survive significantly longer than mice treated with "9 Gy + IV-BMT + DLI"; mice treated with "sublethal doses (6 or 6.5 Gy) + IBM-BMT + DLI" show a 100% survival rate [7]. To prolong the survival rate of mice treated with "lethal doses + IBM-BMT + DLI," we attempted to inject allogeneic T cells as DLI into the bone marrow cavity (IBM-DLI) in lethally irradiated (8.5 Gy) mice. In the present study, we show that 100% of mice treated with 8.5 Gy + IBM-BMT + IBM-DLI (but not intravenous DLI [IV-DLI]) can survive >100 days after the treatment without showing GvHD. Furthermore, we show that BMSCs might be involved in the prevention of GvHD via the production of transforming growth factor-β (TGF-β) or hepatocyte growth factor (HGF).
 |
MATERIALS AND METHODS
|
|---|
Mice
C57BL/6 (B6, H-2b), BALB/c (H-2d), and green fluorescent protein (GFP) (B6 background, H-2b) mice were purchased from Japan SLC Inc. (Hamamatsu, Japan, http://www.jslc.co.jp). C57BL/6 mice at the age of 7–9 weeks were used as recipients, and BALB/c mice at the age of 7–9 weeks were used as donors.
Irradiation
C57BL/6 mice were irradiated at 8.5 Gy (1.0 Gy/minute) from a 137Cs source (Gammacell 40 Exactor; MDS Nordion, Ottawa, http://www.mds.nordion.com) 1 day before the BMT.
BMT and Donor Lymphocyte Infusion
BMCs were flushed from the femoral and tibial bones of the BALB/c mice and then suspended in RPMI 1640. The BMCs were then filtered through a 70-mm nylon mesh (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com), washed, and adjusted to 1.5 x 109 cells per milliliter in RPMI 1640.
The BMCs, thus prepared, were injected directly into the bone marrow cavity as described previously [6]. Briefly, the region from the inguen to the knee joint was shaved, and a 5-mm incision was made on the thigh. The knee was flexed to 90 degrees, and the proximal side of the tibia was drawn to the anterior. A 26-gauge needle was inserted into the joint surface of the tibia through the patellar tendon and then inserted into the bone marrow cavity. Using a microsyringe (50 µl; Hamilton Co., Reno, NV, http://www.hamiltoncompany.com) containing the donor BMCs (1.5 x 109 cells per milliliter), the donor BMCs were injected from the bone holes into the bone marrow cavity of the left tibia (107 cells per 7 microliters per tibia). In some groups, BMCs were injected intravenously.
T cells were purified from the spleens by positive selection by a magnetic cell sorting system using CD4 and CD8
microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany, http://www.miltenyibiotec.com) after depletion of red blood cells (RBCs) or by an EPICS ALTRA flow cytometer (Beckman Coulter, Fullerton, CA, http://www.beckmancoulter.com) after staining with fluorescein isothiocyanate (FITC)- or phycoerythrin (PE)-conjugated anti-CD4/CD8 monoclonal antibodies (mAbs) (BD Pharmingen, San Diego, http://www.bdbiosciences.com/index_us.shtml). Non-T cells were obtained from the spleens using Dynabeads (Dynal Biotech, Oslo, Norway, http://www.invitrogen.com/dynal) after the treatment with anti-CD4/CD8 mAbs. Splenic T cells were injected into the bone marrow cavity of the right tibia (107 cells per 7 microliters per tibia: intra-bone marrow T-cell injection as DLI; IBM-DLI) or injected intravenously (IV-DLI; 107 cells per 0.5 milliliter) into the recipient mice along with the IBM-BMT. Non-T cells were also injected into the bone marrow cavity as a negative control.
In some experiments, to examine whether T cells injected into the bone marrow cavity (IBM-DLI) are trapped or die in the bone marrow cavity, BALB/c mice were irradiated, and BMCs from B6 donors were injected into the bone marrow cavity of the left tibia (IBM-BMT). Splenic T cells from GFP mice (B6 background) were injected into the right tibia (107 cells per 7 microliters per tibia: IBM-DLI) or injected intravenously (107 cells per 0.5 milliliter: IV-DLI) into the recipient mice along with the IBM-BMT. Three days after the injection, GFP+ cells in the spleen of recipients were flow cytometrically analyzed.
Flow Cytometrical Analyses of Surface Marker Antigens and Intracellular Cytokines
Peripheral blood was collected from the tail vein and stained with FITC-conjugated anti-H-2Kb and PE-conjugated anti-H-2Kd Ab (BD Pharmingen) to differentiate between the donor- and recipient-derived cells after the lysis of RBCs by a BD Pharm Lyse (BD Pharmingen). Furthermore, spleen cells and BMCs were prepared from the recipient mice, and the cell surface phenotypes were analyzed by FITC- or PE-conjugated mAbs against CD45R, CD4, CD8, CD11b, and Gr-1. In some experiments, the cells were stained with anti-CD4 and anti-CD25 mAbs (BD Pharmingen) or anti-CD4 and anti-Foxp3 mAbs to detect regulatory T cells (Tregs). In the case of staining with anti-Foxp3 mAb, cells were stained with FITC-antiCD4 mAb and then fixed and permeabilized with Cytofix/Cytoperm solution (BD Pharmingen). The cells thus treated were intracytoplasmically stained with PE-anti-Foxp3 mAb (eBioscience Inc., San Diego, http://www.ebioscience.com). Furthermore, after staining the spleen cells with FITC-anti-CD4 mAb, intracellular cytokines (tumor necrosis factor [TNF]-
; interferon [IFN]-
; interleukin [IL]-2, IL-4, IL-10) were detected using an Intracellular Cytokine Staining Kit (BD Pharmingen). The stained cells were analyzed by a FACScan (Becton, Dickinson).
Preparation of BMSCs
BMCs from the right tibia, into which T cells had been injected as DLI, were collected from the recipients 3 days after the treatment and cultured in Dulbecco's modified Eagle's medium with 10% fetal calf serum. Two days later, nonadherent cells were removed. Adherent cells were detached using trypsin-EDTA and passaged when 80% confluence was reached and then replated. After 2 weeks, the cultures were discontinued, and BMSCs were harvested and used for further experiments. The BMSCs, thus prepared, were negative for CD45 and CD34 but positive for CD90 and CD106 after staining with FITC- or PE-conjugated mABs. The culture-expanded BMSCs from the recipients of IBM-BMT + IBM-DLI, IBM-BMT + IV-DLI, or IBM-BMT alone (without DLI) were used for real-time reverse transcription-polymerase chain reaction (RT-PCR) assay.
Real-Time RT-PCR Assay
Cytokine messages of BMSCs were determined by real-time RT-PCR. We prepared two pairs of primers for TGF-β (forward: TTTCGATTCAGCGCTCACTGCTCTTGTGAC, reverse: ATGTTGGACAACTGCTCCACCTTGGGCTTGC) and HGF (forward: AAGAGTGGCATCAAGTGCCAG, reverse: CTGGATTGCTTGTGAAACACC) (Nisshinbo, Tokyo, http://www.nisshinbo.co.jp/english). Real-time RT-PCR was conducted on a DNA Engine Opticon 2 system (MJ Japan Ltd., Tokyo, http://www.labtrade.com/mjr) by using SYBR Green I as a double-stranded DNA-specific binding dye and continuous fluorescence monitoring. The cycling conditions consisted of a denaturation step for 10 minutes at 95°C, 40 cycles of denaturation (94°C for 15 seconds), annealing (60°C for 30 seconds), and extension (72°C for 30 seconds). After amplification, melting curve analysis was performed with denaturation at 95°C then continuous fluorescence measurement from 65°C to 95°C at 0.1°C/second. All reactions were run in duplicate, at least, and included control wells without cDNA.
Assessment of GvHD
To examine GvHD, the body weight of the recipients was measured every other day, and the recipients were also assessed once per week on the clinical findings listed in Table 1. Furthermore, to histopathologically determine GvHD, the liver, spleen, intestine, and skin were removed and fixed in 10% formalin and embedded in paraffin according to standard procedures. Sections were stained with hematoxylin and eosin or Masson-trichrome and examined by the pathologist (N.H.). Scorings of the histopathological changes in the liver and spleen are according to the pathological findings listed in Table 2.
Statistical Analyses
Statistical analyses were performed using Student's t test and log-rank (Mantel-Cox) test.
 |
RESULTS
|
|---|
Survival Rates and Body Weight of Mice Treated with Various Conditioning Regimens
As shown in Figure 1, 8.5 Gy-irradiated mice treated with IBM-BMT alone showed a 100% survival rate, although mice treated with IBM-BMT + IV-DLI died of acute GvHD by 78 days after the treatment. Surprisingly, mice treated with IV-BMT + IBM-DLI showed a 100% survival rate until 100 days after the treatment (Fig. 1A). Furthermore, decreases in body weight due to GvHD were observed in mice treated with IBM-BMT + IV-DLI; after day 20, the body weight of thus-treated recipients gradually decreased (Fig. 1B). In contrast, in mice treated with IBM-BMT + IBM-DLI, body weight gradually increased and reached the normal level on day 14. It should be noted that decreases in the body weight (due to GvHD) of mice treated with IV-BMT + IBM-DLI were not as striking as in mice treated with IV-BMT + IV-DLI. When non-T-cells were injected into the bone marrow cavity with IBM-BMT (data not shown), the recipients showed a 100% survival rate until 100 days, as observed in control recipients treated with IBM-BMT or IV-BMT alone.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 1. Survival rates and changes in body weight of recipients treated with IBM-BMT + IBM-DLI. (A): B6 mice were irradiated with 8.5 Gy 1 day before BMT. Bone marrow cells (BMCs) (1 x 107) from BALB/c mice were injected into the bone cavity (IBM-BMT alone; ) or intravenously (IV-BMT alone; ). The recipients were further injected with splenic T cells (1 x 107) from BALB/c mice to induce graft-versus-host disease via the bone cavity (IBM-BMT + IBM-DLI; ) or the tail vein (IBM-BMT + IV-DLI; ). The recipients that had been intravenously injected with BMCs were further prepared, and splenic T cells were injected via the bone cavity (IV-BMT + IBM-DLI; ) or the tail vein (IV-BMT + IV-DLI; ). Statistical analyses were carried out by the log-rank (Mantel-Cox) test (*, p < .01, IBM-BMT + IBM-DLI vs. IBM-BMT + IV-DLI; **, p < .05, IV-BMT + IV-DLI vs. IBM-BMT + IV-DLI). (B): B6 mice were irradiated and transplanted with BALB/c BMCs plus splenic T cells, and body weights were measured every 2 days after BMT. Symbols in the figure represent the mean of five mice (*, p < .01, IBM-BMT + IBM-DLI vs. IBM-BMT + IV-DLI; **, p < .05, IV-BMT + IV-DLI vs. IBM-BMT + IV-DLI). The results are representative of two replicate experiments. Abbreviations: BMT, bone marrow transplantation; DLI, donor lymphocyte infusion; IBM, intra-bone marrow; IV, intravenous.
|
|
Macroscopical and Microscopical Findings of GvHD
GvHD was assessed by not only the loss of body weight but also macroscopical (items examined are included in Table 1) and histopathologic findings (scoring of histologic changes as indices of tissue injury; items examined are listed in Table 2). As shown in Figure 2, the clinical GvHD score of recipients treated with IBM-BMT + IV-DLI was significantly higher (4.8 ± 2.05) than that of recipients treated with IBM-BMT + IBM-DLI or IBM-BMT alone (no clinical signs of GvHD) on day 35.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 2. Macroscopical findings after induction of GvHD. Items listed in Table 1 were macroscopically examined once per week in the recipients treated with IBM-BMT + IBM-DLI or IV-DLI, and GvHD was determined using clinical GvHD scores. The representative results at 35 days (all the mice used in the experiments were alive at 35 days, and thereafter some recipients died by GvHD) are shown in this figure. Columns and bars in the figure represent the mean ± SD of five mice. The results are representative of two replicate experiments. Abbreviations: BMT, bone marrow transplantation; DLI, donor lymphocyte infusion; GvHD, graft-versus-host disease; IBM, intra-bone marrow; IV, intravenous.
|
|
Tissue injury scores (listed in Table 2) were next examined. As shown in Figure 3, although the infiltration of lymphocytes in the Glisson's sheath and the destruction or dysplasia of bile duct epithelia were observed both in recipients treated with IBM-BMT + IBM-DLI or IBM-BMT + IV-DLI (Fig. 3A, 3B), the tissue injury observed in the latter (Fig. 3B) was more severe than that in the former (Fig. 3A). The atrophy of the white pulp and the appearance of epithelioid cells were clearly observed in recipients treated with IBM-BMT + IV-DLI (Fig. 3H) when compared with that in recipients treated with IBM-BMT + IBM-DLI (Fig. 3G). It should be noted that no tissue injury was observed in the recipients treated with IBM-BMT alone, as shown in Figure 3C, 3F, and 3I. The appearance of single cell necrosis in the skin and intestine, or the appearance of crypt dropout in the intestine, were not observed in any of the recipient mice. Tissue injury scores are summarized in Figure 3J and 3K; as seen in the clinical GvHD scores, the tissue injury scores of the liver (Fig. 3J) and spleen (Fig. 3K) were significantly higher in recipients treated with IBM-BMT + IV-DLI at 14 and 21 days than in recipients treated with IBM-BMT + IBM-DLI. It is noted that recipients treated with IBM-BMT alone or those with IBM-BMT plus IBM injection of non-T-cells showed no signs of GvHD when macroscopically and histopathologically examined (data not shown). No significant pathological changes were observed in the intestine or skin of the recipients.

View larger version (91K):
[in this window]
[in a new window]
|
Figure 3. Histopathological findings and tissue injury scores of recipient mice after induction of graft-versus-host disease (GvHD). Items listed in Table 2 were microscopically examined at 7, 14, and 21 days in the recipients treated with IBM-BMT + IBM-DLI or IV-DLI, and GvHD was determined using tissue injury scores. The figures represent findings at 21 days. (A–C): The specimens of liver were stained with HE. (D–F): Spleen specimens stained with HE. (G–I): Spleen specimens stained with MT. Original magnification x200 for all panels. (J, K): Tissue injury scores are summarized in (J) (liver) and (K) (spleen), and columns and bars in the figures represent the mean ± SD of five mice. Statistical analyses were carried out by Student's t test. (*, p < .05). The results are representative of two replicate experiments. Abbreviations: BMT, bone marrow transplantation; DLI, donor lymphocyte infusion; HE, hematoxylin and eosin; IBM, intra-bone marrow; IV, intravenous; MT, Masson-trichrome.
|
|
Mechanisms Underlying Prevention of GvHD by IBM-BMT + IBM-DLI
Both the numbers and frequency of T cells detected in the periphery (spleen) of the recipients treated with IBM-BMT + IBM-DLI were similar to those in the recipients treated with IBM-BMT + IV-DLI examined using T cells from GFP mice as shown in supplemental online Table 1. This indicates that T cells injected into the bone marrow cavity survive and migrate to the periphery. Therefore, the cells injected into the bone marrow cavity (IBM-DLI) are not trapped or killed by "some artifacts" (like hematoma). Thus, the cells that contribute to the prevention or reduction of GvHD were next analyzed. It is noted that, after IBM-BMT + IBM-DLI or IV-DLI, hematolymphoid cells in the recipients were completely reconstituted with those of donor origin when flow cytometrically analyzed after staining with mAbs against CD45R, CD4, CD8, CD11b, and Gr-1 plus anti-H-2d mAb (donor type H-2); >98% of CD4 and CD8 T cells showed donor type H-2d (data not shown). As shown in Figure 4, the frequency of Tregs, detected as CD4+Foxp3+ cells, in the spleen of recipients treated with IBM-BMT + IBM-DLI was significantly higher than that in the recipients treated with IBM-BMT + IV-DLI at 7, 14, and 21 days after the treatment. Conversely, the frequency of CD4+Foxp3+ cells in the recipients treated with IBM-BMT + IV-DLI was significantly lower than in those treated with IBM-BMT alone (without DLI). Furthermore, the frequency of CD4+CD25+ cells in the peripheral blood of the recipients treated with IBM-BMT + IBM-DLI was also significantly higher than that in the recipients treated with IBM-BMT + IV-DLI at 14 and 21 days after the treatment (data not shown).

View larger version (30K):
[in this window]
[in a new window]
|
Figure 4. Analysis of regulatory T cells. Recipient mice were treated with IBM-BMT + IBM-DLI or IBM-BMT + IV-DLI, and 7, 14, and 21 days after the treatment, spleen cells in recipient mice were stained with fluorescein isothiocyanate-anti-CD4 monoclonal antibody (mAb) and then fixed and permeabilized with Cytofix/Cytoperm solution. The spleen cells thus treated were intracytoplasmically stained with phycoerythrin-anti-Foxp3 mAb to measure CD4+Foxp3+ cells. Columns and bars in the figures represent the mean % ± SD of 10 mice. Statistical analyses were carried out using the Student's t test. (*, p < .05). Abbreviations: BMT, bone marrow transplantation; DLI, donor lymphocyte infusion; IBM, intra-bone marrow; IV, intravenous.
|
|
Furthermore, the frequency of IL-4-producing (Fig. 5A) and also IL-10-producing cells (Fig. 5C) was significantly higher in recipients treated with IBM-BMT + IBM-DLI than in those treated with IBM-BMT + IV-DLI. Conversely, the percentage of IL-2-producing helper T (Th)1 cells was lower in recipients treated with IBM-BMT + IBM-DLI than in those treated with IBM-BMT + IV-DLI (Fig. 5B). In IFN-
- and TNF-
-producing cells, no significant differences were observed in recipients treated with IBM-BMT + IBM-DLI or IV-DLI (data not shown). Thus, the polarization of Th2 response is dominant in recipients treated with IBM-DLI, whereas the polarization of Th1 response is dominant in recipients treated with IV-DLI. An increase in the frequency of IL-10-producing cells in the recipients treated with IBM-BMT + IBM-DLI indicates the inhibition of GvHD through the production of the immunosuppressive cytokine IL-10.

View larger version (35K):
[in this window]
[in a new window]
|
Figure 5. Analysis of IL-2-, IL-4-, and IL-10-producing cells of recipient mice after IBM-BMT + IBM-DLI. (A–C): Recipient mice were treated with IBM-BMT + IBM-DLI or IV-DLI, and 7, 14, and 21 days after the treatment, spleen cells were removed and stained with fluorescein isothiocyanate-anti-CD4 monoclonal antibody (mAb). The cells were then intracytoplasmically stained with phycoerythrin-anti-IL-2, IL-4, or IL-10 mAbs to measure IL-2-, IL-4-, or IL-10-producing cells. Columns and bars in the figures represent the mean % ± SD of 10 mice. Statistical analyses were carried out using the Student's t test (*, p < .05). Abbreviations: BMT, bone marrow transplantation; DLI, donor lymphocyte infusion; IBM, intra-bone marrow; IL, interleukin; IV, intravenous.
|
|
Involvement of BMSCs in Inhibition of GvHD
It has been reported that BMSCs inhibit T-cell proliferation or activation through the production of soluble factors such as TGF-β and HGF [8]. Thus, we next measured the level of TGF-β or HGF in BMSCs to examine, using quantitative real-time RT-PCR, whether the production of these immunosuppressive factors is enhanced after IBM-DLI. As shown in Figure 6A (HGF) and 6B (TGF-β), the relative intensities of HGF and TGF-β were significantly higher in the BMSCs from the recipients of IBM-BMT + IBM-DLI than those from the recipients of IBM-BMT + IV-DLI or IBM-BMT alone (without DLI). Therefore, T cells directly injected into the bone marrow cavity can induce the production of suppressive cytokines from BMSCs, and BMSCs might exert their inhibitory effect on T-cell activation or proliferation via HGF and/or TGF-β.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6. Analyses of cytokine messages. Total RNA extracted from the bone marrow stromal cells (originally from the right tibia, into which T cells had been injected as DLI) was collected from the recipients 3 days after the treatment. After DNase I treatment, cDNA was synthesized, amplified using HGF or TGF-β primer, and visualized with SYBR Green by real-time reverse transcription-polymerase chain reaction. Relative intensity of HGF (A) or TGF-β (B) mRNA was calculated on the basis of glyceraldehyde-3-phosphate dehydrogenase intensity. Data are shown as mean ± SD of four mice. Statistical analyses were carried out using the Student's t test (*, p < .05). Abbreviations: BMT, bone marrow transplantation; DLI, donor lymphocyte infusion; HGF, hepatocyte growth factor; IBM, intra-bone marrow; IV, intravenous; TGF, transforming growth factor.
|
|
 |
DISCUSSION
|
|---|
Evidence has been accumulating that allogeneic BMT is an effective treatment not only for congenital immunodeficiency, metabolic disorders, and hematological disorders but also for autoimmune diseases [9–18]. However, acute GvHD is a major cause of morbidity and mortality in patients after allogeneic BMT [19–23]. Acute GvHD is induced by alloreactive donor T cells that recognize MHC class I and II molecules on the surface of host cells, and the infiltration of donor leukocytes (including T cells) into several target organs such as the gut, liver, and skin is thought to be a key process in the early phase of acute GvHD [24]. The activation of the donor T cells, followed by the secretion of proinflammatory cytokines, initiates the recruitment of additional inflammatory effector cells to the inflammatory sites, leading to further damage to the affected tissues [22, 25, 26]. Although the incidence and severity of acute GvHD can be dramatically improved by T-cell depletion, such a pretreatment has been shown to be associated with a higher incidence of graft failure and a higher risk of opportunistic infections, tumor relapse, and secondary lymphoproliferative diseases [27–29]. Furthermore, the potential side effects of the long-term use of immunosuppressants to reduce GvHD include the development of various infections and malignant tumors. Therefore, we have aimed to develop a new strategy for the successful engraftment of donor-derived hematolymphoid cells without developing GvHD even in the presence of T cells in the donor inoculum.
Recently, we have established a new method for BMT (IBM-BMT) that can induce persistent allogeneic donor-specific tolerance without using immunosuppressants [6]. Moreover, the recipients treated with IBM-BMT showed less GvHD than those treated with conventional IV-BMT [7]. In line with this finding, we have examined whether GvHD could be alleviated if BMCs containing T cells were inoculated into the bone marrow cavity. In allogeneic BMT for human patients, BMCs are usually collected from the donor iliac bone by aspiration, and the bone marrow fluid thus contains a large number of T cells (>20%) because of the contamination with peripheral blood cells. Therefore, to investigate the advantage of IBM-BMT over IV-BMT, we compared the severity of GvHD induced by the i.v. injection of T cells (IV-DLI) with that induced by the IBM injection of T cells (IBM-DLI).
As shown in the present paper, acute GvHD was observed in recipients treated with IBM-BMT + IV-DLI, whereas reduced GvHD was seen in those treated with IBM-BMT + IBM-DLI, as evidenced from the survival rate, changes in body weight, and macro- and microscopic findings. T cells injected into the bone marrow cavity (IBM-DLI) do not become trapped and do not die in the bone marrow but appear to migrate to the periphery when examined using GFP+ T cells (supplemental online Table 1). The mechanism(s) underlying these results cannot be fully explained, but the following two points are possibly related to our findings.
The first point is the frequency of Tregs detected as CD4+CD25+ and, more convincingly, as CD4+Foxp3+ cells. As shown in Figure 4, the numbers of CD4+Foxp3+ Tregs in the spleen of recipients treated with IBM-BMT + IBM-DLI were significantly higher than those in recipients treated with IBM-BMT + IV-DLI, and those in recipients treated with IBM-BMT + IV-DLI were significantly lower than those treated with IBM-BMT + IBM-DLI. The frequency of Tregs in the DLI population (splenic T cells) was approximately 10%. Therefore, Tregs might be maintained or might even have proliferated in the recipients treated with IBM-BMT + IBM-DLI, whereas they were somehow depleted in the recipients treated with IBM-BMT + IV-DLI. It should be noted that, at 14 and 21 days after the treatment, the frequency of Tregs in the bone marrow after the IBM-BMT + IBM-DLI, IBM-BMT + IV-DLI, or IBM-BMT alone was very low, and there was no significant difference among these three groups (data not shown). Therefore, Tregs might migrate out of the bone marrow to the peripheral lymphoid tissues and further proliferate there. Alternatively, Tregs might be newly developed from transplanted BMCs and proliferate in the peripheral lymphoid tissues of the recipients treated with IBM-BMT + IBM-DLI. It has been reported that Tregs inhibit GvHD after BMT while preserving graft versus tumor activity [30, 31]; therefore, Tregs might be applicable to the therapy for GvHD [32].
The second point related to the reduced GvHD is a decrease in the number of IL-2-producing cells and an increase in the number of IL-4-producing and IL-10-producing cells in recipients treated with IBM-BMT + IBM-DLI. It has been suggested that the Th1/Th2 polarization of T-helper-cell subsets plays an important role in the development of GvHD. In both mice and humans, there is a correlation between the production of cytokines related to the Th1 phenotype and the development of GvHD [33]; the production of Th2 cytokines (IL-4) has also been shown to be associated with inhibitory effects on the development of GvHD [34]. Furthermore, it has been reported that the transplantation of in vitro-polarized murine Th2 cells resulted in a significant increase in survival rates after BMT across minor histocompatibility antigenic barriers [35]. Thus, our results are compatible with these reports, and Tregs also could inhibit IL-2 production, as previously reported [36]. We also found an increase in IL-10-producing cells in recipients treated with IBM-BMT + IBM-DLI, suggesting that these cells, possibly including Tr1 (T regulatory type 1 cells) [37], down-modulate immune responses and prevent GvHD through the production of the immunosuppressive cytokine IL-10. The initiation and regulation of GvHR or GvHD is a complex process involving various cells or cytokines. IL-15 has been reported to be a critical mediator of T-cell functions in acute GvHD [38], and IL-18 also participates in inducing acute GvHD by enhancing cytotoxic T-cell activity [39]. Thus, kinetic changes in these "GvHD-potentiating cytokines" in recipients treated with IBM-DLI should be compared with those treated with IV-DLI.
The difference in the migratory patterns of IBM-DLI T cells and IV-DLI T cells is a possible explanation for the severity of GvHD. Although T cells injected intravenously (IV-DLI) can migrate to the lymphoid organs, IBM-DLI T cells can interact with BMSCs or mesenchymal stem cells (MSCs) in the bone marrow after the inoculation. It has very recently been reported that MSCs in the bone marrow induce T-cell unresponsiveness [8, 40, 41]. We have reported that IBM-BMT can recruit not only donor-derived hemopoietic cells but also BMSCs, including MSCs [42, 43]. Therefore, it is conceivable that BMSCs (MSCs) residing in the bone marrow can inhibit the activity of host-reactive T cells via direct cell interaction or through the cytokines, TGF-β, HGF, or IL-15, produced from BMSCs when they are injected into the bone marrow cavity. This was so when we examined the HGF and TGF-β in BMSCs. BMSCs prepared from the recipients of IBM-DLI produced significantly higher amounts of HGF and TGF-β than those prepared from the recipients of IV-DLI and IBM-BMT alone (without DLI). Thus, the prevention of GvHD observed in the recipients of IBM-BMT + IBM-DLI might be attributable to the increased production of immunosuppressive cytokines from BMSCs after the interaction of T cells and BMSCs in the bone marrow, these immunosuppressive cytokines then either directly inhibiting T-cell activation/proliferation or doing so via the activation of Tregs. The finding that TGF-β signaling is required for the in vivo expansion of Tregs supports our result [44]. However, it is surprising that the levels of HGF and TGF-β remain elevated in BMSCs that have been cultured for 2 weeks, suggesting that the effect of T cells (IBM-DLI) on BMSCs is long-lasting and thereby efficiently inhibits GvHD. Furthermore, some other cells in the bone marrow, such as veto cells or immature dendritic cells [45], could also control the severity of GvHD in the IBM-DLI recipients. Furthermore, it is important to consider the difference between IBM-DLI and IV-DLI recipients in the differentiation process from naïve T to Tregs or Th1/Th2 cells. Our findings suggest that naïve T cells can develop into Tregs, Tr, and Th2 in recipients treated with IBM-BMT + IBM-DLI whereas, in recipients treated with IBM-BMT + IV-DLI, naïve T cells preferentially differentiate into Th1 without the development of Tregs.
 |
DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST
|
|---|
The authors indicate no potential conflicts of interest.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Y. Tokuyama for expert technical assistance and Hilary Eastwick-Field and K. Ando for their help with preparation of the manuscript. This work was supported by a grant from the Haiteku Research Center of the Ministry of Education, a grant from the Millennium program of the Ministry of Education, Culture, Sports, Science and Technology, a grant from the Science Frontier program of the Ministry of Education, Culture, Sports, Science and Technology, a grant from the 21st Century Center of Excellence (COE) program of the Ministry of Education, Culture, Sports, Science and Technology, a Grant-in-Aid for scientific research (B) 11470062, Grants-in-Aid for scientific research on priority areas (A)10181225 and (A)11162221, and Health and Labour Sciences research grants (Research on Human Genome, Tissue Engineering Food Biotechnology). This work was also supported by a grant from the Department of Transplantation for Regeneration Therapy (sponsored by Otsuka Pharmaceutical Co., Ltd.), a grant from Molecular Medical Science Institute, Otsuka Pharmaceutical Co., Ltd., and a grant from Japan Immunoresearch Laboratories Co., Ltd. (JIMRO).
 |
REFERENCES
|
|---|
- Petersdorf EW, Mickelson EM, Anasetti C et al. Effect of HLA mismatches on the outcome of hematopoietic transplants. Curr Opin Immunol 1999;11:521–526.[CrossRef][Medline]
- Horowitz MM, Gale RP, Sondel PM et al. Graft-versus-leukemia reactions after bone marrow transplantation. Blood 1990;75:555–562.[Abstract/Free Full Text]
- Slavin S. New strategies for bone marrow transplantation. Curr Opin Immunol 2000;12:542–551.[CrossRef][Medline]
- van Besien KW, de Lima M, Giralt SA et al. Management of lymphoma recurrence after allogeneic transplantation: The relevance of graft-versus-lymphoma effect. Bone Marrow Transplant 1997;19:977–982.[CrossRef][Medline]
- Verdonck LF, Lokhorst HM, Dekker AW et al. Graft-versus-myeloma effect in two cases. Lancet 1996;347:800–801.[CrossRef][Medline]
- Kushida T, Inaba M, Hisha H et al. Intra-bone marrow injection of allogeneic bone marrow cells: A powerful new strategy for treatment of intractable autoimmune diseases in MRL/lpr mice. Blood 2001;97:3292–3299.[Abstract/Free Full Text]
- Nakamura K, Inaba M, Sugiura K et al. Enhancement of allogeneic hematopoietic stem cell engraftment and prevention of GVHD by intra-bone marrow bone marrow transplantation plus donor lymphocyte infusion. STEM CELLS 2004;22:125–134.[Abstract/Free Full Text]
- Di Nicola M, Carlo-Stella C, Magni M et al. Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002;99:3838–3843.[Abstract/Free Full Text]
- Thomas ED. Pros and cons of stem cell transplantation for autoimmune disease. J Rheumatol Suppl 1997;48:100–102.[Medline]
- Ikehara S, Good RA, Nakamura T et al. Rationale for bone marrow transplantation in the treatment of autoimmune diseases. Proc Natl Acad Sci U S A 1985;82:2483–2487.[Abstract/Free Full Text]
- Jacobs P, Vincent MD, Martell RW. Prolonged remission of severe refractory rheumatoid arthritis following allogeneic bone marrow transplantation for drug-induced aplastic anaemia. Bone Marrow Transplant 1986;1:237–239.[Medline]
- Lowenthal RM, Cohen ML, Atkinson K et al. Apparent cure of rheumatoid arthritis by bone marrow transplantation. J Rheumatol 1993;20:137–140.[Medline]
- Marmont AM. Immune ablation followed by allogeneic or autologous bone marrow transplantation: A new treatment for severe autoimmune diseases? STEM CELLS 1994;12:125–135.[Medline]
- Nelson JL, Torrez R, Louie FM et al. Pre-existing autoimmune disease in patients with long-term survival after allogeneic bone marrow transplantation. J Rheumatol Suppl 1997;48:23–29.[Medline]
- Nishimura M, Toki J, Sugiura K et al. Focal segmental glomerular sclerosis, a type of intractable chronic glomerulonephritis, is a stem cell disorder. J Exp Med 1994;179:1053–1058.[Abstract/Free Full Text]
- Oyaizu N, Yasumizu R, Miyama-Inaba M et al. (NZW x BXSB)F1 mouse. A new animal model of idiopathic thrombocytopenic purpura. J Exp Med 1988;167:2017–2022.[Abstract/Free Full Text]
- Snowden JA, Kearney P, Kearney A et al. Long-term outcome of autoimmune disease following allogeneic bone marrow transplantation. Arthritis Rheum 1998;41:453–459.[CrossRef][Medline]
- Yin JA, Jowitt SN. Resolution of immune-mediated diseases following allogeneic bone marrow transplantation for leukaemia. Bone Marrow Transplant 1992;9:31–33.[Medline]
- Slavin S, Marmont A, Burt RK. Allogeneic hematopoietic stem cell transplantation for autoimmune diseases. In: Burt RK, Marmont AM, eds. Stem Cell Therapy for Autoimmune Disease.Georgetown, TX: Landes Bioscience,2004;474–478.
- Sato K, Yamashita N, Yamashita N et al. Regulatory dendritic cells protect mice from murine acute graft-versus-host disease and leukemia relapse. Immunity 2003;18:367–379.[CrossRef][Medline]
- Schmaltz C, Alpdogan O, Kappel BJ et al. T cells require TRAIL for optimal graft-versus-tumor activity. Nat Med 2002;8:1433–1437.[CrossRef][Medline]
- Shlomchik WD, Couzens MS, Tang CB et al. Prevention of graft versus host disease by inactivation of host antigen-presenting cells. Science 1999;285:412–415.[Abstract/Free Full Text]
- Tsukada N, Kobata T, Aizawa Y et al. Graft-versus-leukemia effect and graft-versus-host disease can be differentiated by cytotoxic mechanisms in a murine model of allogeneic bone marrow transplantation. Blood 1999;93:2738–2747.[Abstract/Free Full Text]
- Snider D, Liang H. Early intestinal Th1 inflammation and mucosal T cell recruitment during acute graft-versus-host reaction. J Immunol 2001;166:5991–5999.[Abstract/Free Full Text]
- Ferrara JL, Levy R, Chao NJ. Pathophysiologic mechanisms of acute graft-vs-host disease. Biol Blood Marrow Transplant 1999;5:347–356.[CrossRef][Medline]
- Hill GR, Ferrara JL. The primacy of the gastrointestinal tract as a target organ of acute graft-versus-host disease: Rationale for the use of cytokine shields in allogeneic bone marrow transplantation. Blood 2000;95:2754–2759.[Abstract/Free Full Text]
- Burnett AK, Hann IM, Robertson AG et al. Prevention of graft-versus-host disease by ex vivo T cell depletion: Reduction in graft failure with augmented total body irradiation. Leukemia 1988;2:300–303.[Medline]
- Hertenstein B, Hampl W, Bunjes D et al. In vivo/ex vivo T cell depletion for GVHD prophylaxis influences onset and course of active cytomegalovirus infection and disease after BMT. Bone Marrow Transplant 1995;15:387–393.[Medline]
- Voltarelli JC, Corpuz S, Martin PJ. In vitro comparison of two methods of T cell depletion associated with different rates of graft failure after allogeneic marrow transplantation. Bone Marrow Transplant 1990;6:419–423.[Medline]
- Edinger M, Hoffmann P, Ermann J et al. CD4+CD25+ regulatory T cells preserve graft-versus-tumor activity while inhibiting graft-versus-host disease after bone marrow transplantation. Nat Med 2003;9:1144–1150.[CrossRef][Medline]
- Hoffmann P, Ermann J, Edinger M et al. Donor-type CD4(+)CD25(+) regulatory T cells suppress lethal acute graft-versus-host disease after allogeneic bone marrow transplantation. J Exp Med 2002;196:389–399.[Abstract/Free Full Text]
- Cohen JL, Trenado A, Vasey D et al. CD4(+)CD25(+) immunoregulatory T Cells: New therapeutics for graft-versus-host disease. J Exp Med 2002;196:401–406.[Abstract/Free Full Text]
- Blazar BR, Korngold R, Vallera DA. Recent advances in graft-versus-host disease (GVHD) prevention. Immunol Rev 1997;157:79–109.[CrossRef][Medline]
- Takabayashi M, Kanamori H, Takasaki H et al. A possible association between the presence of interleukin-4-secreting cells and a reduction in the risk of acute graft-versus-host disease. Exp Hematol 2005;33:251–257.[CrossRef][Medline]
- Krenger W, Cooke KR, Crawford JM et al. Transplantation of polarized type 2 donor T cells reduces mortality caused by experimental graft-versus-host disease. Transplantation 1996;62:1278–1285.[CrossRef][Medline]
- Thornton AM, Shevach EM. CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 1998;188:287–296.[Abstract/Free Full Text]
- Battaglia M, Gregori S, Bacchetta R et al. Tr1 cells: From discovery to their clinical application. Semin Immunol 2006;18:120–127.[CrossRef][Medline]
- Blaser BW, Roychowdhury S, Kim DJ et al. Donor-derived IL-15 is critical for acute allogeneic graft-versus-host disease. Blood 2005;105:894–901.[Abstract/Free Full Text]
- Itoi H, Fujimori Y, Tsutsui H et al. Involvement of interleukin-18 in acute graft-versus-host disease in mice. Transplantation 2004;78:1245–1250.[CrossRef][Medline]
- Aggarwal S, Pittenger MF. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 2005;105:1815–1822.[Abstract/Free Full Text]
- Le Blanc K, Rasmusson I, Sundberg B et al. Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004;363:1439–1441.[CrossRef][Medline]
- Ichioka N, Inaba M, Kushida T et al. Prevention of senile osteoporosis in SAMP6 mice by intrabone marrow injection of allogeneic bone marrow cells. STEM CELLS 2002;20:542–551.[Abstract/Free Full Text]
- Takada K, Inaba M, Ichioka N et al. Treatment of senile osteoporosis in SAMP6 mice by intra-bone marrow injection of allogeneic bone marrow cells. STEM CELLS 2006;24:399–405.[Abstract/Free Full Text]
- Huber S, Schramm C, Lehr HA et al. TGF-beta signaling is required for the in vivo expansion and immunosuppressive capacity of regulatory CD4+CD25+ T cells. J Immunol 2004;173:6526–6531.[Abstract/Free Full Text]
- Rutella S, Danese S, Leone G et al. Tolerogenic dendritic cells: Cytokine modulation comes of age. Blood 2006;108:1435–1440.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
M. Inaba, Y. Adachi, H. Hisha, N. Hosaka, M. Maki, Y. Ueda, Y. Koike, T. Miyake, J. Fukui, Y. Cui, et al.
Extensive Studies on Perfusion Method Plus Intra-Bone Marrow-Bone Marrow Transplantation Using Cynomolgus Monkeys
Stem Cells,
August 1, 2007;
25(8):
2098 - 2103.
[Abstract]
[Full Text]
[PDF]
|
 |
|