Stem Cells http://www.peprotech.com/
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

First published online April 26, 2007
Stem Cells Vol. 25 No. 7 July 2007, pp. 1654 -1663
doi:10.1634/stemcells.2006-0753; www.StemCells.com
© 2007 AlphaMed Press

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2006-0753v1
25/7/1654    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, M.-H.
Right arrow Articles by Han, Y.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, M.-H.
Right arrow Articles by Han, Y.-M.

EMBRYONIC STEM CELLS

Simvastatin Suppresses Self-Renewal of Mouse Embryonic Stem Cells by Inhibiting RhoA Geranylgeranylation

Mi-Hee Leea, Yee Sook Choa, Yong-Mahn Hanb

aCenter for Development & Differentiation, KRIBB, Yuseong-gu, Daejeon, Republic of Korea;
bDepartment of Biological Sciences, KAIST, Yuseong-gu, Daejeon, Republic of Korea

Key Words. Mouse embryonic stem cells • Self-renewal • Simvastatin • Geranylgeranyl pyrophosphate • RhoA

Correspondence: Yong-Mahn Han, Ph.D., Department of Biological Sciences, KAIST, 373-1 Guseong-dong, Yuseong-gu, Daejeon 305-701, Republic of Korea. Telephone: 82-42-869-2640; Fax: 82-42-869-2610; e-mail: ymhan{at}kaist.ac.kr; or Yee Sook Cho, Ph.D., Center for Development & Differentiation, KRIBB, 52 Eoeun-dong, Yuseong-gu, Daejeon 305-806, Republic of Korea. Telephone: 82-42-860-4479; Fax: 82-42-860-4608; e-mail: june{at}kribb.re.kr

Received November 20, 2006; accepted for publication April 10, 2007.
First published online in STEM CELLS EXPRESS   April 26, 2007.


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Statins, 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors, were originally developed to lower cholesterol. Their pleiotropic (or cholesterol-independent) effects at the cellular and molecular levels are highly related to numerous cellular functions, such as proliferation and differentiation. However, they are hardly studied in embryonic stem cells. In this study, we evaluated the effects of statins on mouse ESCs (J1, D3, and RW.4) to enhance our understanding of the molecular basis of ESC self-renewal. Treatment of ESCs with simvastatin, mevastatin, atorvastatin, or pravastatin induced morphological change and decreased cell proliferation. We observed that the use of simvastatin was most effective in all three ESCs. Loss of ESC self-renewal by simvastatin was determined by marked downregulation of ESC markers alkaline phosphatase, Oct4, Nanog, Rex-1, and SSEA-1. Simvastatin effects were selectively reversed by either mevalonate or its metabolite geranylgeranyl pyrophosphate (GGPP) but not by cholesterol or farnesyl pyrophosphate. These results suggest that simvastatin effects were mainly derived from depletion of intracellular pools of GGPP, the substrate required for the geranylgeranylation. Using this approach, we found that GGPP, a derivative of the mevalonate pathway, is critical for ESC self-renewal. Furthermore, we identified that simvastatin selectively blocked cytosol-to-membrane translocalization of RhoA small guanosine triphosphate-binding protein, known to be the major target for geranylgeranylation, and lowered the levels of Rho-kinase (ROCK)2 protein in ESCs. In addition, simvastatin downregulated the ROCK activity, and this effect was reversed by addition of GGPP. Our data suggest that simvastatin, independently of its cholesterol-lowering properties, impairs the ESC self-renewal by modulating RhoA/ROCK-dependent cell-signaling.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Embryonic stem cells self-renew indefinitely while maintaining pluripotency. Many studies have been undertaken to understand the regulation mechanisms that control self-renewal and differentiation of ESCs. Inhibition of post-translational isoprenylation by statins has been known to mediate numerous cellular functions including proliferation, apoptosis, and differentiation in various cell lines [1–5]. However, the molecular mechanisms of statin action on embryonic stem (ES) cells are largely unknown.

Statins, potent inhibitors of cholesterol synthesis, act by inhibiting 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase, which catalyzes the conversion of HMG-CoA to mevalonate [6]. In addition to the cholesterol lowering property, many biological effects of statins can be derived from cholesterol-independent (pleiotropic) mechanisms, which are likely a consequence of blocking intracellular signaling through inhibition of protein isoprenylation [7]. Protein isoprenylation, a covalent lipid modification, involves the addition of either 15-carbon farnesyl or 20-carbon geranylgeranyl isoprenoids to the conserved C-terminal region of a number of proteins, including most small guanosine triphosphate-binding proteins (G-proteins). This post-translational modification is believed to be involved in subcellular localization, protein-protein interactions, and intracellular trafficking of membrane-associated proteins [8–12]. By inhibiting mevalonate synthesis, statins block the biosynthesis of downstream isoprenoid intermediates of mevalonate pathway, such as farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP). Both FPP and GGPP serve as an isoprenoid substrate for protein farnesylation and geranylgeranylation, respectively [9]. The enzymes that catalyze protein farnesylation and geranylgeranylation are farnesyl transferase (FTase) [13] and geranylgeranyl transferase (GGTase) [14], respectively.

Small G-proteins including the Ras and Rho family serve as molecular switches by cycling between an active guanosine triphosphate (GTP)-bound and an inactive guanosine diphosphate-bound conformation. Most small G-proteins are localized in the cytosol or on membranes. Isoprenylation of small G-proteins is critical for their membrane localization, permitting interaction with relevant effector molecules to trigger diverse cellular functions [10, 15, 16]. Ras small G-proteins are modified by either farnesylation or geranylgeranylation, whereas Rho small G-proteins are modified by geranylgeranylation [10]. Recent studies have demonstrated that the lipid-lowering-independent effects of statins on cell proliferation [3, 17], cell adhesion [18], apoptosis [2, 19, 20], and differentiation [21] are mediated by inhibition of small G-protein isoprenylation in various cell lines. Clinical benefits of statins are also largely associated with G-protein-coupled mechanisms [22–26]. Stimulatory effects of statins on osteoblastic and adipocytic differentiations have been observed in vitro and in vivo [27, 28]. ESCs also preferentially undergo osteoblastic and adipocytic differentiation after treatment with statins [29, 30]. Reports demonstrate that small G-proteins are involved in the regulation of many important signal transduction processes that affect ESC proliferation and differentiation [31–34]. However, a wide variety of biological effects related to inhibition or activation of isoprenylation of small G-proteins are poorly defined in ESCs.

In the present study, we examine the actions of statins and their interference with downstream metabolites of HMG-CoA reductase including mevalonate, FPP, and GGPP in three different ESC lines derived from 129 strains of mice (J1, D3, and RW.4). The effects of the statins were also assessed by inhibiting FTase or GGTase using their specific inhibitors, FTI-277 or GGTI-298, respectively. Here, we found that downregulation of ESC self-renewal by simvastatin is significantly related to its inhibitory effect on RhoA geranylgeranylation, whereas other Rho family members including cdc42 and Ras had no effect. These data support that RhoA small G-protein is an important molecular target of simvastatin effects on ESCs. Our data demonstrate that the basal activity of RhoA, which is altered in response to GGPP availability, is required to retain proper self-renewal capacity of ESCs.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Materials and Antibodies
Simvastatin, cholesterol, and Y27632 were purchased from Calbiochem (San Diego, http://www.emdbiosciences.com). Mevastatin, pravastatin, mevalonate, FPP, GGPP, FTI-277, and GGTI-298 were from Sigma-Aldrich (St. Louis, http://www.sigmaaldrich.com). Atorvastatin was from Pfizer (New York, http://www.pfizer.com). Antibodies to RhoA, Rho-kinase (ROCK)1, and ROCK2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, http://www.scbt.com). Antibody to stage-specific embryonic antigen (SSEA)-1 was obtained from R&D Systems (Minneapolis, http://www.rndsystems.com). Antibodies to myosin phosphatase target protein-1 (MYPT-1) and phosphorylated MYPT-1 (Thr850) were obtained from Upstate (Charlottesville, VA, http://www.upstate.com). Antibodies to bromodeoxyuridine (BrdU), platelet endothelial cell adhesion molecule (PECAM)-1, intercellular adhesion molecule (ICAM)-1, and vascular cell adhesion molecule (VCAM)-1 were obtained from BD Pharmingen (San Diego, http://www.bdbiosciences.com/index_us.shtml). Horseradish peroxidase (HRP)-conjugated anti-mouse IgG antibody was obtained from Sigma. Alexa Fluor 488-conjugated donkey anti-mouse IgM and IgG antibodies were obtained from Molecular Probes (Eugene, OR, http://probes.invitrogen.com).

Cell Culture
Three mouse embryonic stem cell lines (J1, D3, RW.4) derived from 129 substrains were maintained in an undifferentiated state by coculture with {gamma}-irradiated mouse embryonic fibroblast (MEF) feeder cells in Dulbecco's modified Eagle's medium (Gibco-BRL, Gaithersburg, MD, http://www.gibcobrl.com) with 15% fetal bovine serum (ES cell qualified; HyClone, Logan, UT, http://www.hyclone.com), 100 µM nonessential amino acids (Invitrogen, Carlsbad, CA, http://www.invitrogen.com), 1 mM sodium pyruvate (Invitrogen), 100 µM 2-mercaptoethanol (Invitrogen), 1x antibiotic-antimycotic (Invitrogen), and 1,000 U/ml leukemia inhibitory factors (LIF) (ESGRO; Chemicon, Temecula, CA, http://www.chemicon.com). Cells were passaged every 2 days, and media were changed daily.

3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium Assay
To investigate the effects of statins on cell viability and proliferation, statins were added to the ES culture medium to a total volume of 100 µl in each well of 96-well plates, and cell growth was evaluated using a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay according to the manufacturer's instructions (Promega, Madison, WI, http://www.promega.com). Briefly, the culture medium was removed at different times (12- or 24-hour exposure), and 20 µl of MTS reagent mixed with 100 µl of culture medium was added to each well. Then, the cells were incubated at 37°C in a humidified, 5% CO2 atmosphere for 1–2 hours. A 60-µl aliquot of medium from each well was transferred to an enzyme-linked immunosorbent assay 96-well plate, and its absorbance at 490 nm was measured. Each bar represents means ± SEM ≥3 of independent experiments. Results are expressed as percentage of control values. The data from treated groups were compared with those from nontreated control groups by using paired Student's t test. In our experimental conditions, the conversion of a tetrazolium salt (MTS) into a colored formazan was not significantly affected by the addition of statins, which were subjected to identical treatment in ESC culture medium without cells.

BrdU Incorporation
Bromodeoxyuridine (Roche Diagnostics, Basel, Switzerland, http://www.roche-applied-science.com) was used to label proliferating cells. BrdU was added into the culture medium at a concentration of 30 µM for 2 hours. Cells were washed with phosphate-buffered saline (PBS) and fixed with 4% formaldehyde for 30 minutes then washed with washing buffer again for 15 minutes. Cells were permeabilized with 0.1% Triton X-100 for 10 minutes and washed with washing buffer three times. Samples were then incubated in 2 N HCl for 10 minutes at room temperature followed by washing buffer for 5 minutes. Cells were rinsed with 0.1 M sodium tetraborate (Sigma) for 10 minutes to neutralize the HCl and added to PBS containing 1 mg/ml RNase A (Sigma) and incubated at 37°C for 30 minutes. The cells were incubated with anti-BrdU antibody for 1 hour at 4°C, washed twice, and then labeled with Alexa Fluor 488-conjugated donkey anti-mouse IgG antibody (Molecular Probes) for 1 hour at room temperature. After washing three times with washing buffer, the cells were resuspended in 50 µg/ml propidium iodide (Sigma) solution. Cells were analyzed on a FACSCalibur flow cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, http://www.bd.com). All data were calculated and displayed using the Cell Quest analysis software provided by Becton Dickinson.

Alkaline Phosphatase Assay
Staining for alkaline phosphatase (AP) was performed at room temperature using an alkaline phosphatase detection kit containing Naphthol/Fast Red Violet Solution (Chemicon) as recommended by the manufacturer. During reaction, culture dishes were protected from drying and direct light. Cells were rinsed with deionized water and air-dried. Images were observed under an inverted microscope (Olympus, Tokyo, http://www.olympus-global.com).

Semiquantitative Reverse Transcriptase-Polymerase Chain Reaction
Total RNA was extracted from ESCs using TRIzol reagent (Invitrogen). DNase-treated total RNA was used to prepare the first-strand cDNA with SuperScript II (Invitrogen), following the protocol of the manufacturer. cDNA samples were subjected to polymerase chain reaction (PCR) amplification with specific primers under linear conditions to approximate the original amount of the specific transcript. Amplification conditions consisted of denaturation at 95°C for 5 minutes followed by 26 cycles of denaturation at 95°C for 20 seconds, annealing at 56°C for 30 seconds, and elongation at 72°C for 30 seconds. Platinum Taq SuperMix kit (Invitrogen) was used according to manufacturer's directions. The PCR primers (listed as forward primer and reverse primer) were as follows: Oct4, 5'GCGTTCTCTTTGGAAAGGTG3' and 5'ACTCGAACCACATCCTTCTC3'; Nanog, 5'AACGATATGGTGGCTACTCTC3' and 5'TCGGTTCATCATGGTACAGTC3'; Rex-1, 5'TGAGGAAGCACATGCTTGTCCA3' and 5'TGCGTGGGTTAGGATGTGAATC3'; Tubulin, 5'GGAACATAGCCGTAAACTGC3' and 5'TCACTGTGCCTGAACTTACC3'. Tubulin gene served as a control.

Real-Time Reverse Transcriptase-PCR
Total RNA was extracted from ESCs by using RNeasy Protect Mini Kit (Qiagen, Hilden, Germany, http://www1.qiagen.com). cDNA synthesis was performed by using SuperScript II reverse transcriptase (Invitrogen). Quantitative real-time PCR was performed using SYBR Green PCR master mix (Qiagen) on the ABI 7500 real-time PCR System (Applied BioSystems, Foster City, CA, http://www.appliedbiosystems.com). The PCR primers (listed as forward primer and reverse primer) were as follows: Oct4, 5' TGTGGACCTCAGGTTGGACT 3' and 5' CTTCTGCAGGGCTTTCATGT 3'; glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 5'GTGTTCCTACCCCCAATGTG3' and 5'TGTCATTGAGAGCAATGCCAG3'. The following conditions were used: 2 minutes at 50°C and 15 minutes at 95°C followed by 50 cycles of 15 seconds at 95°C and 1 minute at 58°C. All experiments were run in triplicate and relative quantification of Oct4, Nanog, and Rex-1 gene expression was achieved by normalization against the endogenous control GAPDH using the {Delta}CT method of quantification. The primer pairs for Nanog and Rex-1 used were the same as those for the semiquantitative reverse transcriptase (RT)-PCR.

Fluorescence-Activated Cell Sorting Analysis
Cells for flow cytometry were resuspended in 0.3% bovine serum albumin (BSA)/PBS and incubated with antibodies directed against specific cell surface protein SSEA-1 for 1 hour at 4°C. Cells were then washed twice with washing buffer (10 mM Tris, 100 mM NaCl, 0.05% Tween 20, and 0.3% BSA) and labeled with Alexa Fluor 488-conjugated donkey anti-mouse IgM antibody (Molecular Probes) for 1 hour at 4°C. After 30 minutes of incubation at 4°C, cells were washed three times. Cell-associated fluorescence was analyzed on a FACSCalibur flow cytometer (Becton Dickinson). Control cells were not treated with primary antibodies. All data were calculated and displayed using the Cell Quest analysis software provided by Becton Dickinson.

Preparation of Membrane and Cytosolic Fractions
Cells were suspended in extraction solution (10% glycerol, 20 mM HEPES, 1 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol [DTT], 1 mM phenylmethylsulfonyl fluoride [PMSF], and a cocktail of protease inhibitors). The lysate was incubated for 30 minutes on ice and centrifuged at 4°C for 1 hour and 30 minutes at 48,000g. The supernatant contained the proteins of the cytosolic fraction. The insoluble material was subsequently resuspended in solubilization buffer (1% NP-40, 20 mM HEPES, 0.2 mM EDTA, 0.8 mM EGTA, 1 mM DTT, 1 mM PMSF, and a cocktail of protease inhibitors). After incubation for 1 hour on ice and centrifugation at 4°C for 1 hour at 48,000g, proteins of the membrane fraction were present in the supernatant. Protein concentrations were determined by the BCA assay (Pierce, Rockford, IL, http://www.piercenet.com).

Western Blot Analysis
Samples containing equal amounts of proteins were mixed with equal volumes of 2x sample buffer (125 mM Tris pH 6.8, 4% sodium dodecyl sulfate [SDS], 10% glycerol, 0.006% bromophenol blue, 1.8% ß-mercaptoethanol) and were boiled for 5 minutes. Proteins were subsequently fractionated in 12% SDS-polyacrylamide gel electrophoresis at room temperature and electrically transferred from the gel to a nitrocellulose membrane. After blocking in 3% bovine serum albumin fraction V (Sigma) in TBST (10 mM Tris, 100 mM NaCl, and 0.05% Tween 20), the membrane was incubated with primary antibody at 4°C overnight. After incubation with HRP-conjugated secondary antibody at 4°C for 3 hours, protein bands were visualized with an ECL chemiluminescence detection kit (Roche).

Statistical Analysis
Each experiment was repeated at least three times. Data are shown as means ± SEM. The statistical significance of differences was analyzed using Student's t test.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 
Simvastatin Induces Downregulation of ESC Proliferation and ESC-Specific Markers
Three different cell lines such as J1, D3, and RW.4 derived from the 129 strain were used to examine and provide physiological relevance of statin effects on mouse embryonic stem cells. Undifferentiated mouse embryonic stem cells were maintained on MEF feeder cells in the presence of LIF (1000 U/ml). All ESCs treated with either 10 µM simvastatin, mevastatin, or atorvastatin exhibited dramatic changes in cell morphology within 24 hours, whereas pravastatin had little effect (Fig. 1A and supplemental online Fig. 1). The same morphological change by pravastatin was observed after a long period of incubation (48 hours). The morphological changes by statins were induced in a dose- and time-dependent manner either in the presence or absence of LIF in ESCs compared with untreated control cells. Cell viability and proliferation in response to statins were examined by MTS colorimetric methods. The optical density of ESCs significantly decreased after incubation with simvastatin, mevastatin, or atorvastatin compared with unexposed cells. ESCs treated with simvastatin, mevastatin, or atorvastatin exhibited a dose-dependent and statistically significant reduction in cell proliferation for all three ESCs (Fig. 1B and supplemental online Fig. 2). After treatment for 12 hours, the cell proliferation rate of simvastatin-treated J1 ESCs was 78% ± 2.3% at 10 µM and 70.9% ± 2.1% at 20 µM, whereas the effects of mevastatin were 90.4% ± 1.3% at 10 µM and 82.2% ± 1.9% at 20 µM (Fig. 1B). ESCs showed higher sensitivity to simvastatin than other statins. Thus, we selected simvastatin for the following studies.


Figure 1
View larger version (80K):
[in this window]
[in a new window]

  		Figure 1. Statins modulate ESC morphology and proliferation. (A): Phase-contrast images of J1 mouse embryonic stem cells after treatment with vehicle (control) or 10 µM simvastatin, atorvastatin, mevastatin, or pravastatin for 12 or 24 hours (magnification x200). (B): Effect of statins on ESC proliferation evaluated in the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay. J1 ESCs were treated with measured doses of statins (0–20 µM) for 12 hours, and the cell growth was assessed by MTS assay. Each datum represents the mean ± SEM (n = 3–5). Statistical differences among groups were assessed with Student's t test. * p < .005; ** p < .001. (C): Schematic diagram of the mevalonate pathway. The sites of action of compounds were indicated. Abbreviations: FPP, farnesyl pyrophosphate; FTase, farnesyl transferase; FTI, farnesyl transferase inhibitor; GGPP, geranylgeranyl pyrophosphate; GGTase, geranylgeranyl transferase; GGTI, geranylgeranyl transferase inhibitor; HMG-CoA, 3-hydroxy-3-methylglutaryl CoA; hr, hours.

 
Simvastatin effect on ESC self-renewal was characterized by measuring expression levels of specific ESC markers, such as AP, Oct4, Nanog, Rex-1, and SSEA-1. Following 24-hour treatment of 10 µM simvastatin, AP expression was clearly downregulated in J1 ESCs (Figs. 2A, 4A). Similar effects were obtained in independent experiments with two different ESCs, D3 and RW.4 (supplemental online Fig. 3). Semiquantitative RT-PCR revealed that simvastatin had inhibitory effects on expressions of Oct4, Nanog, and Rex-1 compared with an untreated control (Fig. 2B). Consistently, quantitative real-time PCR showed statistically significant downregulation of Oct4 (2.9-fold) and Nanog (2.9-fold) (p < .01) in simvastatin-treated cells compared with an untreated control (Fig. 2C). A slight downregulation of Rex-1 mRNA was observed; however, it was not statistically significant (Fig. 4C). Upon simvastatin treatment, the majority of cells (76%) were negative for SSEA-1 staining (Fig. 2C). These results showed that, in response to simvastatin, ESCs lose their typical ESC-like morphology and self-renewal capacity.


Figure 2
View larger version (43K):
[in this window]
[in a new window]

  		Figure 2. Mevalonate reverses the morphological change of ESCs and downregulation of ESC markers by simvastatin. J1 ESCs were incubated with vehicle (control), 10 µM simvastatin, 1 mM mevalonate, and/or 50 µM cholesterol. After a 24-hour treatment, ESCs were visualized by staining for AP using an AP detection kit containing Naphthol/Fast Red Violet solution (magnification x200; inset images x40) (A). Gene expression levels of ESC markers Oct4, Nanog, and Rex-1 were measured by semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) (B) and quantitative real-time PCR (C). Tubulin was used as a control of semiquantitative RT-PCR. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNAs were quantified using real-time PCR. Data of target genes were normalized to GAPDH. Statistical differences among groups were assessed with Student's t test. ** p < .01. Expression of SSEA-1 was analyzed with an anti-SSEA-1 monoclonal antibody using flow cytometry (D). Data correspond to a representative experiment of three independent experiments, each of which gave similar results. Abbreviations: AP, alkaline phosphatase; SSEA, stage-specific embryonic antigen.

 
Mevalonate Reverses Simvastatin Effects on ESCs
As statin blocks mevalonate generation and subsequent cholesterol synthesis by inhibiting HMG-CoA reductase (Fig. 1C), we examined the compensatory effect of exogenous mevalonate and cholesterol on statin treatment. Addition of 1 mM mevalonate fully blocked simvastatin-mediated morphological change (left panel) and downregulation of AP expression (right panel) in J1 ESCs (Fig. 2A). In contrast, addition of cholesterol did not prevent simvastatin effects on cell morphology (Fig. 2A). Similar results were obtained for D3 and RW.4 ESCs under the same conditions (supplemental online Fig. 3). Consistently, expression of ESC markers including Oct4, Nanog, Rex-1, and SSEA-1 was preserved when simvastatin was coincubated with mevalonate (Fig. 2B, 2C). Mevalonate but not cholesterol was sufficient to prevent simvastatin effects on morphological change and downregulation of the ESC markers. Mevalonate or cholesterol alone had no or little effect.

Simvastatin effects on ESC proliferation were further characterized by BrdU incorporation assay after treatment with various concentrations (0, 2, 5, or 10 µM) for 24 hours. DNA replication of ESCs was ceased by simvastatin in a dose-dependent manner. As shown in Figure 3, ESCs treated with 10 µM of simvastatin exhibited only 39% BrdU incorporation, whereas nontreated control cells exhibited 74%. Cotreatment with mevalonate completely prevented the simvastatin-mediated decrease in a number of BrdU-positive cells. These results implied that the depletion of mevalonate and its derivatives is involved in simvastatin actions on ESCs.


Figure 3
View larger version (30K):
[in this window]
[in a new window]

  		Figure 3. Antiproliferative effects of simvastatin are reversed by addition of mevalonate. J1 ESCs were incubated with vehicle, simvastatin (2, 5, or 10 µM), and/or mevalonate (1 mM) for 24 hours. Cell proliferation was measured by BrdU incorporation assay and determined by flow cytometry. Data correspond to a representative experiment of three independent experiments, each of which gave similar results. Abbreviation: BrdU, bromodeoxyuridine.

 
Isoprenoid Intermediate GGPP, but Not FPP, Inhibits the Downregulation of ESC Self-Renewal by Simvastatin
Because statin inhibits the synthesis of isoprenoids including geranylgeranyl pyrophosphate and farnesyl pyrophosphate (Fig. 1C), statin effects could be abolished not only by mevalonate but also by GGPP or FPP. Thus, we further examined the ability of the isoprenoids GGPP or FPP to prevent the simvastatin-mediated effects. J1 ESCs were incubated with 10 µM simvastatin alone or in combination with 20 µM GGPP or FPP. Adding GGPP, not FPP, prevented the simvastatin-induced morphological change (left panel) and reduction of AP expression (right panel) (Fig. 4A), as did adding mevalonate (Fig. 2A). Quantitative real-time PCR results showed that addition of GGPP, but not FPP, restored the downregulation of Oct4 and Nanog mRNA expression in simvastatin-treated cells (Fig. 4C). Addition of GGPP also reversed the simvastatin-mediated downregulation of SSEA-1 expression (Fig. 4D). To further confirm that GGPP, a substrate for geranylgeranylation of cellular proteins, is a key effector of simvastatin, we evaluated isoprenoid inhibitors such as geranylgeranyl transferase I (GGTase I) inhibitor GGTI-298 (GGTI) and farnesyl transferase inhibitor FTI-277 (FTI). In concordance, only GGTI, not FTI, showed simvastatin-like morphological change and downregulation of ESC markers such as AP (Fig. 4A), Oct4, Nanog, Rex-1 (Fig. 4C), and SSEA-1 (Fig. 4D). This was further confirmed with two other ESC lines, D3 and RW.4. Similar results were obtained under the same conditions (supplemental online Fig. 4). These results clearly support that simvastatin-mediated loss of ES self-renewal capacity is mainly related to the depletion of GGPP, but not FPP, and the involvement of defective protein geranylgeranylation.


Figure 4
View larger version (42K):
[in this window]
[in a new window]

  		Figure 4. GGPP attenuates the simvastatin inhibitory effect on ESC self-renewal. J1 ESCs were incubated with vehicle (control), 20 µM FPP, 20 µM GGPP, and 10 µM simvastatin (A, C, D). Separate culture of ESCs was incubated with vehicle (control), 2.5 µM farnesyl transferase inhibitor-277, or 10 µM geranylgeranyl transferase I inhibitor-286 (B, C, D). After a 24-hour treatment, ESCs were visualized by staining for AP using an AP detection kit (magnification x200; inset images x40) (A, B). Gene expression levels of ESC markers Oct4, Nanog, and Rex-1 were measured by quantitative real-time polymerase chain reaction (C). Data of target genes were normalized to glyceraldehyde-3-phosphate dehydrogenase. Statistical differences among groups were assessed with Student's t test. * p < .05; ** p < .01. Expression of SSEA-1 was analyzed with an anti-SSEA-1 monoclonal antibody using flow cytometry (D). Abbreviations: AP, alkaline phosphatase; FPP, farnesyl pyrophosphate; FTI, farnesyl transferase inhibitor; GGPP, geranylgeranyl pyrophosphate; GGTI, geranylgeranyl transferase inhibitor; SSEA, stage-specific embryonic antigen.

 
Simvastatin Impairs RhoA Geranylgeranylation
Isoprenoid intermediate GGPP is an important post-translational lipid attachment of many cellular proteins for intracellular signaling, and its most notable molecular target is small GTP-binding proteins including RhoA, Rac, CDC42, and Ras [10]. RhoA activation requires active RhoA to be targeted to the plasma membrane. Isoprenylation of Rho family proteins is essential for its proper membrane translocation from the cytosol and cellular functions [11, 16, 35]. Previous reports showed that statins could specifically inhibit post-translational geranylgeranylation of RhoA protein [36, 37]. To address whether the simvastatin-mediated depletion of GGPP is reflective of isoprenylation of Rho family proteins, we performed a biochemical fractionation method, which enabled us to confirm the subcellular localization of RhoA, Rac1, and CDC42. After a 24-hour incubation with 10 µM simvastatin, cellular lysates from ESCs were fractionated into membrane and cytosolic fractions and immunoblotted with respective antibodies to assess relative amounts of lysates. We observed that simvastatin significantly decreased the amounts of RhoA associated with the membrane by 0.3-fold (p < .01) in J1 ESCs compared with untreated control cells (Fig. 5B, upper panel). Consistently, simvastatin treatment significantly abolished association of RhoA with the membrane in D3 and RW.4 ESCs (p < .01) (Fig. 5B, lower panel). However, simvastatin had no effect on other Rho family members such as Rac1 and CDC42 in all ESCs (Fig. 5C). Importantly, coincubation with either mevalonate or GGPP significantly reversed downregulation of membrane-associated RhoA protein in all ESCs (Fig. 5B). However, addition of FPP had no effects on altered cellular distribution of RhoA mediated by simvastatin (Fig. 5B). Supportively, we found that ESCs treated with geranylgeranyl transferase I specific inhibitor GGTI-286, highly selective for geranylgeranylation over farnesylation, showed selective inhibition of RhoA membrane translocation (Fig. 5A). However, specific inhibitor of farnesylation (FTI-277) had no significant effect. Moreover, simvastatin had no effect on membrane translocation of Ras G-protein, which is mainly activated by farnesylation (Fig. 5C). These results strongly suggest that, by depleting intracellular pools of GGPP, simvastatin selectively blocks RhoA geranylgeranylation and its translocation to the cell membrane, where it interacts with downstream targets (effectors) to generate cellular responses.


Figure 5
View larger version (45K):
[in this window]
[in a new window]

  		Figure 5. Simvastatin inhibits RhoA geranylgeranylation. (A): Effects of GGTI or FTI on membrane translocation of RhoA. ESCs (J1, D3, and RW.4) were incubated with vehicle, 10 µM FTI-277, or 10 µM GGTI-298 for 24 hours. (B): Effects of simvastatin alone and in combination with mevalonate metabolites (mevalonate, GGPP, FPP) on membrane translocation of RhoA. ESCs (J1, D3, and RW.4) were incubated with vehicle, 10 µM simvastatin, 1 mM mevalonate, 20 µM FPP, and/or 20 µM GGPP for 24 hours. Western blot analysis was performed using membrane and/or cytosolic fractions with anti-RhoA specific antibody (A, B). Immunoreactive bands were quantified by densitometry. The data from immunoblots were expressed as a relative fold of the control in each experiment. Each bar represents the mean ± SEM of three independent experiments. Statistical differences among groups were assessed with Student's t test. * p < .01. (C): Effects of simvastatin on membrane translocation of cdc42, Rac1, and Ras. ESCs (J1, D3, and RW.4) were incubated with vehicle or 10 µM simvastatin. After a 24-hour treatment, membrane fractions were immunoblotted for antibodies against cdc42, Rac1, or Ras. Experiments were repeated three times and a representative experiment is displayed. Abbreviations: C, vehicle; FPP, farnesyl pyrophosphate; FTI, farnesyl transferase inhibitor; GGPP, geranylgeranyl pyrophosphate; GGTI, geranylgeranyl transferase inhibitor; M, mevalonate; S, simvastatin.

 
ROCK Is a Downstream Effector of RhoA on Simvastatin Actions
Previous studies have shown that statin can inhibit the RhoA/ROCK-dependent signaling pathway through blocking RhoA geranylgeranylation [2, 36]. To further elucidate the RhoA involvement on simvastatin-mediated effects in ESCs, we examined whether ROCK is the downstream RhoA effector in our experimental conditions. Interestingly, we observed that the ROCK-specific inhibitor Y27632 (10 µM) mimicked the effects of statin on morphological changes and downregulation of ESC marker expression (Fig. 6A). To further clarify the ROCK involvement, we tested ROCK expression and activity after treatment with 10 µM simvastatin for 24 hours in ESCs. Simvastatin induced marked downregulation of ROCK2 protein, whereas ROCK1 showed no change. There was no compensatory upregulation of ROCK1 expression of the loss of ROCK2. We indirectly measured ROCK activity using MYPT-1 as a substrate. As shown in Figure 6B, simvastatin decreased the MYPT-1 phosphorylation at T850, and this effect was reversed by addition of GGPP. These results suggest that RhoA inhibition may account for the inhibition of ROCK2 expression and ROCK activity that may be an important mechanism of simvastatin-mediated actions in ESCs. Although further studies are needed to uncover the precise mechanism, these results indicate that ROCK1 and ROCK2 play different physiological roles in RhoA-dependent signaling in ESCs.


Figure 6
View larger version (31K):
[in this window]
[in a new window]

  		Figure 6. Simvastatin impairs RhoA and ROCK activity. J1 ESCs were incubated with vehicle, 10 µM simvastatin, 20 µM farnesyl pyrophosphate, and/or 20 µM GGPP for 24 hours. (A): Effects of ROCK inhibitor Y27632 on cell morphology and ESC marker expression. J1 ESCs were incubated with vehicle or 10 µM Y27632 for 24 hours. Expression of ESC markers was evaluated by AP staining and quantitative real-time polymerase chain reaction. (B): Immunoblot analysis for ROCK1 and ROCK2. ROCK1 and ROCK2 expressions were determined by Western blot analysis using specific ROCK1 and ROCK2 antibodies, respectively. (C): Immunoblot analysis for phosphorylated MYPT-1 and MYPT-1 (T850). ROCK activity was determined by immunoblotting with anti-phospho-MYPT-1 specific antibody. Tubulin was used as a control. The results are representative of three independent experiments. Abbreviations: AP, alkaline phosphatase; C, vehicle; GGPP, geranylgeranyl pyrophosphate; MYPT-1, myosin phosphatase target protein-1; p-MYPT-1, phosphorylated myosin phosphatase target protein-1; ROCK, Rho kinase.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 Acknowledgments
 References
 
In this report, we demonstrated that the HMG-CoA reductase inhibitor simvastatin downmodulates the self-renewal of embryonic stem cells through blocking HMG-CoA/GGPP/RhoA-dependent pathways. We showed for the first time the in vitro efficacy of mevalonate and its isoprenoid intermediates GGPP or FPP alone and in combination with simvastatin in three different mouse ESC lines, J1, D3, and RW.4.

Statins, small molecule inhibitors of HMG-CoA reductase, effectively diminish endogenous cholesterol levels and other products in the mevalonate pathway. However, there is growing evidence for additional benefits of statins, which are independent of the lipid/cholesterol lowering properties, that are dependent on protein isoprenylation related to the defective synthesis of isoprenoid precursor GGPP, FPP [7, 23]. We primarily observed whether three lipophilic statins (simvastatin, mevastatin, and atorvastatin) and one hydrophilic statin (pravastatin) had effects on morphological changes and loss of ESC self-renewal. Lipophilic statins were consistently more potent than the hydrophilic statin in three ESC lines. Of these, simvastatin was most effective for alteration of cellular morphology and inhibition of ESC proliferations and ESC marker expression with less cytotoxicity. Since changes in cell morphology are conspicuous features on disruption of ESC self-renewal, we further evaluated the simvastatin effects on ESC marker expression. Simvastatin clearly downregulated the expression of the alkaline phosphatase ESC marker (Fig. 2, supplemental online Figs. 3, 4). Simvastatin effects modulating cell morphology, proliferation, and ESC marker expression were completely reversed by the coaddition of mevalonate, the product of HMG-CoA reductase. We extensively examined cholesterol's inhibitory effects on simvastatin actions using many different incubation times and concentrations. However, none of them had inhibitory effects. These indicate that simvastatins' actions on ESCs could be attributed to their ability to inhibit the synthesis of isoprenoid intermediates such as GGPP or FPP rather than their ability to block cholesterol synthesis. Such pleiotropic actions of statins have been known to be mainly achieved by preventing the synthesis of isoprenoid intermediates of the cholesterol biosynthetic pathway [7, 23].

Consistent with other reports [27, 30], the expressions of the adipocytic/osteoblastic lineage-specific marker were increased in simvastatin-treated ESCs (data not shown) along with decrease in ESC marker expression (Fig. 2) and ESC proliferation (Fig. 3). To understand the mechanisms that induce the downregulation of ESC self-renewal and initiate a distinct differentiation process upon simvastatin treatment, we further investigated downstream of the mevalonate pathway using a cell-permeable form of GGPP and FPP. Supplementary addition of GGPP, but not FPP, completely prevented the simvastatin-mediated morphological changes and decrease in ESC marker expressions (Fig. 3). This finding indicates that simvastatin might be able to block the geranylgeranylation process of cellular protein, which has a critical role in regulation of pluripotent ESCs. Consistently, incubation with geranylgeranyl transferase I specific inhibitor GGTI-298, which blocks protein geranylgeranylation, but not farnesyl transferase specific inhibitor FTI-277 results in simvastatin-like responses such as morphological changes (Fig. 4B) and decrease in ESC marker expression (Fig. 4C, 4D). Therefore, we demonstrated that the inhibition of protein geranylgeranylation, but not of cholesterol synthesis, is responsible for simvastatin effects and related to disruption of ESC self-renewal.

The subcellular localization and biological functions of small G-proteins strongly depend on selective post-translational isoprenylations [8, 10, 12, 16]. By inhibiting isoprenylation of G-proteins, statins lead to the accumulation of inactive G-proteins in cytoplasm. Importantly, members of Rho family including RhoA, Rac1, and cdc42 are major substrates of post-translational geranylgeranylation [10] and important regulators of cytoskeletal and cell shape changes [35, 38–40]. Many studies demonstrate that GGPP is essential for the activation of Rho small G-proteins in regulation of cellular proliferation and differentiation in many types of cells [41, 42].

Pluripotent ESCs have a round colony shape that is tightly packed and close together. However, tight intercellular contact was notably diminished by statins in ESCs (Fig. 1, supplemental online Fig. 1). Morphological changes were accompanied with downregulation of membrane bound cell adhesion molecules (CAMs) including PECAM-1, VCAM-1, and ICAM-1, and those effects were reversed by GGPP supplementation (data not shown). Supportively, studies demonstrated that statins downmodulate the actin-cytoskeletal remodeling and the expression of CAMs by blocking Rho/Rho-kinase signaling [36, 37, 43]. Thus, we studied particularly the effect of simvastatin on the Rho small G-protein, although many proteins are potential substrates for post-translational modification by geranylgeranylation.

We speculated that simvastatin could alter cellular distribution of Rho family members through its ability to prevent the geranylgeranylation process via depletion of isoprenoid precursors in ESCs. As a result, RhoA dysfunction by simvastatin was confirmed by attenuation of the presence of RhoA protein in membrane fraction and its higher accumulation in cytosolic fraction, and such an effect was selectively prevented by coincubation with either mevalonate or GGPP (Fig. 5B). Other Rho subfamilies such as Rac and cdc42 were not affected by simvastatin (Fig. 5C). Treatment with GGTI-298, which could potently inhibit protein geranylgeranylation, effectively blocked RhoA translocation from cytosol to membrane (Fig. 5A). Expression level of Ras protein, which was modified by farnesylation, at membrane fraction was not changed by treatment with simvastatin (Fig. 5C). This demonstrates that inhibition of RhoA geranylgeranylation is an important mechanism to account for the effects of simvastatin on ESCs. Furthermore, our results demonstrate that basal RhoA activity is crucial for the maintenance of the undifferentiated state of ESCs, and its loss may initiate the differentiation program of ESCs. This is believed to be the first time that RhoA was identified as the downstream signaling molecule of GGPP, which was downmodulated by simvastatin on ESCs.

We examined whether simvastatin altered GTP loading of RhoA by using the Rho binding domain of Rhotekin. Interestingly, after 24 hours of incubation with simvastatin, active GTP-loaded RhoA protein in total cell lysates was markedly increased in ESCs (data not shown). These results suggest that most active RhoA protein is accumulated in the cytosol in its unprocessed form in simvastatin-treated cells. In accordance with our results, increase of GTP-loaded small G-proteins by statin was observed in various cell types [44, 45]. Thus, we determined if altered distribution of active RhoA in ESCs affects the downstream signal pathway of RhoA.

ROCK (a kinase associated with RhoA for transducing RhoA signaling) mediates multiple RhoA effects through phosphorylating various downstream targets of ROCKs [46]. Direct inhibition of ROCK by Y-27632 (a selective inhibitor of ROCK) mimicked the statin effects on morphological changes and downregulation of ESC markers (Fig. 6A). When treated with simvastatin, ROCK2 expression was markedly decreased in ESCs. Decrease in ROCK2 expression was reversed by GGPP supplementation (Fig. 6B). However, expression of ROCK1 was not affected by simvastatin treatment. In addition, we indirectly confirmed the downregulation of ROCK activity by performing Western blots using anti-phospho-MYPT-1 specific antibody in simvastatin-treated cells (Fig. 6C). These results demonstrate that simvastatin actins in ESCs are clearly related to ROCK-dependent signaling. Simvastatin may enable the inhibition of RhoA signaling at least partly through the ROCK-dependent pathway. ROCK1 and ROCK2 may serve different functions and have different downstream target proteins for simvastatin actions in ESCs. Most of the downstream targets of ROCKs, including myosin-binding subunit on myosin light chain phosphatase, myosin light chains, and ERM proteins, are associated with the regulation of the actin cytoskeleton. Therefore, ROCK inhibition by simvastatin may mediate the changes in regulation of the actin cytoskeleton, which play an important role in proliferation and differentiation of ESCs. Downregulation of CAMs such as PECAM, VCAM, and ICAM observed in simvastatin-treated ESCs (data not shown) may be related to the RhoA/ROCK signal pathway; however, further exploration remains to be characterized. Our results clearly demonstrated that RhoA is one of the important target molecules of simvastatin actions in ESCs; however, it would be expected that other possible candidate geranylgeranylated proteins presented in ESCs.

In conclusion, we demonstrated that simvastatin mediates loss in self-renewal potential of ESCs and commitment to differentiation that may be due to a suppression of RhoA/ROCK function. Using this approach, we demonstrated that geranylgeranylation of RhoA protein is required for its proper membrane localization, where it can bind to a set of effector molecules that could be important regulation for the maintenance of ESC self-renewal. Further clarification of the mechanism underlying the simvastatin action and its relation to intracellular cell signaling may provide valuable information that helps us to understand ESC self-renewal. Our findings also suggest that ESCs could be a good model to evaluate potential pleiotropic effects of statins.


   DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
Acknowledgments
 References
 
The authors indicate no potential conflicts of interest.


   ACKNOWLEDGMENTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
References
 
We thank Dr. Dae-Yeul Yu for kindly providing J1 mouse embryonic stem cells. This work was supported by KOSEF Stem Cell Research Program (M1064102000206N410200210), Stem Cell Research Center of the 21st Century Frontier Research (SC2090), and KRCF/KRIBB Research Initiative Program.


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 Acknowledgments
 References
 

  1. Zhong WB, Wang CY, Chang TC et al. Lovastatin induces apoptosis of anaplastic thyroid cancer cells via inhibition of protein geranylgeranylation and de novo protein synthesis. Endocrinology 2003;144:3852–3859.[Abstract/Free Full Text]

  2. Li X, Liu L, Tupper JC et al. Inhibition of protein geranylgeranylation and RhoA/RhoA kinase pathway induces apoptosis in human endothelial cells. J Biol Chem 2002;277:15309–15316.[Abstract/Free Full Text]

  3. Bouterfa HL, Sattelmeyer V, Czub S et al. Inhibition of Ras farnesylation by lovastatin leads to downregulation of proliferation and migration in primary cultured human glioblastoma cells. Anticancer Res 2000;20:2761–2771.[Medline]

  4. Park HJ, Galper JB. 3-Hydroxy-3-methylglutaryl CoA reductase inhibitors up-regulate transforming growth factor-beta signaling in cultured heart cells via inhibition of geranylgeranylation of RhoA GTPase. Proc Natl Acad Sci U S A 1999;96:11525–11530.[Abstract/Free Full Text]

  5. Maltese WA, Sheridan KM. Differentiation of neuroblastoma cells induced by an inhibitor of mevalonate synthesis: Relation of neurite outgrowth and acetylcholinesterase activity to changes in cell proliferation and blocked isoprenoid synthesis. J Cellular Physiol 1985;125:540–558.[CrossRef][Medline]

  6. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature 1990;343:425–430.[CrossRef][Medline]

  7. Liao JK, Laufs U. Pleiotropic effects of statins. Annu Rev Pharmacol Toxicol 2005;45:89–118.[CrossRef][Medline]

  8. Sinensky M. Recent advances in the study of prenylated proteins. Biochim Biophys Acta 2000;1484:93–106.[Medline]

  9. Zhang FL, Casey PJ. Protein prenylation: Molecular mechanisms and functional consequences. Annu Rev Biochem 1996;65:241–269.[CrossRef][Medline]

  10. Casey PJ. Mechanisms of protein prenylation and role in G protein function. Biochem Soc Trans 1995;23:161–166.[Medline]

  11. Glomset JA, Gelb MH, Farnsworth CC. Prenyl proteins in eukaryotic cells: A new type of membrane anchor. Trends Biochem Sci 1990;15:139–142.[CrossRef][Medline]

  12. Lowy DR, Willumsen BM. Protein modification: New clue to Ras lipid glue. Nature 1989;341:384–385.[Medline]

  13. Manne V, Roberts D, Tobin A et al. Identification and preliminary characterization of protein-cysteine farnesyltransferase. Proc Natl Acad Sci U S A 1990;87:7541–7545.[Abstract/Free Full Text]

  14. Moomaw JF, Casey PJ. Mammalian protein geranylgeranyltransferase. Subunit composition and metal requirements. J Biol Chem 1992;267:17438–17443.[Abstract/Free Full Text]

  15. Takai Y, Sasaki T, Matozaki T. Small GTP-binding proteins. Physiol Rev 2001;81:153–208.[Abstract/Free Full Text]

  16. Hori Y, Kikuchi A, Isomura M et al. Post-translational modifications of the C-terminal region of the rho protein are important for its interaction with membranes and the stimulatory and inhibitory GDP/GTP exchange proteins. Oncogene 1991;6:515–522.[Medline]

  17. Takeda N, Kondo M, Ito S et al. Role of RhoA inactivation in reduced cell proliferation of human airway smooth muscle by simvastatin. Am J Respir Cell Mol Biol 2006;35:722–729.[Abstract/Free Full Text]

  18. Liu L, Moesner P, Kovach NL et al. Integrin-dependent leukocyte adhesion involves geranylgeranylated protein(s). J Biol Chem 1999;274:33334–33340.[Abstract/Free Full Text]

  19. Tang D, Park HJ, Georgescu SP et al. Simvastatin potentiates tumor necrosis factor alpha-mediated apoptosis of human vascular endothelial cells via the inhibition of the geranylgeranylation of RhoA. Life Sci 2006;79:1484–1492.[CrossRef][Medline]

  20. Matzno S, Yasuda S, Juman S et al. Statin-induced apoptosis linked with membrane farnesylated Ras small G protein depletion, rather than geranylated Rho protein. J Pharm Pharmacol 2005;57:1475–1484.[CrossRef][Medline]

  21. Fernandez-Hernando C, Suarez Y, Lasuncion MA. Lovastatin-induced PC-12 cell differentiation is associated with RhoA/RhoA kinase pathway inactivation. Mol Cell Neurosci 2005;29:591–602.[CrossRef][Medline]

  22. Demierre MF, Higgins PD, Gruber SB et al. Statins and cancer prevention. Nat Rev Cancer 2005;5:930–942.[CrossRef][Medline]

  23. Liao JK. Clinical implications for statin pleiotropy. Curr Opin Lipidol 2005;16:624–629.[Medline]

  24. Chan KA, Andrade SE, Boles M et al. Inhibitors of hydroxymethylglutaryl-coenzyme A reductase and risk of fracture among older women. Lancet 2000;355:2185–2188.[CrossRef][Medline]

  25. Wolozin B, Kellman W, Ruosseau P et al. Decreased prevalence of Alzheimer disease associated with 3-hydroxy-3-methyglutaryl coenzyme A reductase inhibitors. Arch Neurol 2000;57:1439–1443.[Abstract/Free Full Text]

  26. Crouse JR 3rd, Byington RP, Furberg CD. HMG-CoA reductase inhibitor therapy and stroke risk reduction: an analysis of clinical trials data. Atherosclerosis 1998;138:11–24.[CrossRef][Medline]

  27. Song C, Guo Z, Ma Q et al. Simvastatin induces osteoblastic differentiation and inhibits adipocytic differentiation in mouse bone marrow stromal cells. Biochem Biophys Res Commun 2003;308:458–462.[CrossRef][Medline]

  28. Mundy G, Garrett R, Harris S et al. Stimulation of bone formation in vitro and in rodents by statins. Science 1999;286:1946–1949.[Abstract/Free Full Text]

  29. Phillips BW, Vernochet C, Dani C. Differentiation of embryonic stem cells for pharmacological studies on adipose cells. Pharmacol Res 2003;47:263–268.[CrossRef][Medline]

  30. Phillips BW, Belmonte N, Vernochet C et al. Compactin enhances osteogenesis in murine embryonic stem cells. Biochem Biophys Res Commun 2001;284:478–484.[CrossRef][Medline]

  31. Yoshida-Koide U, Matsuda T, Saikawa K et al. Involvement of Ras in extraembryonic endoderm differentiation of embryonic stem cells. Biochem Biophys Res Commun 2004;313:475–481.[CrossRef][Medline]

  32. Nur-E-Kamal A, Ahmed I, Kamal J et al. Three-dimensional nanofibrillar surfaces promote self-renewal in mouse embryonic stem cells. STEM CELLS 2006;24:426–433.[Abstract/Free Full Text]

  33. Puceat M, Travo P, Quinn MT et al. A dual role of the GTPase Rac in cardiac differentiation of stem cells. Mol Biol Cell 2003;14:2781–2792.[Abstract/Free Full Text]

  34. Takahashi K, Mitsui K, Yamanaka S. Role of ERas in promoting tumour-like properties in mouse embryonic stem cells. Nature 2003;423:541–545.[CrossRef][Medline]

  35. Etienne-Manneville S, Hall A. Rho GTPases in cell biology. Nature 2002;420:629–635.[CrossRef][Medline]

  36. Kato T, Hashikabe H, Iwata C et al. Statin blocks Rho/Rho-kinase signalling and disrupts the actin cytoskeleton: relationship to enhancement of LPS-mediated nitric oxide synthesis in vascular smooth muscle cells. Biochim Biophys Acta 2004;1689:267–272.[Medline]

  37. Schmidmaier R, Baumann P, Simsek M et al. The HMG-CoA reductase inhibitor simvastatin overcomes cell adhesion-mediated drug resistance in multiple myeloma by geranylgeranylation of Rho protein and activation of Rho kinase. Blood 2004;104:1825–1832.[Abstract/Free Full Text]

  38. Hall A. Rho GTPases and the actin cytoskeleton. Science 1998;279:509–514.[Abstract/Free Full Text]

  39. Vouret-Craviari V, Bourcier C, Boulter E et al. Distinct signals via Rho GTPases and Src drive shape changes by thrombin and sphingosine-1-phosphate in endothelial cells. J Cell Sci 2002;115:2475–2484.[Abstract/Free Full Text]

  40. Leabu M, Uniyal S, Xie J et al. Integrin alpha2beta1 modulates EGF stimulation of Rho GTPase-dependent morphological changes in adherent human rhabdomyosarcoma RD cells. J Cell Physiol 2005;202:754–766.[CrossRef][Medline]

  41. Tanaka T, Tatsuno I, Noguchi Y et al. Activation of cyclin-dependent kinase 2 (Cdk2) in growth-stimulated rat astrocytes. Geranylgeranylated Rho small GTPase(s) are essential for the induction of cyclin E gene expression. J Biol Chem 1998;273:26772–26778.[Abstract/Free Full Text]

  42. Yoshida T, Asanuma M, Grossmann L et al. Geranylgeranyl-pyrophosphate (GGPP) synthase is down-regulated during differentiation of osteoblastic cell line MC3T3–E1. FEBS Lett 2006;580:5203–5207.[CrossRef][Medline]

  43. Yoshida M, Sawada T, Ishii H et al. Hmg-CoA reductase inhibitor modulates monocyte-endothelial cell interaction under physiological flow conditions in vitro: involvement of Rho GTPase-dependent mechanism. Arterioscler Thromb Vasc Biol 2001;21:1165–1171.[Abstract/Free Full Text]

  44. Cordle A, Koenigsknecht-Talboo J, Wilkinson B et al. Mechanisms of statin-mediated inhibition of small G-protein function. J Biol Chem 2005;280:34202–34209.[Abstract/Free Full Text]

  45. Stamatakis K, Cernuda-Morollon E, Hernandez-Perera O et al. Isoprenylation of RhoB is necessary for its degradation. A novel determinant in the complex regulation of RhoB expression by the mevalonate pathway. J Biol Chem 2002;277:49389–49396.[Abstract/Free Full Text]

  46. Riento K, Ridley AJ. Rocks: Multifunctional kinases in cell behaviour. Nat Rev Mol Cell Biol 2003;4:446–456.[CrossRef][Medline]




This article has been cited by other articles:


Home page
 J. Immunol.Home page
S. Waiczies, I. Bendix, T. Prozorovski, M. Ratner, I. Nazarenko, C. F. Pfueller, A. U. Brandt, J. Herz, S. Brocke, O. Ullrich, et al.
Geranylgeranylation but Not GTP Loading Determines Rho Migratory Function in T Cells
J. Immunol., November 1, 2007; 179(9): 6024 - 6032.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
2006-0753v1
25/7/1654    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints/Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, M.-H.
Right arrow Articles by Han, Y.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, M.-H.
Right arrow Articles by Han, Y.-M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
STEM CELLS THE ONCOLOGIST